Identification of Nuclear Factor-κB Pathway Genes in Chicken Erythrocytes and their Expression Level in Erythrocytes after

Infection with Mycoplasma synoviae

Afrasyab Khan1,3, Ali Raza Jahejo1,3, Meng-li Qiao1,3, Xin-yu Han1,3, Raza Ali Mangi1,3, Ding Zhang1,3, Yu-hai Bi2, George F Gao1,3* and Wen-xia Tian1,3*

1College of Veterinary Medicine, Shanxi Agricultural University, Jinzhong 030801, China

2CAS Key Laboratory of Pathogenic Microbiology and immunology, Collaborative Innovation Center of Infectious Diseases, Institute of Microbiology, Center for Influenza Research and Early-Warning (CASCIRE), Chinese Academy of Science, Beijing 100101, China

3Shanxi Key Laboratory of Protein Structure Determination, Shanxi Academy of Advanced Research and Innovation, Taiyuan 030032, China

ABSTRACT

Mycoplasma synoviae is one of the most important pathogens in the poultry industry and often causes diseases of a chronic and persistent nature. However, there is limited data available on Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) signaling pathway genes expression in chicken erythrocytes infected with Mycoplasma synoviae (M. synoviae). Therefore, the aim of the current in-vitro study was to determine the interaction between chicken erythrocytes and M. synoviae using Transmission electron microscope (TEM) and further to investigate the mRNA gene expression of MyD88 (Myeloid differentiation primary response 88), CCL5 (C-C Motif Chemokine Ligand 5), MDA5 (melanoma differentiation-associated protein 5) IKBKE (inhibitor of nuclear factor kappa-B kinase subunit epsilon), NFKBIA (NF-kappa-B inhibitor alpha), NFKBIE (NF-kappa-B inhibitor epsilon), Interferon Alpha (IFN-α), cMGF (chicken myelomonocytic growth factor), and TRAF6 (Tumor necrosis factor receptor-associated factor 6) in chicken erythrocytes infected with M. synoviae using quantitative real-time PCR (qRT-PCR) at four different time intervals (0, 2, 6 and 10 h) post-infection and compared to uninfected controls. The results indicated that M.synoviae interacted efficiently in chicken erythrocytes, which strongly induced the up-regulation of NF-κB pathway and other immune system genes in response to early bacterial infection such as NFKBIA, NFKBIE, IKBKE, CCL5, MDA5, MyD88, and TRAF6 at different h’s interval. Whereas cMGF and IFN-α expression were significantly downregulated during early time intervals such as 0 h, 2 h and 6 h while later on the expression level significantly increased. These results will lead to increased insights on M. synoviae infection resistance mechanisms and the role of NF-κB signaling pathway and other immune system genes in the control of the host immune response.


Article Information

Received 10 November 2020

Revised 15 January 2022

Accepted 10 February 2022

Available online 05 January 2023

(early access)

Published 29 January 2024

Authors’ Contribution

AK drafted the basic manuscript and analyzed the data. WXT and GFG contributed to conception and design of the research and reviewed the manuscript. YHB reviewed the manuscript. RAM and XYH participated in sample collection and laboratory testing. ARJ, DZ and MLQ analysed the data and revised the manuscript. All authors read and approved the final manuscript.

Key words

Chicken, Erythrocytes, Mycoplasma synoviae, Transmission electron microscope quantitative real time PCR, NF-κB signaling pathway

DOI: https://dx.doi.org/10.17582/journal.pjz/20201110141107

* Corresponding author: [email protected], [email protected]

0030-9923/2024/0002-0759 $ 9.00/0

Copyright 2024 by the authors. Licensee Zoological Society of Pakistan.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).



Introduction

Erythrocytes in circulation are the most abundant cells which plays critical role in the exchange and transportation of gases. In the blood, erythrocytes are the key bactericidal cells, which perform pathogens clearance in bloodstream. They attract, engulf, kill and then push killed microorganisms back to blood plasma (Minasyan, 2014). Furthermore, many studies stated that in immunology, an important role is played by chicken erythrocytes (Paolucci et al., 2013). Indeed, it was shown that candida albicans stimulated erythrocytes released mediators which in turn enhanced phagocytic capabilities after macrophage activation (Passantino et al., 2007). Additionally, in erythrocytes several TLRs transcripts were constitutively expressed (Paolucci et al., 2013).

Mycoplasma synoviae is a significant pathogen of domestic poultry, leads to huge economic losses in poultry industry (Kleven, 2008; Umar et al., 2017). Infection mainly occurs as a subclinical upper respiratory tract infection, but when virulent M. synoviae strains are involved along with other respiratory pathogens, may leads to respiratory disease with air saculitis (Lockaby et al., 1999). Whereas, acute to chronic infectious synovitis can occur as a results of systemic infection in poultry birds (Kleven., 2008). Most importantly, the birds remain carriers for life after being persistently infected with M. synoviae (Raviv et al., 2007; Umar et al., 2017). It has been reported that several immune genes are modulated in response to M. synoviae infection in chicken macrophages (Lavrič et al., 2007; 2008).

Innate immunity is the first line of defense against invading pathogens. After TLRs detect the microbial components, they recruit adaptor proteins to active the NF-κB pathway (Kawai and Akira, 2007). Nuclear factor-κB (NF-κB) represents a family of inducible transcription factors, which regulates a large array of genes involved in different processes of the immune and inflammatory responses (Oeckinghaus et al., 2009) NF-κB induces the expression of various pro-inflammatory genes, including those encoding cytokines and chemokines, and also participates in inflammasome regulation. In addition, NF-κB plays a critical role in regulating the survival, activation and differentiation of innate immune cells and inflammatory T cells. Consequently, deregulated NF-κB activation contributes to the pathogenic processes of various inflammatory diseases (Liu et al., 2017).

 The activation of NF-κB involves two major signaling pathways, the canonical and noncanonical (or alternative) pathways, both being important for regulating immune and inflammatory responses despite their differences in signaling mechanism (Sun, 2017; Vallabhapurapu and Karin, 2009). The canonical NF-κB pathway responds to stim- uli from diverse immune receptors and leads to rapid but transient NF-κB activation (Hayden and Ghosh, 2008; Vallabhapurapu and Karin, 2009; Hu and Sun, 2016). The non-canonical NF-κB pathway regulates important aspects of immune functions, including lymphoid organ development, the cross-priming function of dendritic cells, B cell survival and germinal center reactions, generation and maintenance of effector and memory T cells, and antiviral innate immunity (Sun, 2017). A well-recognized function of NF-κB is regulation of inflammatory responses. In addition to mediating induction of various pro-inflammatory genes in innate immune cells, NF-κB regulates the activation, differentiation and effector function of inflammatory T cells (Lawrence, 2009; Tak and Firestein, 2001). Recent evidence suggests that NF-κB also has a role in regulating the activation of inflammasomes (Sutterwala et al., 2014).

Our earlier studies have reported that in immunity against thiram induced TD chickens, the main role had been played by chicken erythrocytes, which may also have a role in apoptosis (Jahejo et al., 2020b; Tian et al., 2013; Wang et al., 2018). In addition, chicken erythrocytes express TLRs 2, 3, 4, 5, 7 and possess immune related functions (Paolucci et al., 2013). However, till date there was no evidence, whether NF-κB signaling pathway and other immune system genes expressed in M. synoviae infected chicken’s erythrocytes or not and how M. synoviae affects their genes expressions. Therefore, in current study we planned to determine the interaction between M. synoviae and erythrocytes and further to determine the effect of M. synoviae strain on the mRNA expression of NF-κB signaling pathway and other immune system genes in chicken erythrocytes.

MATERIALS AND METHODS

Erythrocyte collection

Blood was obtained from Specific pathogen free (SPF) chickens purchased from Longkol Company (Taigu, Shanxi). In the same volume of Alsever’s solution (Solarbio, Beijing, China), about 4 mL of fresh venous blood from pterygoid vein of adult SPF chicken was drawn and mixed. To the 4 mL Histopaque-1119 solution (Sigma–Aldrich, Oakville, ON), the diluted blood was carefully added following centrifugation at 2000 r/min for 20 min; consequently, the leukocytes and platelets were removed from the supernatant. Later procedures were done as previously described (Kabanova et al., 2009). Moreover, via Wright Giemsa staining 99.9% purity of isolated erythrocytes were determined.

Treatment of Mycoplasma

About 8 mL of FM-4 mycoplasma culture medium was taken during log phase (the medium has just turned yellow). The concentration of mycoplasma was about 1×106-1×107 mL, followed by centrifugation at 12000 r/min 15min, later supernatant was discarded. After washing twice with PBS again centrifuge at 12000 r/min for 10 min. Lastly cells were than cultured in 98% Dulbecco’s Modified Eagle Medium (DMEM) (Solarbio, Beijing, China), added with 2% fetal bovine serum (FBS) and 2% chicken serum (Longkol, Shanxi, China).

Experimental infection of chicken erythrocytes (CER)

Total 50 µl of erythrocytes were obtained from specific pathogen free (SPF) chickens purchased from Longkol Company (Taigu, Shanxi) in a sixteen 2 mL centrifuge tube containing a certain amount of cell maintenance solution, and distributed into four groups i.e., 0, 2, 6 and 10 h. The experiment was performed in an Animal Biosafety Level 2 Laboratory. To an experimental group, 100 ul of M. synoviae was added into all experimental four groups with the addition of 900 µl of DMEM to make the final volume 1050 µl. Whereas to the another four group M. synoviae was not added and designated as control group. The cells were then cultured at 37 °C in 5% CO2 incubator, and each of the respective group was taken out at 0 h, 2 h, 6 h, and 10 h, respectively after the centrifugation for 10 min at 2000 r/min. To the Eppendorf tubes supernatants was drawn and stored. Furthermore, 3 times washing of erythrocytes were done with PBS and stored for upcoming experiments.

Identification of interaction between M. synoviae and erythrocytes using Transmission Electron Microscope (TEM)

TEM was performed as described previously (Strunov et al., 2016). Briefly, erythrocytes were isolated at 2000 r/min for 10 min and washed 3 times for transmission electron microscopy. The samples were then fixed and sent to Shanxi Medical University for testing where, the ultrastructure was observed in JEM-1400 (JEOL Ltd., Tokyo, Japan) TEM.

Total RNA extraction from chicken erythrocytes, and synthesis of cDNA

From blood samples taken at 0 h, 2 h, 6 h and 10 h from both an experimental and control groups the total RNAs was extracted from erythrocytes that were isolated by RNAiso Plus (Takara Bio Inc., Dalian, China) by following the instructions of the manufacturer, and then dissolved in 20 μL RNase-free water. The extracted RNAs purity and quantity were initially examined through a NanoDrop Bioanalyzer ND1000 (Labtech, Uckfield, UK) and via 1.5% agarose gel electrophoresis. Furthermore, from 500 ng total RNA, the PrimeScript RT reagent Kit with gDNA Eraser (Takara Bio Inc., Dalian, China) was used to reverse transcribe the total RNAs to cDNA according to the procedures recommended by the manufacturer. The cDNA samples were then stored at − 20°C after diluted at 1:10 in RNase-free water.

Analysis of mRNA expression of NF-κB signaling pathway and other immune system genes by quantitative real-time PCR (qRT-PCR)

The qRT-PCR was used for the NF-κB signaling pathway and other immune system genes expression analysis, using real-time RT-PCR kit (TaKaRa SYBR Premix Ex Taq™II (Takara Bio Inc.). Primer Express 3.0 (Applied Biosystems, Foster City, CA, USA) was used to designed primers of TLR’s and other immunity-related genes according to the respective chicken genes coding sequences in NCBI and manufactured by Shanghai Generay Biotech Co., Ltd. (Shanghai, China). Thorough info of the NF-κB signaling pathway and other immune system genes primers and annealing temperature fixed in this experiment along with GenBank accession numbers of the reference sequences are presented in Table I. For qRT-PCR, the thermal cycling parameters used were described previously (Sheng et al., 2018). The expression level of NF-κB

 

Table I. Primer sequences and accession numbers used in quantitative RT- PCR.

Gene targeted

Primers sequences (5′→3′)

Sizes (bp)

Annealing temp.

Accession number

NFKBIA

F: CACCAACTACAACGGCCATA

R: TGAAGGTCTACGGCCAAGTG

100

55 ̊ C

NM_001001472.2

IKBKE

F: GCAGCAGGATGAGGAAAGTCT

R: CGTACGATACCGACTTCATCTG

100

55 ̊ C

XM_015299066.2

NFKBIE

F: CGGTGACACGTTGGTTCA

R: CTGGGCTGCTCCAGATAGA

100

55 ̊ C

XM_419490.6

IFN α

F: CCACACCTTCCTCCAAGACA

R: GCCTGTGAGGTTGTGGATGT

100

55 ̊ C

EU367971

MYD88

F: CAGAAAGACCTTCAGTTTGTCCA

R: AATGACGACCACCATCCTCC

165

55 ̊ C

NM_001030962

MDA5

F: GAGTTTGGATCTCAGCCATA

R: TCAAGTGTTCTGCACAGACA

100

55 ̊ C

GU570144.1

CCL5

F: TGATACAACCGTGTGCTGCTT

R: TGCTGCCTGTGGGCATTT

100

55 ̊ C

NM_001045832.1

TRAF 6

F: ATGGAAGCCAAGCCAGAGTT

R: ACAGCGCACCAGAAGGGTAT

144

55 ̊ C

XM015287208

cMGF

F: CAATCACACGACGTTGGTT

R: GGATGTTGGAGGAGAGGTT

62

55 ̊ C

M85034

18SrDNA

F: TTCCGATAACGAACGACAC

R: GACATCTAAGGGCATCACAG

139

55 ̊ C

FM165414

 

signaling pathway and other immune system genes relative to the 18S rRNA housekeeping gene was calculated by the QuantStudio™ 6 Flex Real-Time PCR System Software (Applied Biosystems, USA).

Statistical analysis

The real time PCR data was calculated using 2−ΔΔCt method. The data obtained between control and experiment groups for each time point post-infection was employed to Two-way ANOVA to perform statistical analysis. All graphs were accomplished using GraphPad Prism 5. Significant differences were measured once the p-value was *P < 0.05, **P < 0.01 or P*** ≤ 0.001

Results

Interaction between M. synoviae and erythrocytes

For TEM analysis, we have chosen non-infected chicken erythrocytes and infected chicken erythrocytes with M. synoviae. Control erythrocyte was distributed uniform cytoplasm as shown in control section of Figure 1A. But erythrocyte infected with M. synoviae contain endosome as shown in Figure 1B. it was determined that M. synoviae interacted with erythrocyte.

Expression of NF-κB signaling pathway and other immune system genes

The relative mRNA expression levels of NF-κB signaling pathway genes and other immune system genes in chicken erythrocytes following infection with M. synoviae were analyzed and presented in Figure 1 to investigate the degree of effect on gene expression in chicken erythrocytes after interaction with M. synoviae. We found that the expression levels of NF-κB signaling pathway genes and other immune functioning genes were significantly varied at different time intervals such as 0 h, 2 h, 6 h, 10-h post-infection (Hpi). The qRT-PCR results indicated that relative mRNA expression of NFKBIA, IKBKE and TRAF6 were significantly upregulated, whereas IFN-α and cMGF gene expression was significantly downregulated at 0-h -post-inoculation (hpi) (P < 0.05), compared to the control group erythrocytes. Moreover, at 2 hpi, the expression of NFKBIA, IKBKE, NFKBIE, MyD88 and MDA 5 were significantly upregulated (P < 0.05) while cMGF was significantly downregulated (P < 0.05). Relative mRNA expression of NFKBIA, CCL5, MDA5 and cMGF were significantly up-regulated (P < 0.05) compared to a control group at 6hpi. In contrast we observed significant downregulation (P < 0.05) of IKBKE and IFN-α at 6 hpi. Furthermore, the expression of NFKBIE, CCL5, TRAF6, IFN-α and MDA5 in infected erythrocytes at 10 hpi were also significantly upregulated (P < 0.05) while NFKBIA expression was significantly down-regulated (P < 0.05) at 10 hpi compared with the control group.

 

Discussion

M. synoviae infection emerges to cause considerable financial loses to worldwide poultry producers. M. synoviae infection controls numerous immune genes in chicken macrophages (Lavrič et al., 2007, 2008) and apoptotic genes in chicken chondrocytes (Dušanić et al., 2012). Recent studies reports stated that chicken erythrocytes actively participated in important aspects of host immunity (Jahejo et al., 2020; Paolucci et al.,2013). Optimal NF-κB activation is initiated by bacterial or viral infections through Toll-like receptors, phorbol 12-myristate 13-acetate, or interferon. This process involves the signal-induced phosphorylation and subsequent ubiquitin-mediated degradation of IκB by the classical IκB kinase (IKK)-dependent pathway (Perkins, 2007; Hayden and Ghosh, 2008;

 

Karin and Ben-Neriah, 2000). In the current study, for first time it was investigated that chicken erythrocytes constitutively expressed several different NF-kB pathway and other immune system genes (NFKBIA, NFKBIE, IKBKE, CCL5, MDA5, MyD88, TRAF6, IFN-α and cMGF) at the transcript level and responded to M. synoviae by up-regulating different genes expression at certain time interval. Therefore, this result offers a novel perspective for poultry health because, targeting such TLRs for therapeutic purposes can be one of the ways to defend chickens from infection of mycoplasmas, particularly, M. synoviae.

There are few reports regarding gene expression of NFKBIA, NFKBIE and IKBKE during bacterial infection. However, genetic variations within NFKBIA, NFKBIE and IKBKE have been shown to influence susceptibility to invasive bacterial infection (Zimmerman et al., 2010). The expression of NFKBIA was significantly upregulated during early h of infection (0 h, 2 h and 6 h) while there was significant downregulated expression at 10 h post infection on M. synoviae infection in chicken erythrocytes. Exposure of cells to various stimulants resulting in release of NF-κB from inhibitor IKB that controls NF-κB activity. Signals activate NF-κB by targeting IKB for proteolysis (Asakrah et al., 2013). An NF-κB dependent host response was shown by the significant differential expression of NFKBIA. Phosphorylation and the subsequent ubiquitination of IKB, the gene product of the NFKBIA gene, are known as key processes required for regulating the innate immune system (Bhoj and Chen, 2009). Furthermore, our results are in agreement with (Tripathi et al., 2009) who reported that erythrocytes infected with plasmodium Falciparum upregulates the expression of NF-κB pathway genes including NFKBIA, NFKBIE in humans.

The kinase was first identified as an IKK kinase family member of the NF-κB activation by lipopolysaccharides and phorbolesters (Shimada et al., 1999; Peters et al., 2000). IKBKE (IKKE, IKKi) is a non-canonical I-kappa-B kinase which can be activated by numerous stimuli (Boehm et al., 2007). IKBKE mainly mediates NF-κB activation induced by the T cell receptor, phorbol 12-myristate 13-acetate, or interferon. In current study we observed dramatic expression pattern differences of the NF-κB related gene such as IKBKE whose expression was significantly upregulated at 0h and 2h while at 10 h post-infection the expression was significantly downregulated in infected erythrocytes. Previously it was reported that most of the bacterial diseases induces NF-κB related gene expression (Wang et al., 2017). Furthermore, (Verhelst et al., 2013; Kim et al., 2014) reported that IKBKE was a major NF-κB signaling mediator. As the significant upregulation of most of NF-κB pathway genes (NFKBIA, NFKBIE and IKBKE) were detected, it seems that NF-κB pathway was activated in the chicken erythrocytes after M. synoviae infection. This study results suggests that NF-κB related genes may play key roles in regulating the immune response to bacterial infection in chickens.

The expression of NFKBIE gene was also significantly upregulated at certain time interval (2 h and 10 h) post infection in response to M. synoviae infected erythrocytes. This finding could be supported by biological knowledge since NF-κB signaling that is inhibited by NFKBIE is transcriptional factor involved in inflammatory immune response (Guthke et al., 2005). Moreover, it was also reported that NFKBIE itself is upregulated at mRNA level by TNF, whose over expression is feature of inflammatory diseases (Rao et al., 2010).

IFNs are cytokines produced in response to viral, bacterial, and fungal pathogens, as well as parasites. The effector mechanisms of IFN-α mainly derive from products of genes which are transcriptionally regulated by type I IFN signaling. Bacteria trigger type I IFN (IFN-α) production mostly following the recognition of bacterial nucleic acids or the Gram-negative cell wall component lipopolysaccharide (LPS) by innate immune receptors (Boxx and Cheng, 2016; Monroe et al., 2010). Our results revealed that IFN-α can be expressed in chicken erythrocytes in response to M. synoviae infection. Interestingly, we observed decreased expression level during early stage of infection (0 h, 2 h and 6 h) surprisingly; expression level increased significantly at later stage (10 h) post infection. It was recently found that chicken erythrocytes constitutively express transcripts for many TLRs as well as for some cytokines such as IFN-α, IFN-β, and IL-8 (Paolucci et al., 2013).

Our study result also reveals the significant up-regulation of MyD88 mRNA gene expression in chicken erythrocytes in response to M. synoviae strain. Previously it was reported that MyD88 gene constitutively expressed on almost all tissues (Hardiman et al.,1997). Likewise, it was shown previously that in spleen and thymus MyD88 gene was expressed higher, which is consistent with results of mouse and human (Hardiman et al., 1996, 1997). Previous studies also suggested an important role of MyD88 gene expression in NF-kB activation in-vitro in the chicken innate immune response to bacterial infections (Yafeng et al., 2008). Recently it was also stated that all TLR 3 employ the MyD88 dependent pathway (O’neil, 2006). The significant upregulation of MyD88 in erythrocyte suggested that this adaptor molecule plays an important role to induce an innate immune response to M. synoviae infection.

There is increasing evidence that MDA5 have additional distinct molecular functionalities in immune signaling (Kasumba and Grandvaux, 2018). It is well-established that the interferon regulatory factor (IRF) and innate immune NF-κB cytokine signaling pathways have many areas of cross-regulation and expression (Czerkies et al., 2018). Accordingly, MDA5 have been shown to activate NF-κB signaling during infection (Yoboua et al., 2010; Rückle et al., 2012). In current in-vitro study for first time it was reported that in M. synoviae infected chicken erythrocytes expression of MDA5 was upregulated in response to bacterial infection. Our results are in agreement with (Ye et al., 2018), their results showed up-regulated MDA5 expression after using a synthetic bacterial analog, Lipopolysaccharide (LPS), representing stimulation by Gram-negative bacteria. Several studies concurrently showed that LPS or bacterial challenge resulted in up-regulation of fish MDA5, such as common carp (Cyprinus carpio) challenged with Aeromonas hydrophila (Imaizumi et al., 2002). Furthermore, chicken MDA5 is ubiquitously expressed highest in intestine (Su et al., 2010; Huang et al., 2010). Hence, such results suggesting that MDA5 might not be involved exclusively in recognizing viral PAMPS, but they are also capable of indirectly distinguishing bacterial PAMPs chickens.

CCL5, a target gene of NF-κB activity, is expressed by T lymphocytes, macrophages, platelets, synovial fibroblasts, tubular epithelium, and certain types of tumor cells (Soria and Ben-Baruch, 2008). NF-κB activation by different stimuli such as CD40 (Aldinucci et al., 2012; or IL-15 Chenoweth et al., 2012) induces CCL5 production. In current in-vitro study, infection of erythrocytes with M. synovie in chicken significantly upregulated the mRNA expression of CCL5. Previously upregulated expression of CCL5 was reported by (Majumder and Silbart, 2015) in chicken macrophages upon direct contact of HD-11 cells with M. gallisepticum. In addition, in 4T1 tumour cells CCL5 was constitutively expressed with upregulated expression (Kurt et al., 2001), suggesting that in resistance to immune-surveillance high levels of CCL5 may play an important role (Adler et al., 2003). Moreover, higher expression of CCL5 gene maybe due to its transcriptional activation that critically dependent on NF- κB signaling pathway (Dandan et al., 2013).

TRAF6 has been linked to the function of various immune effector cells. Previous studies have shown that TRAF6 regulates several signaling cascades involved in adaptive immunity and innate immunity (Ye et al., 2002). TRAF6 recognizes different binding sites of CD40 and receptor activator of nuclear factor kB, and other members of the TNFR superfamily (Pullen et al., 1998). In addition, MDA5 signaling pathway requires the mitochondrial protein ISP-1 to form a signaling complex with TRAF6, which leads to the activation of TRAF6 and initiation of the innate immune response (West et al., 2011). In our study the expression of TRAF6 was significantly upregulated in response to M. synoviae infected erythrocytes, suggesting that TRAF6 is essential for the induction of effective innate immune responses in chicken erythrocytes. Previously it was observed that abundant TRAF6 expression was in the spleen, largest lymph organ, in mice, ducks and humans, suggesting that TRAF6 could be a vital factor for the immune system (Jin et al., 2017). In addition, (Stockhammer et al., 2010) revealed that in immune-related tissue, such as thymus, spleen and bursa of Fabricius the mRNA expression of TRAF6 was highest, indicated an innate immune response mediated by TRAF6 in chickens to pathogenic challenges. Hence, TRAF6 expression indicated that chicken erythrocytes might have an important role in chicken defense against bacterial infections.

Lastly, in the current study, we examined the mRNA gene expression of cMGF in infected chicken erythrocytes. Our results revealed for the first time that M.synoviae infected chicken erythrocytes, there is down regulation of cMGF gene in the early phase such as 0h and 2h post infection while with passage of time expression enhanced significantly in later time intervals when compared with an uninfected group. cMGF is a 27-kDa glycoprotein that was first described regarding its capability to encourage the growth of macrophage and granulocyte colonies from avian bone marrow progenitor cells in vitro (Leutz et al., 1984). Previously it was reported the involvement of cMGF in the innate immune response through enhancing monocyte or macrophages quantity and activation, resulting in the production of NO with antiviral activity (Djeraba et al., 2002). Furthermore, it was also declared that cMGF is required for survival and growth for normal and transformed avian myelomonocytic cells (Leutz et al., 1984, 1988). Together, all these results show that chicken erythrocytes may have the potential to respond to bacterial infectious agents.

Conclusion

This in vitro study provided the first evidence that M. synoviae interacts with chicken erythrocytes which can also constitutively express NF-kB signaling and other immune system genes. Expression of most of NF-κB signaling pathway and other immune system genes were significantly regulated in chicken erythrocytes after M. synoviae infection, indicating their involvement in immune response to bacterial infection. Future studies may be planned to understand how NF-κB signaling and other immune system genes respond to bacterial infections in chicken erythrocytes and their roles in the host’s immunity.

Acknowledgement

This work was supported by the Shanxi Key R&D Program (202102130501001), the China-U.S. Collaborative Program on Emerging and Reemerging Infectious Diseases (E090090201-3, E2900901-02), “131” Leading Talent project for College and Universities of Shanxi Province, the Fund for Shanxi “1331 Project” (20211331-3), the special fund for Science and Technology Innovation Teams of Shanxi Province and Shanxi Key Laboratory of Protein Structure Determination (202104010910006).

Statement of conflict of interest

The authors have declared no conflict of interest .

References

Adler, E.P., Lemken, C.A., Katchen, N.S. and Kurt, R.A., 2003. A dual role for tumor derived chemokine RANTES (CCL5). Immunol. Lett., 90: 187– 194. https://doi.org/10.1016/j.imlet.2003.09.013

Aldinucci, D., Gloghini, A., Pinto, A., Colombatti, A. and Carbone, A., 2012. The role of CD40/CD40L and interferon regulatory factor 4 in Hodgkin lymphoma microenvironment. Leuk. Lymphoma., 53: 195–201. https://doi.org/10.3109/10428194.2011.605190

Asakrah, S., Nieves, W., Mahdi Z., Mallory A., Arnold, H., Zea, C., Roy, J. and Lisa A., 2013. Post-exposure therapeutic efficacy of COX-2 inhibition against Burkholderia pseudomallei. PLoS Negl. Trop. Dis., 7: Article ID e2212. https://doi.org/10.1371/journal.pntd.0002212

Bhoj, V.G. and Chen, Z.J., 2009. Ubiquitylation in innate and adaptive immunity. Nature, 458: 430-437. https://doi.org/10.1038/nature07959

Boehm, J.S., Zhao, J.J., Yao, J., Kim, S.Y., Firestein, R., Dunn, I.F., Sjostrom, S.K., Garraway, L.A., Weremowicz, S., Richardson, A.L., Greulich, H., Stewart, C.J., Mulvey, L.A., Shen, R.R., Ambrogio, L., Hirozane-Kishikawa, T., Hill, D.E., Vidal, M., Meyerson, M., Grenier, J.K., Hinkle, G., Root, D.E., Roberts, T.M., Lander, E.S., Polyak, K. and Hahn, W.C., 2007. Integrative genomic approaches identify IKBKE as a breast cancer oncogene. Cell., 129(6): 1065-1079. https://doi.org/10.1016/j.cell.2007.03.052

Boxx, G.M. and Cheng, G., 2016. The roles of type I interferon in bacterial infectionCell Host. Microbe, 8: 760–769. https://doi.org/10.1016/j.chom.2016.05.016

Chen, Z.J., Parent, L. and Maniatis, T., 1996. Site-specific phosphorylation of I kappa B alpha by a novel ubiquitination-dependent protein kinase activity. Cell, 84: 853–862. https://doi.org/10.1016/S0092-8674(00)81064-8

Chenoweth, M.J., Mian, M.F., Barra, N.G., Tommy, A., Nahum, S., Jonathan, B., Brian, D.L., Carl, D.R., Averil, M. and Li, A., 2012. IL-15 can signal via IL-15Rα, JNK, and NF-κB to drive RANTES production by myeloid cells. J. Immunol., 188: 4149– 4157. https://doi.org/10.4049/jimmunol.1101883

Czerkies, M., Korwek, Z., Prus, W., Kochanczyk, M., Jaruszewicz-Błonska, J., Tudelska, K., Błoński, S., Kimmel, M., Brasier, A.R. and Lipniacki, T., 2018. Cell fate in antiviral response arises in the crosstalk of IRF, NF-kB and JAK/STAT pathways. Nat. Commun., 91: 493. https://doi.org/10.1038/s41467-017-02640-8

Djeraba, A., Musset, E., Lowenthal, J.W., Boyle, D.B., Chaussé, A.M., Péloille, M. and Quéré, P., 2002. Protective effect of avian myelomonocytic growth factor in infection with Marek’s disease virus. J. Virol., 76: 1062–1070. https://doi.org/10.1128/JVI.76.3.1062-1070.2002

Dušanić, D., Benčina, D., Oven, D., Cizelj, I., Benčina, M. and Narat, M., 2012. Mycoplasma synoviae induces upregulation of apoptotic genes, secretion of nitric oxide and appearance of an apoptotic phenotype in infected chicken chondrocytes. Vet. Res., 43: 7. https://doi.org/10.1038/cmi.2012.69

Guthke, R., Möller, U., Hoffmann, M., Thies, F. and Töpfer, S., 2005. Dynamic network reconstruction from gene expression data applied to immune response during bacterial infection. Bioinformatics, 21: 1626-1634. https://doi.org/10.1093/bioinformatics/bti226

Hardiman, G., Jenkins, N.A., Copeland, N.G., Gilbert, D.J., Garcia, D.K., Naylor, S.L., Kastelein, R.A. and Bazan, J.F., 1997. Genetic structure and chromosomal mapping of MyD88. Genomics, 45: 332–339. https://doi.org/10.1006/geno.1997.4940

Hardiman, G., Rock, F.L., Balasubramanian, S., Kastelein, R.A. and Bazan, J.F., 1996. Molecular characterization and modular analysis of human MyD88. Oncogene, 13: 2467–2475.

Hayden, M.S. and Ghosh, S., 2008. Shared principles in NF-kappaB signaling. Cell, 132: 344–362. https://doi.org/10.1016/j.cell.2008.01.020

Hu, H. and Sun, S.C., 2016. Ubiquitin signaling in immune responses. Cell Res., 26: 457–483. https://doi.org/10.1038/cr.2016.40

Huang, T., Su, J., Heng, J., Dong, J., Zhang, R. and Zhu, H., 2010. Identification and expression profiling analysis of grass carp Ctenopharyngodon idella LGP2 cDNA. Fish Shellf. Immunol., 29: 349–355. https://doi.org/10.1016/j.fsi.2010.04.001

Imaizumi, T., Aratani, S., Nakajima, T., Carlson, M., Matsumiya, T., Tanji, K., Ookawa, K., Yoshida, H., Tsuchida, S., McIntyre, T.M., Prescott, S.M, Zimmerman, G.A. and Satoh, K., 2002. Retinoic acid-inducible gene-I is induced in endothelial cells by LPS and regulates expression of COX-2. Biochem. Biophys. Res. Commun., 292: 274–279. https://doi.org/10.1006/bbrc.2002.6650

Jahejo, AR., Zhang, D., Niu, S., Mangi, RA., Khan, A., Qadir, M. F., Khan, A., Chen, H.C., Tian, W.X., 2020b. Transcriptome-based screening of intracellular pathways and angiogenesis related genes at different stages of thiram induced tibial lesions in broiler chickens. BMC. Genomics, 21: 1-15. https://doi.org/10.1186/s12864-020-6456-9

Jahejo, AR., Zhang, D., Niu, S., Mangi, RA., Khan, A., Qadir, M.F., Khan, A., Chen, H.C. and Tian, W.X., 2020. Transcriptome-based screening of intracellular pathways and angiogenesis related genes at different stages of thiram induced tibial lesions in broiler chickens. BMC Genomics, 21: 1-15. https://doi.org/10.1186/s12864-020-6456-9

Jin, J., Ran, J.S., Yang, C., Jiang, X.S., Zhou, Y.G., Feng, Z.Q., Wang, Y., Lan, D., Ren, P. and Liu, Y.P., 2017. Molecular characterization, expression, and functional analysis of chicken TRAF6. Genet. mol. Res.., 16: 10, 4238/gmr16019138. https://doi.org/10.4238/gmr16019138

Kabanova, S., Kleinbongard, P., Volkmer, J. andrée, B., Kelm, M. and Jax, T.W., 2009. Gene expression analysis of human red blood cells. Int. J. med. Sci., 6: 156. https://doi.org/10.7150/ijms.6.156

Karin, M. and Ben-Neriah, Y., 2000. Phosphorylation meets ubiquitination: The control of NF-kappaB activity. Annu. Rev. Immunol., 18: 621–663. https://doi.org/10.1146/annurev.immunol.18.1.621

Kasumba, D.M. and Grandvaux, N., 2008. Therapeutic targeting of RIG-I and MDA5 might not lead to the same Rome. Trends Pharmacol. Sci., 40: 116–127. https://doi.org/10.1016/j.tips.2018.12.003

Kawai, T. and Akira, S., 2007. Signaling to NF-kB by toll-like receptors. Trends Mol. Med., 13: 460-469. https://doi.org/10.1016/j.molmed.2007.09.002

Kim, D., Guo, J., Challa, S., Coppola, D. and Cheng, J.Q., 2014. IKBKE is a key mediator of Ras activation of NF-kB and Ras oncogenic function. Cancer Res., 74: 4416–4416. https://doi.org/10.1158/1538-7445.AM2014-4416

Kleven, S.H., 2008. Control of avian mycoplasma infections in commercial poultry. Avian Dis., 52: 367–374. https://doi.org/10.1637/8323-041808-Review.1

Kurt, R.A., Baher, A., Wisner, K.P., Tackitt, S. and Urba, W.J., 2001. Chemokine receptor desensitization in tumor-bearing mice. Cell. Immunol., 207: 81– 88. https://doi.org/10.1006/cimm.2000.1754

Lavrič, M., Benčina, D., Kothlow, S., Kaspers, B. and Narat, M., 2007. Mycoplasma synoviae lipoprotein MSPB, the N-terminal part of VlhA haemagglutinin, induces secretion of nitric oxide, IL-6 and IL-1β in chicken macrophages. Vet. Microbiol., 121: 278–287. https://doi.org/10.1016/j.vetmic.2006.12.005

Lavrič, M., Maughan, M.N., Bliss, T.W., Dohms, J.E., Benčina, D., Keeler, C.L., Jr. and Narat, M., 2008. Gene expression modulation in chicken macrophages exposed to Mycoplasma synoviae or Escherichia coli. Vet. Microbiol., 126: 111–121. https://doi.org/10.1016/j.vetmic.2007.06.011

Lawrence, T., 2009. The nuclear factor NF-kappaB pathway in inflammation. Cold Spring Harb. Perspect. Biol., 1: a001651. https://doi.org/10.1101/cshperspect.a001651

Leutz, A., Beug, H. and Graf, T., 1984. Purification and characterization of cMGF, a novel chicken myelomonocytic growth factor. EMBO J., 3: 3191– 3197. https://doi.org/10.1002/j.1460-2075.1984.tb02278.x

Leutz, A., Beug, H., Walter, C. and Graf, T., 1988. Hematopoietic growth factor glycosylation: multiple forms of chicken myelomonocytic growth factor. J. biol. Chem., 263: 3905-3911. https://doi.org/10.1016/S0021-9258(18)69011-8

Liu, T., Zhang, L., Joo, D. and Sun, S.C., 2017. NF-κB signaling in inflammation. Signal Transduct. Target Ther., 2: 17023. https://doi.org/10.1038/sigtrans.2017.23

Lockaby, S.B., Hoerr, F.J., Lauerman, L.H., Smith, B.F., Samoylov, A.M., Toivio-Kinnucan, M.A. and Kleven, S.H., 1999. Factors associated with virulence of Mycoplasma synoviae. Avian Dis., 43: 251–261. https://doi.org/10.2307/1592615

Lv, D., Zhang, Y., Kim, H.J., Zhang, L. and Ma, X., 2013. CCL5 as a potential immunotherapeutic target in triple-negative breast cancer. Cell. Mol. Immunol., 10: 303–310. https://doi.org/10.1038/cmi.2012.69

Majumder, S. and Silbart, L., 2015. Mycoplasma gallisepticum’s interaction with chicken tracheal epithelial cells contributes to macrophage chemotaxis and activation. Infect. Immun., 84: IAI.01113-15. https://doi.org/10.1128/IAI.01113-15

Minasyan, H., 2014. Erythrocyte and blood antibacterial defense. Eur. J. Microbiol. Immunol., 4: 138–143. https://doi.org/10.1556/EuJMI.4.2014.2.7

Monroe, K.M., McWhirter, S.M. and Vance, R.E., 2010. Induction of type I interferons by bacteriaCell Microbiol., 12: 881–890. https://doi.org/10.1111/j.1462-5822.2010.01478.x

Niu, S., Jahejo, A.R., Jia, F.J., Li, X., Ning, G.B., Zhang, D., Ma, H.L., Hao, W.f., Gao, W.W., Zhao, Y.J., Gao, S.M., I, GL., Li, J.H., Yan, F., Gao, R.K., Bi, Y.H., Han, L.X., Gao, G.F. and Tian, W.X., 2018. Transcripts of antibacterial peptides in chicken erythrocytes infected with Marek’s disease virus. BMC. Vet. Res., 14: 363. https://doi.org/10.1186/s12917-018-1678-7

O’Neill, L.A., 2006. How toll-like receptors signal: What we know and what we don’t know. Curr. Opin. Immunol., 18: 3–9. https://doi.org/10.1016/j.coi.2005.11.012

Oeckinghaus, A. and Ghosh, S., 2009. The NF-kappaB family of transcription factors and its regulation. Cold Spring Harb. Perspect. Biol., 1: a000034. https://doi.org/10.1101/cshperspect.a000034

Paolucci, S., Barjesteh, N., Wood, R.D. and Sharif, S., 2013. Chicken erythrocytes respond to toll-like receptor ligands by up-regulating cytokine transcripts. Res. Vet. Sci., 95: 87–91. https://doi.org/10.1016/j.rvsc.2013.01.024

Passantino, L., Massaro, M.A., Jirillo, F., Di Modugno, D., Ribaud, M.R., Di Modugno, G., Passantino, G.F. and Jirillo, E., 2007. Antigenically activated avian erythrocytes release cytokine-like factors: a conserved phylogenetic function discovered in fish. Immunopharmacol. Immunotoxicol., 29: 141–152. https://doi.org/10.1080/08923970701284664

Perkins, N.D., 2007. Integrating cell signalling pathways with NF-kappaB and IKK function. Nat. Rev. Mol. Cell Biol., 8: 49–62. https://doi.org/10.1038/nrm2083

Peters, R.T., Liao, S.M. and Maniatis, T., 2000. IKKepsilon is part of a novel PMA-inducible IkappaB kinase complex. Mol. Cell5: 513–522. https://doi.org/10.1016/S1097-2765(00)80445-1

Pullen, S.S., Miller, H.G., Everdeen, D.S., Dang, T.T., Crute, J.J. and Kehry, M.R., 1998. CD40-tumor necrosis factor receptor-associated factor (TRAF) interactions: regulation of CD40 signaling through multiple TRAF binding sites and TRAF hetero-oligomerization. Biochemistry, 37: 11836-11845. https://doi.org/10.1021/bi981067q

Rao, P., Hayden, M.S., Long, M., Martin L.S., Philip A.W., Dekai Z. andrea O., Candace L., Alexander H., David B. and Sankar G., 2010. IκBβ acts to inhibit and activate gene expression during the inflammatory response. Nature, 466: 1115–1119. https://doi.org/10.1038/nature09283

Raviv, Z., Ferguson-Noel, N., Laibinis, V., Wooten, R. and Kleven, S.H., 2007. Role of Mycoplasma synoviae in commercial layer Escherichia coli peritonitis syndrome. Avian Dis., 51: 685–690. https://doi.org/10.1637/0005-2086(2007)51[685:ROMSIC]2.0.CO;2

Rückle, A., Haasbach, E., Julkunen, I., Planz, O., Ehrhardt, C. and Ludwig, S., 2012. The NS1 protein of influenza A virus blocks RIG-I-mediated activation of the noncanonical NF-kB pathway and p52/RelB-dependent gene expression in lung epithelial cells. J. Virol., 86: 10211–10217. https://doi.org/10.1128/JVI.00323-12

Shimada, T., Kawai, T., Takeda, K., Matsumoto, M., Inoue, J., Tatsumi, Y., Kanamaru, A. and Akira, S., 1999. IKK-i, a novel lipopolysaccharide-inducible kinase that is related to IkappaB kinases. Int. Immunol., 11: 1357–1362. https://doi.org/10.1093/intimm/11.8.1357

Soria, G. and Ben-Baruch, A., 2008. The inflammatory chemokines CCL2 and CCL5 in breast cancer. Cancer Lett., 267: 271–285. https://doi.org/10.1016/j.canlet.2008.03.018

Stockhammer, O.W., Rauwerda, H., Wittink, F.R., Breit, T.M., Annemarie, H.M. and Herman, P.S., 2010. Transcriptome analysis of Traf6 function in the innate immune response of zebrafish embryos. Mol. Immunol., 48: 179-190. https://doi.org/10.1016/j.molimm.2010.08.011

Strunov, A., Boldyreva, L.V., Pavlova, G.A., Pindyurin A.V., Gatti, M. and Kiseleva E., 2016. A simple and effective method for ultrastructural analysis of mitosis in Drosophila S2 cells. Methods X, 3: 551–559. https://doi.org/10.1016/j.mex.2016.10.003

Su, J., Huang, T., Dong, J., Heng, J., Zhang, R. and Peng, L., 2010. Molecular cloning and immune responsive expression of MDA5 gene, a pivotal member of the RLR gene family from grass carp Ctenopharyngodon idella. Fish Shellf. Immunol., 28: 712–718. https://doi.org/10.1016/j.fsi.2010.01.009

Sun, S.C., 2011. Non-canonical NF-kappaB signaling pathway. Cell Res., 21: 71–85. https://doi.org/10.1038/cr.2010.177

Sun, S.C., 2017. The non-canonical NF-κB pathway in immunity and inflammation. Nat. Rev. Immunol., 17:545-558. https://doi.org/10.1038/nri.2017.52

Sutterwala, F.S., Haasken, S. and Cassel, S.L., 2014. Mechanism of NLRP3 inflammasome activation. Annls N. Y. Acad. Sci., 1319: 82–95. https://doi.org/10.1111/nyas.12458

Tak, P.P. and Firestein, G.S., 2001. NF-kappaB: A key role in inflammatory diseases. J clin Invest., 107: 7–11. https://doi.org/10.1172/JCI11830

Taro, K. and Shizuo, A., 2007. Signaling to NF-kB by Toll-like receptors. Trends mol. Med., 13: P460-469. https://doi.org/10.1016/j.molmed.2007.09.002

Tian, W.X., Li, J.K., Qin, P., Wang, R., Ning, G.B., Qiao, J.G., Li, H.Q., Bi, D.R., Pan, S.Y. and Guo, D.Z., 2013. Screening of differentially expressed genes in the growth plate of broiler chickens with tibial dyschondroplasia by microarray analysis. BMC Genom., 14: 276. https://doi.org/10.1186/1471-2164-14-276

Tripathi, A.K., Sha, W., Shulaev, V., Stins, M.F. and Sullivan, D.J, Jr., 2009. Plasmodium falciparum-infected erythrocytes induce NF-kappaB regulated inflammatory pathways in human cerebral endothelium. Blood, 114: 4243-4252. https://doi.org/10.1182/blood-2009-06-226415

Umar, S., Munir, M.T., Ur-Rehman, Z., Subhan, S., Azam, T. and Shah, M.A.A., 2017. Mycoplasmosis in poultry: Update on diagnosis and preventive measures. World Poult. Sci. J., 72: 17–28. https://doi.org/10.1017/S0043933916000830

Vallabhapurapu, S. and Karin, M., 2009. Regulation and function of NF-kappaB transcription factors in the immune system. Annu. Rev. Immunol., 27: 693–733. https://doi.org/10.1146/annurev.immunol.021908.132641.

Verhelst, K., Verstrepen, L., Carpentier, I. and Beyaert, R., 2013. IkB kinase ε (IKKε): a therapeutic target in inflammation and cancer. Biochem. Pharmacol., 85: 873–880. https://doi.org/10.1016/j.bcp.2013.01.007

Wang, X., Liu, S., Yang, Y., Fu, Q., Abebe, A. and Liu Z., 2017. Identification of NF-κB related genes in channel catfish and their expression profiles in mucosal tissues after columnaris bacterial infection. Dev. Comp. Immunol., 70: 27–38. https://doi.org/10.1016/j.dci.2017.01.003

Wang, C.X., Niu, S., Jahejo, A.R., Jia, F.J., Li, Z., Zhang, N., Ning, G.B., Zhang, D., Li, H.Q., Ma, H.L., Hao, W.f., Gao, W.W., Gao, S.M., Li, J.H., Li, G.L., Yan, F., Gao, R.K., Zhao, Y.J., Chen, H.C. and Tian, W.X., 2018. Identification of apoptosis-related genes in erythrocytes of broiler chickens and their response to thiram-induced tibial dyschondroplasia and recombinant glutathione S-transferase A3 protein. Res. Vet. Sci., 120: 11-16. https://doi.org/10.1016/j.rvsc.2018.08.001

West, A.P., Shadel, G.S. and Ghosh, S., 2011. Mitochondria in innate immune responses. Nat. Rev. Immunol., 11: 389-402. https://doi.org/10.1038/nri2975

Qiu, Y., Shen, Y., Li, X., Ding, C. and Ma, Z., 2008. Molecular cloning and functional characterization of a novel isoform of chicken myeloid differentiation factor 88 (MyD88). Dev. Comp. Immunol., 32: 1522–1530. https://doi.org/10.1016/j.dci.2008.05.016

Ye, H., Arron, J.R., Lamothe, B., Cirilli, M., Kobayashi, T., Shevde, N.K., Segal, D., Dzivenu, O.K., Vologodskaia, M., Yim, M., Du, K., Singh, S., Pike, J.W., Darnay, B.G., Choi, Y. and Wu, H., 2002. Distinct molecular mechanism for initiating TRAF6 signalling. Nature, 418: 443-447. https://doi.org/10.1038/nature00888

Ye, W., Chew, M., Hou, J., Lai, F., Leopold, S.J., Loo, H.L., Ghose, A., Dutta, A.K., Chen, Q., Ooi, E.E., White, N.J., Dondorp, A.M., Preiser, P. and Chen, J., 2018. Microvesicles from malaria-infected red blood cells activate natural killer cells via MDA5 pathway. PLoS Pathog., 14: e1007298. https://doi.org/10.1371/journal.ppat.1007298

Yoboua, F., Martel, A., Duval, A., Mukawera, E. and Grandvaux, N., 2010. Respiratory syncytial virus-mediated NF-kappa B p65 phosphorylation at serine 536 is dependent on RIG-I, TRAF6, and IKK beta. J. Virol., 84: 7267– 7277. https://doi.org/10.1128/JVI.00142-10

Zimmerman, M., Yang, D., Hu, X., Liu, F., Singh, N., Browning, D., Ganapathy, V., Chandler, P., Choubey, D., Abrams, S.I., Liu, K., 2010. IFN-γ upregulates survivin and ifi202 expression to induce survival and proliferation of tumor-specific T cells. PLoS One, 5: e14076. https://doi.org/10.1371/journal.pone.0014076