Isolation and Characterization of Virulent Citrobacter freundii Associated with White Muscle Disease in Farmed Red Swamp Crayfish, Procambarus clarkia
Hongsen Xu*, Xiaoni Wang, Tie Tian, Changyu Zhao, Denghang Yu and Jun Liu
Hubei Key Laboratory of Animal Nutrition and Feed Science, School of Animal Science and Nutritional Engineering, Wuhan Polytechnic University, No. 68, Xuefunan Road, Wuhan 430023, China
ABSTRACT
In June 2021, a sudden outbreak of white muscle disease coincidence with considerable mortality was occurred in Procambarus clarkii which were cultured in Jiangxia fish farm, Wuhan, Hubei province, China. A dominant bacterial colony, named FSN1, was isolated by incubating on Luria-Bertani agar. Morphological, physiological and biochemical characterization as well as 16S rRNA sequencing identified FSN1 isolate as Citrobacter freundii. Drug sensitivity test showed the strain has multiple drug resistance and was only sensitive to a few antibiotics (doxycycline, tetracycline, minocycline and ciprofloxacin). PCR amplification of specific genes responsible for antibiotic resistance (extended-spectrum β-lactamases, quinolone resistance determinants and tetracycline-resistance) confirmed antibiotics sensitivity of this bacterium. Artificial infection showed that the strain could cause similar symptoms to those of naturally infected crayfish, and the lethal dose 50% was 1.52 × 106 CFU/g crayfish. Serious histopathological changes, such as cell degeneration and necrosis, hemorrhage and inflammatory cell infiltration, were found in diseased crayfish. In conclusion, this study confirmed the pathogen of whitish muscle disease in farmed P. clarkii, and preliminarily investigated the biological characteristic, pathogenicity and drug sensitivity of this bacterium. The results of this study will provide scientific guidance for the effective prevention and control of muscle turbidity of P. clarkii.
Article Information
Received 04 October 2022
Revised 22 October 2022
Accepted 09 November 2022
Available online 19 May 2023
(early access)
Published 20 February 2024
Authors’ Contribution
HX and XW conducted the
experiments, wrote and revised
the manuscript. TT and CZ collected
the samples. DY and JL analyzed
the results.
Key words
Procambarus clarkii, Citrobacter freundii, Whitish muscle disease, Antibiotic resistance, Histopathology
DOI: https://dx.doi.org/10.17582/journal.pjz/20221004141003
* Corresponding author: [email protected]
0030-9923/2024/0002-0915 $ 9.00/0
Copyright 2024 by the authors. Licensee Zoological Society of Pakistan.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
INTRODUCTION
Red swamp crayfish (Procambarus clarkii), originally from northeastern Mexico and the southcentral United States, is extensively distributed worldwide (Hobbs, 1989). In 1929, P. clarkii was firstly introduced into Nanjing, China from Japan for aquaculture, which then spread to many cities as a special aquatic animal (Yan et al., 2001). Nowadays, P. clarkii has been an important commercial freshwater crustacean species in China due to its strong fecundity and high economic value (Cremades et al., 2001). According to the China Fisheries Statistic Yearbook in 2022, the gross production of crayfish has exceeded 2.63 million tons in 2021, which has increased about 10.02% compared to those produced in 2020 (Bureau, 2022). Nevertheless, the appearance of contagious diseases has substantially accumulated with the increased stocking density of intensive practices, which constitutes the major bottlenecks of sustainable development in P. clarkii farming.
Bacteria disease has caused significant economic losses in the culture of P. clarkii. The major microorganism identified from diseased crayfish including Aeromonas veronii (Yuan et al., 2021), Aeromonas hydrophila (Jiravanichpaisal et al., 2009) and Citrobacter freundii (Liu et al., 2020). Meanwhile, C. freundii is a facultative anaerobic Gram-negative bacterium that belongs to the Enterobacteriaceae family (Liu et al., 2020). It is widely distributed in aquatic environment and is an opportunistic pathogen in veterinary and medical sciences (Nawaz et al., 2008). The bacterium was firstly regarded as an emerging fish pathogen from sunfish (Mola mola) in Japan (Sato et al., 1982). Recently, there have been reports of deaths of aquatic animals infected with C. freundii, including significant infections in silver catfish (Rhamdia quelen) (Junior et al., 2018), rohu (Labeo rohita) (Behera et al., 2022), freshwater prawn (Macrobrachium rosenbergii) (Zhao et al., 2022) and P. clarkii (Liu et al., 2020).
In this study, we firstly report a case of a natural bacterial infection with C. freundii as a cause of white muscle disease in farmed crayfish. In addition to the morphological and biochemical characteristics, the molecular determination by PCR was carried out to ascertain the distribution of antimicrobial resistant genes of C. freundii. Then, the antibiotic susceptibility of the bacterium and the histopathological changes caused by C. freundii in the infected crayfish were investigated.
MATERIALS AND METHODS
Bacterial isolation and phenotypic characterization
The bacterial isolation was performed from three clinically moribund crayfish cultured in Jiangxia fish farm, Wuhan, Hubei province, China as described previously (Xu et al., 2022). Briefly, swabs were taken aseptically using a sterile inoculating loop from the white muscle of diseased crayfish, streaked onto Luria-Bertani agar (LBA, Land Bridge Ltd) plates and incubated at 28 °C for 24 h. The bacteria were re-inoculated on LBA plates thrice to obtain the pure culture. Moreover, the isolate was streaked on LBA containing 5% defibrinated sheep blood and incubated at 28 ºC for 24 h to observe colony morphology and haemolysis. The morphology of isolated bacteria was certified using a Gram Stain Kit (Solarbio, Beijing, China). Images were acquired with an imaging microscope (Olympus BX60, Japan) by using 100 × oil immersion objective lens.
The biochemical characteristics of C. freundii was detected using standardized API® 20E system (BioMerieux S.A., France) according to the manufacture’s guidelines. Briefly, pure cultures of single colonies obtained on LB were suspended in 2 mL of sterile saline and then gently mixed for 10 min to disperse the bacteria. The turbidity of bacterial suspension was adjusted to 1.8 × 109 CFU/mL, and 65 μL of each suspension was added to each cupule on the strip. Plates were incubated at 28 °C for 48 h and the biochemical characteristics of C. freundii were recorded thereafter.
Molecular identification of pathogenic bacterium
Molecular identification was based on 16S rRNA gene sequence analysis. Total genomic DNA of isolated bacterium was prepared using bacteria DNA extraction kits (Tiangen Biotech, Beijing Co., Ltd., China) following the manufacturer’s instructions. The extracted total genomic DNA was stored at −20 °C for further used as templates for PCR amplification. PCR assay was performed in a final volume of 25 µL using a Biometra T Professional Thermocycler (TaKaRa, Japan) as previous report (Sun et al., 2018). The utilized primers for 16S rRNA gene was shown on Table I. The amplified products were checked on 1% agarose gel
Table I. Oligonucleotide primer sequences used for PCR amplification of drug-resistant genes of Citrobacter freundii.
|
Genes |
F: Primer sequence (5'-3') |
R: Primer sequence (5'-3') |
Tm |
Product size/bp |
References |
|
16s rRNA |
AGAGTTTGATCCTGGCTCAG |
GGTTACCTTG-TTACGACTT |
55 |
1465 |
Liu et al., 2020 |
|
blaCTX |
CGCTTTGCGATGTGCAG |
ACCGCGATAT-CGTTGGT |
54 |
550 |
Dallenne et al., 2010 |
|
blaTEM |
CATTTCCGTGTCGCCCTTATTC |
CGTTCATCCA-TAGTTGCCTGAC |
52 |
800 |
Dallenne et al., 2010 |
|
blaSHV |
AGCCGCTTGAGCAAATTAAAC |
ATCCCGCAGA-TAAATCACCAC |
52 |
713 |
Dallenne et al., 2010 |
|
blaPER |
GCTCCGATAATGAAAGCGT |
TTCGGCTTGA-CTCGGCTGA |
52 |
520 |
Dallenne et al., 2010 |
|
blaACC |
AACAGCCTCAGCAGCCGGTTA |
TTCGCCGCAA-TCATCCCTAGC |
64 |
346 |
Pérez-Pérez and Hanson, 2002 |
|
blaDHA |
AACTTTCACAGGTGTGCTGGGT |
CCGTACGCAT-ACTGGCTTTGC |
64 |
405 |
Pérez-Pérez and Hanson, 2002 |
|
blaEBC |
TCGGTAAAGCCGATGTTGCGG |
CTTCCACTGC-GGCTGCCAGTT |
64 |
302 |
Pérez-Pérez and Hanson, 2002 |
|
blaFOX |
AACATGGGGTATCAGGGAGATG |
CAAAGCGCGT-AACCGGATTGG |
64 |
190 |
Pérez-Pérez and Hanson, 2002 |
|
qnrA |
CAGCAAGAGGATTTCTCACG |
AATCCGGCAG-CACTATTACTC |
54 |
630 |
Ciesielczuk et al., 2013 |
|
qnrC |
GGGTTGTACATTTATTGAATCG |
CACCTACCCA-TTTATTTTCA |
54 |
307 |
Kim et al., 2009 |
|
qepA |
GCAGGTCCAGCAGCGGGTAG |
CTTCCTGCCC-GAGTATCGTG |
54 |
218 |
Kim et al., 2009 |
|
tetA (A) |
GCTACATCCTGCTTGCCTTC |
CATAGATCGC-CGTGAAGAGG |
55 |
210 |
Poirel et al., 2005 |
|
tetA (B) |
TTGGTTAGGGGCAAGTTTTG |
GTAATGGGCC-AATAACACCG |
55 |
659 |
Poirel et al., 2005 |
|
tetA (C) |
CTTGAGAGCCTTCAACCCAG |
ATGGTCGTCA-TCTACCTGCC |
55 |
418 |
Poirel et al., 2005 |
|
tetA (G) |
GCTCGGTGGTATCTCTGCTC |
AGCAACAGA-ATCGGGAACAC |
55 |
468 |
Poirel et al., 2005 |
electrophoresis, purified with gel extraction kit (TIANGEN, Beijing, China), and then inserted into the pMD18-T vector. The recombinant vectors were sequenced at TsingKe Biotech (Wuhan, China) and thereafter blasted using the National Center for Biotechnology Information (NCBI) BLASTn (http://www.ncbi.nlm.nih.gov). Phylogenetic tree was constructed using the neighbor-joining method in the MEGA X software package following multiple alignments (using clustal W) of the 16S rRNA sequence.
Growing characteristics
The pH value and NaCl concentration were adjusted based on the LB medium. Briefly, the pH value of LB was adjusted to 3, 5, 7, 9 and 11 with HCl (1 mol/L) or NaOH (1 mol/L), respectively, prior to sterilize by autoclaving. Similarly, the NaCl concentration of LB was adjusted to 0, 1, 3, 5 and 7%, respectively, before sterilization. The FSN1 isolate was incubated in LB until the bacterial suspension reached the 3.0 × 108 CFU/mL. Then 200 μL of bacterial suspension was added to prepared LB and cultured at 180 rpm in 100-mL conical flask. Growth was observed for 68 h by measuring the OD value at 600 nm every 4 h by spectrophotometer.
Antimicrobial susceptibility assay
The antibiotic sensitivity or resistivity of isolated C. freundii was determined following the standard Kirby-Bauer disk diffusion method (Bauer, 1966). Briefly, the bacterial isolates were cultured in LB broth and the concentration of the bacterial solution was adjusted to 1.0 × 108 CFU/mL. The suspension was streaked on LBA plates, and the commercial drug impregnated disks (Hangzhou Tianhe Microorganism Reagent Co., Ltd., China) were applied on the streaked cultures. After 18 h of incubation at 28 °C, the diameter of the zone around the disc was measured and antibiotics were interpreted as susceptible (S), intermediate (I) or drug resistant (R) according to the criteria set by the manufacturer.
Identification of antimicrobial resistant genes
The C. freundii were subjected to PCR amplification to identify extended-spectrum β-lactamases (blaTEM, blaSHV, blaCTX, blaPER, blaDHA, blaACC, blaFOX and blaEBC), plasmid-mediated quinolone resistance determinants (qnrA, qnrC and qepA) and tetracycline-resistance genes (tetA, tetB, tetC and tetG) using specific primers shown at Table I. The PCR amplicons were separated by electrophoresis on 1% (w/v) agarose gels stained with 4S Green and photographed under Gel Doc EZ Imager (Bio-Rad, Germany).
Experimental infection
Two hundred healthy P. clarkii with an average body weight of 15.8 ± 0.6 g were purchased from a local crayfish farm (Hubei, China). Prior to the experimental infection, the crayfish were randomly divided into six groups with each containing 30 crayfish, temporarily cultured in tanks (60 L) with temperature 28 °C for two weeks. The concentration of FSN1 isolate was adjusted with PBS to prepare 1.0 × 104, 1.0 × 105, 1.0 × 106, 1.0 × 107 and 1.0 × 108 CFU/mL bacterial suspensions. Crayfish in five experimental groups were injected at third abdominal segment with the aforementioned bacterial concentrations at a dose of 100 μL/crayfish, respectively. The control group was injected with the same dose of PBS. The number of dead crayfish were recorded daily for a period of 14 days and then the mean lethal dose 50% (LD50) value was calculated according to a modified arithmetical method of Reed and Muench (Reed and Muench, 1938). Investigations were performed strictly following the guidelines allowed by the Committee of the Ethics on Animal Care and Experiments at Wuhan Polytechnic University (No. WPU202011002).
Histopathological assessment
Histopathology assays were conducted in infected crayfish tissues including the muscle, gill, intestine and hepatopancreas with typical clinical manifestations. These tissues were sampled from the diseased crayfish, trimmed to the appropriate size, and fixed in 10% neutral buffered formalin for 48 h. Afterwards, the fixed samples were routinely dehydrated in series increased ethanol solutions, equilibrated the alcohol in the tissues with xylene, followed by embedding in paraffin blocks. Serial 5 μm thicknesses sections of paraffin blocks were prepared using a microtome (Leica RM2245, Germany), mounted onto gelatinized slides and then stained with hematoxylin and eosin (H and E) for histopathological examination. The slides were observed and photographed under an imaging microscope (Olympus BX60, Japan) equipped with an image acquisition software (Cell Sens Standard, Olympus, Tokyo, Japan).
RESULTS
Clinical signs and gross pathology
The natural diseased crayfish showed the clinical symptoms of anorexia, lethargy and inactivity, and exhibited a sudden onset of high mortalities. Figure 1 displayed the clinical picture of the diseased crayfish with opaque or whitish muscles, particularly noticeable in the abdomen.
Morphological and biochemical characteristics
The FSN1 isolate formed white, smooth and convex colonies both on LB and blood agars (Fig. 2A and B).
They were not pigmented and did not induce hemolysis on blood agar (Fig. 2B). The isolate was a typically Gram-negative rod-shaped bacterium (Fig. 2C). The biochemical characterization of C. freundii showed that the bacterium was positive for citrate, sucrose, β-galactosidase, sorbitol, rhamnose, mannitol, glucose, arginine, lysine, ornithine and gelatin reaction, but negative for arabinose, inositol, tryptophan and acetoin, and production from indole and urease (Table II).
Table II. API 20E result for isolates and reference strains of Citrobacter freundii.
|
Items |
C. freundii FSN1 |
C. freundii* |
|
Gram stain |
Negative |
Negative |
|
Cell morphology |
Rod |
Rod |
|
Motility |
+ |
+ |
|
Catalase |
+ |
+ |
|
Oxidase |
− |
− |
|
Hemolysis of sheep RBCs |
− |
+ |
|
Indole production (IND) |
− |
V |
|
Urease production (URE) |
− |
− |
|
Citrate utilization (CIT) |
+ |
V |
|
Sucrose fermentation (SAC) |
+ |
+ |
|
β-galactosidase (ONPG) |
+ |
+ |
|
Sorbitol fermentation (SOR) |
+ |
+ |
|
Rhamnose fermentation (RHA) |
+ |
V |
|
Melibiose fermentation (MEL) |
− |
+ |
|
Amygdalin fermentation (AMY) |
− |
− |
|
Arabinose fermentation (ARA) |
− |
V |
|
Inositol fermentation (INO) |
− |
V |
|
Mannitol fermentation (MAN) |
+ |
+ |
|
Glucose fermentation (GLU) |
+ |
+ |
|
H2S production |
+ |
V |
|
Arginine dihydrolase (ADH) |
+ |
+ |
|
Lysine decarboxylase (LDC) |
+ |
− |
|
Ornithine decarboxylase (ODC) |
+ |
− |
|
Tryptophan deaminase (TDA) |
− |
− |
|
Gelatin hydrolysis (GEL) |
+ |
+ |
|
Acetoin production (VP) |
− |
− |
+, positive; —, negative; * Reference strain data compiled from Bergey’s manual.
Phylogenetic analysis based on 16S rRNA gene sequence
The gene sequence for the 16S rRNA of isolate FSN1 was submitted and deposited in the GenBank database under accession no. OP355145. The BLAST alignment of 16S rRNA gene sequence showed that strain FSN1 shared 99.93% sequence similarity with the sequence of C. freundii strain HME8594 (GenBank accession no. JX426059.1), and the phylogenetic tree further demonstrated that FSN1 clustered together with known species of C. freundii strains (Fig. 3). These results showed that FSN1 have been related to C. freundii, which is supported by a high bootstrap value.
Growing characteristics
The growing characteristics of FSN1 on pH value and NaCl concentration were investigated. As shown in Figure 4A, the bacterium has a wide pH range and can grow normally at pH 5–9, whose optimal value was around pH 5. whereas the growth was inhibited at pH 3 and 11. As shown in Figure 4B, the growth and concentration of FSN1 reached the maximum level at 1% NaCl. The latent phase of growth was extended markedly at 5% NaCl. At 0% and 3% NaCl, the growth trends were similar, even though the considerable final concentration was higher in 0% NaCl than those cultured in 3% NaCl. Growth was halted at 7% NaCl. The present results revealed that C. freundii has a wide range of pH and salinity tolerance.
Determination of antimicrobial resistance
The antibiotic resistance patterns of C. freundii, valued by the size of the inhibition zones around each disc, showed that the strain FSN1 was resistant (R) to kanamycin, streptomycin, amikacin, gentamycin, neomycin, ceftriaxone, cefpimizole, ceftazidime, ampicillin, piperacillin, carbenicillin, oxacillin, levofloxacin, rifampicin, trimethoprim, and sulfisoxazole, intermediate sensitive (I) to cefepime, enrofloxacin, norfloxacin and florfenicol, and susceptible (S) to four antibiotics including doxycycline, tetracycline, minocycline and ciprofloxacin, indicating that isolate FSN1 had multiple resistances to aminoglycosides, cephalosporins, penicillin and sulfonamides antimicrobials used in aquaculture (Table III).
Table III. Antibiotics susceptibility of strain FSN1 against 24 antimicrobial agents.
|
Antibiotics |
Concentration |
R/ mm |
I/mm |
S/ mm |
Diameter of inhibited zone/mm |
|
C. freundii FSN1 |
|||||
|
Aminoglycosides |
|||||
|
Kanamycin |
30 μg/disc |
≤13 |
14~17 |
≥18 |
0 (R) |
|
Streptomycin |
10 μg/disc |
≤11 |
12~14 |
≥15 |
0 (R) |
|
Amikacin |
30 μg/disc |
≤14 |
15~16 |
≥17 |
0 (R) |
|
Gentamycin |
10 μg/disc |
≤12 |
13~14 |
≥15 |
0 (R) |
|
Neomycin |
30 μg/disc |
≤12 |
13~16 |
≥17 |
5 (R) |
|
Tetracyclines |
|||||
|
Doxycycline |
30 μg/disc |
≤12 |
13~15 |
≥16 |
24 (S) |
|
Tetracycline |
30 μg/disc |
≤14 |
15~18 |
≥19 |
26 (S) |
|
Minocycline |
30 μg/disc |
≤14 |
15~18 |
≥19 |
30 (S) |
|
Cephalosporins |
|||||
|
Ceftriaxone |
30 μg/disc |
≤13 |
13~21 |
≥21 |
21 (R) |
|
Cefpimizole |
30 μg/disc |
≤14 |
15~17 |
≥18 |
9 (R) |
|
Ceftazidime |
30 μg/disc |
≤17 |
18~20 |
≥21 |
15 (R) |
|
Cefepime |
30 μg/disc |
≤14 |
15~17 |
≥18 |
16 (I) |
|
Penicillin |
|||||
|
Ampicillin |
10 μg/disc |
≤13 |
14~16 |
≥17 |
11 (R) |
|
Piperacillin |
100μg/disc |
≤17 |
18~20 |
≥21 |
15 (R) |
|
Carbenicillin |
100 μg/disc |
≤18 |
19~23 |
≥24 |
14 (R) |
|
Oxacillin |
1 μg/disc |
≤10 |
11~12 |
≥13 |
0 (R) |
|
Quinolones |
|||||
|
Enrofloxacin |
5 μg/disc |
≤16 |
17~22 |
≥23 |
20 (I) |
|
Norfloxacin |
10 μg/disc |
≤12 |
13~16 |
≥17 |
13 (I) |
|
Ciprofloxacin |
5 μg/disc |
≤15 |
16~20 |
≥21 |
27 (S) |
|
Levofloxacin |
5 μg/disc |
≤12 |
13~16 |
≥17 |
12 (R) |
|
Florfenicol |
30 μg/disc |
≤12 |
13~17 |
≥18 |
17 (I) |
|
Rifampicin |
5 μg/disc |
≤16 |
17~19 |
≥20 |
0 (R) |
|
Sulfonamides |
|||||
|
Trimethoprim |
25 μg/disc |
≤23 |
24~32 |
≥33 |
0 (R) |
|
Sulfisoxazole |
30 μg/disc |
≤10 |
11~15 |
≥16 |
6 (R) |
The diameter of the antibacterial zone includes the diameter of the drug sensitive tablet. S, highly sensitive; I, intermediately sensitive; R, low or not sensitive.
Determination of antimicrobial resistant genes
PCR assay was conducted to screen the antibiotic resistant genes of isolated C. freundii. The PCR profiles of antibiotic resistance genes including blaTEM, blaSHV, blaCTX, blaPER, blaDHA, blaACC, blaFOX, blaEBC and qepA were detected in the C. freundii isolate, whereas the qnrA, qnrC, tetA, tetB, tetC and tetG genes were lost in FSN1 (Fig. 5).
Challenge test
To determine the pathogenicity of the isolated FSN1, the challenge assay was carried out in healthy crayfish. The crayfish injected with 1.0 × 105 to 1.0 × 108 CFU per mL bacteria rapidly died from the 3rd to 8th day post-injection, whereas no death was observed in those crayfish injected with PBS and 1.0 × 104 CFU/mL during the experimental challenge (Fig. 6). Moreover, the crayfish experimentally infected with FSN1 exhibited same symptoms as observed in the diseased crayfish. The LD50 value of isolated C. freundii was calculated as 1.52 × 106 CFU/g crayfish weight.
Histopathology in crayfish infected by C. freundii
Histological analysis showed pathological changes in the muscle, gill, hepatopancrea and intestine from infected crayfish. Specifically, the muscle tissue of diseased crayfish showed cell necrosis and fibrinous degeneration with inflammatory cell infiltration (Fig. 7A and B). The gill of crayfish infected by C. freundii demonstrated leukocytes infiltration and vacuolar degeneration (Fig. 7C). A large number of inflammatory cells infiltrated the intestinal tract, accompanying with serious vacuolar and hyaline degeneration (Fig. 7D and E). The hepatopancreatic tubule lumen is dilated and disappeared star structure, the original structure of cells was disappeared and vacuolated, and more inflammatory cells infiltrated in the interstitium (Fig. 7F).
DISCUSSION
Diseases are major limiting factors in the healthy development of aquaculture industry throughout the world and various diseases are frequently occurred in the breeding process of P. clarkii with the high culture density. White muscle disease is a frequent problem for cultured Litopenaeus vannamei (Zhou et al., 2012) and Macrobrachium rosenbergii (Wang et al., 2008) caused by virus or bacteria. However, scare information is available on white muscle disease occurred in P. clarkii. Previous research revealed that crayfish infected with C. freundii showed high mortality even though the diseased crayfish showed no clinical symptom of whitish muscle (Liu et al., 2020). In the present study, C. freundii was isolated from diseased P. clarkia and firstly confirmed its association in contributing to the pathogenesis of white muscle and crayfish mortality.
The biochemical characteristics of the FSN1 isolates were basically coincidence with those of the C. freundii HME8594, even though the reactions of β-galactosidase, melibiose, arabinose, lysine and ornithine were different. In the current study, based on the results of the phenotypic characterization and biochemical identification, FSN1 was preliminary identified as C. freundii. It is worthwhile identifying phenotypic features of bacteria, however, this becomes implausible when only classic phenotypic characteristics being considered (Zhang et al., 2011). Therefore, the molecular identification method based on the sequence analysis of 16S rRNA gene was proposed. In this research, blast alignments exhibited that 16S rRNA gene sequence of the FSN1 isolate was most closely to C. freundii. Additionally, the phylogenetic trees construct based on the16S rRNA gene sequence displayed that the FSN1 isolate belonged to the C. freundii strains. Based on morphology, phenotypic characteristics and phylogenetic properties, the FSN1 isolated from the diseased crayfish were confirmed as C. freundii.
Appearance of antibiotic resistance is one of the most serious problems in the case of pathogenic bacteria like C. freundii. For example, a C. freundii isolated from diseased Pterophyllum scalare has been found to develop resistance against enrofloxaci, cefalotin, ampicillin, florfenicol and oxytetracycline (Gallani et al., 2016), and a C. freundii isolate from diseased Labeo rohita has been documented to be resistant to dicloxacillin, rifampicin and trimethoprim (Behera et al., 2022). In the present study, the isolated bacterium was resistant to various β-lactam antibiotics, such as aminoglycosides, penicillin, and cephalosporins (except cefepime). However, the bacterium showed sensitive to tetracyclines. To illustrate the antibiotic resistance mechanism, we conducted genetic screening. The blaTEM, blaSHV, blaCTX, blaPER, blaDHA, blaACC, blaFOX and blaEBC genes, which are well known for conferring resistance to carbapenems, were examined first (Barlow and Hall, 2002). The results showed positive reaction of β-lactamase genes (blaTEM, blaSHV, blaCTX, blaPER, blaDHA, blaACC, blaFOX and blaEBC) in C. freundii. Correspondingly, the bacterium exhibited negative reaction to TetA, TetB, TetC and TetG genes, which further explained the sensitive reaction of FSN1 to tetracycline. Even though FSN1 strain exhibited antimicrobial resistance to multiple antibiotics, the pathogens could be regulated by the application of antibiotics, such as doxycycline, tetracycline, minocycline and ciprofloxacin. It is worthy to note that the diseased crayfish successfully recovered as a result of the doxycycline treatment and no further mortality was observed after administration for 7 consecutive days.
Histological changes of immune-related organs including hepatopancreas, gill and intestine can be regarded as a potential indicator for the general health status of crayfish. In the present study, C. freundii infected crayfish exhibited leukocytes infiltration and vacuolar degeneration in the sampled tissues. Previous research performed by Liu et al. (2020) also showed similar symptom in C. freundii infected crayfish (Liu et al., 2020). Interestingly, the typical symptom of crayfish infected with C. freundii was white muscle and the histopathology of muscle showed cell necrosis, fibrinoid degeneration and inflammatory cell infiltration. Similarly, previous research exhibited that C. freundii infection destroyed the arrangement of crayfish muscle fibers, with fractured muscle fibers, abnormal density, nucleus fixation, and red staining of the sarcoplasm, suggesting that C. freundii infection could affect the structural integrity of muscle (Huang et al., 2021). The reason was possibly due to the fact that invading bacteria can use crayfish muscle as a rich source of nutrients to support their own survival and replication.
CONCLUSIONS
In conclusion, the present study firstly reports a C. freundii isolate as a causal agent for white muscle disease in P. clarkia. Furthermore, the pathology and pathogenesis study of this bacterium would help in development of therapies and managing the disease caused by this pathogen in the aquaculture systems.
Funding
This study was supported by the Natural Science Foundation of Hubei Province (grant no. 2021CFB265), National Natural Science Foundation of China (grant no. 31902389) and Key Laboratory of Special Aquatic Formula Feed (grant no. TMKJZ1706 and TMKJZ1912).
IRB approval
For this study, approval was obtained from Institutional Review Board of Wuhan Polytechnic University, Wuhan, China.
Ethical statement
These investigations were approved by the Ethics Committee for Animal Care and Experiments at Wuhan Polytechnic University, Wuhan, China.
Statement of conflict of interest
The authors have declared no conflict of interest.
REFERENCES
Barlow, M., and Hall, B.G., 2002. Origin and evolution of the ampc β-lactamases of Citrobacter freundii. Antimicrob. Agents Chemother., 46: 1190-1198. https://doi.org/10.1128/AAC.46.5.1190-1198.2002
Bauer, A., 1966. Antibiotic susceptibility testing by a standardized single disc method. Am. J. clin. Pathol., 45: 149-158. https://doi.org/10.1093/ajcp/45.4_ts.493
Behera, B.K., Paria, P., Das, A., and Das, B.K., 2022. Molecular identification and pathogenicity study of virulent Citrobacter freundii associated with mortality of farmed Labeo rohita (Hamilton, 1822), in India. Aquaculture, 547: 737437. https://doi.org/10.1016/j.aquaculture.2021.737437
Bureau, M., 2022. China fishery statistical yearbook. National aquatic product technology extension station, fisheries, C.S.O. 2022. Agricultural Press of China, Beijing.
Ciesielczuk, H., Hornsey, M., Choi, V., Woodford, N. and Wareham, D., 2013. Development and evaluation of a multiplex pcr for eight plasmid-mediated quinolone-resistance determinants. J. med. Microbiol., 62: 1823-1827. https://doi.org/10.1099/jmm.0.064428-0
Cremades, O., Ponce, E., Corpas, R., Gutierrez, J., Jover, M., Alvarez-Ossorio, M., Parrado, J., and Bautista, J., 2001. Processing of crawfish (Procambarus clarkii) for the preparation of carotenoproteins and chitin. J. Agric. Fd. Chem., 49: 5468-5472. https://doi.org/10.1021/jf0104174
Dallenne, C., Da Costa, A., Decré, D., Favier, C., and Arlet, G., 2010. Development of a set of multiplex pcr assays for the detection of genes encoding important β-lactamases in enterobacteriaceae. J. Antimicrob. Chemother., 65: 490-495. https://doi.org/10.1093/jac/dkp498
Gallani, S.U., Sebastiao, F.D.A., Valladão, G.M., Boaratti, A.Z., and Pilarski, F., 2016. Pathogenesis of mixed infection by Spironucleus sp. and Citrobacter freundii in freshwater angelfish Pterophyllum scalare. Microb. Pathog., 100: 119-123. https://doi.org/10.1016/j.micpath.2016.09.002
Hobbs, Jr, H.H., 1989. An illustrated checklist of the american crayfishes (decapoda, astacidae, cambaridae, parastacidae). https://doi.org/10.5479/si.00810282.480
Huang, X., Li, M., Wang, J., Ji, L., Geng, Y., Ou, Y., Yang, S., Yin, L., Li, L. and Chen, D., 2021. Effect of bacterial infection on the edibility of aquatic products: The case of crayfish (Procambarus clarkii) infected with Citrobacter freundii. Front. Microbiol., 12: 722037. https://doi.org/10.3389/fmicb.2021.722037
Jiravanichpaisal, P., Roos, S., Edsman, L., Liu, H. and Söderhäll, K., 2009. A highly virulent pathogen, Aeromonas hydrophila, from the freshwater crayfish Pacifastacus leniusculus. J. Invertebr. Pathol., 101: 56-66. https://doi.org/10.1016/j.jip.2009.02.002
Junior, G.B., Dos Santos, A.C., de Freitas Souza, C., Baldissera, M.D., dos Santos Moreira, K.L., da Veiga, M.L., de Vargas, A.P.C., da Cunha, M.A. and Baldisserotto, B., 2018. Citrobacter freundii infection in silver catfish (Rhamdia quelen): Hematological and histological alterations. Microb. Pathog., 125: 276-280. https://doi.org/10.1016/j.micpath.2018.09.038
Kim, H.B., Park, C.H., Kim, C.J., Kim, E.C., Jacoby, G.A., and Hooper, D.C., 2009. Prevalence of plasmid-mediated quinolone resistance determinants over a 9-year period. Antimicrob Agents Chemother., 53: 639-645. https://doi.org/10.1128/AAC.01051-08
Liu, X.D., He, X., An, Z.H., Sun, W., Chen, N., Gao, X.J., Li, X.X., and Zhang, X.J., 2020. Citrobacter freundii infection in red swamp crayfish (Procambarus clarkii) and host immune-related gene expression profiles. Aquaculture, 515: 734499. https://doi.org/10.1016/j.aquaculture.2019.734499
Nawaz, M., Khan, A.A., Khan, S., Sung, K., and Steele, R., 2008. Isolation and characterization of tetracycline-resistant Citrobacter spp. from catfish. Fd. Microbiol., 25: 85-91. https://doi.org/10.1016/j.fm.2007.07.008
Pérez-Pérez, F.J. and Hanson, N.D., 2002. Detection of plasmid-mediated ampc β-lactamase genes in clinical isolates by using multiplex PCR. J. clin. Microbiol., 40: 2153-2162. https://doi.org/10.1128/JCM.40.6.2153-2162.2002
Poirel, L., Héritier, C. and Nordmann, P., 2005. Genetic and biochemical characterization of the chromosome-encoded class b β-lactamases from Shewanella livingstonensis (slb-1) and Shewanella frigidimarina (sfb-1). J. Antimicrob. Chemother., 55: 680-685. https://doi.org/10.1093/jac/dki065
Reed, L.J. and Muench, H., 1938. A simple method of estimating fifty per cent endpoints. Am. J. Epidemiol., 27: 493-497. https://doi.org/10.1093/oxfordjournals.aje.a118408
Sato, N., Yamane, N. and Kawamura, T., 1982. Systemic Citrobacter freundii infection among sunfish Mola mola in matsushima aquarium. Bull. Jpn. Soc. Sci. Fish., 48: 1551-1557. https://doi.org/10.2331/suisan.48.1551
Sun, H.Y., Cao, X.H., Jiang, Y.F., Ni, L.Y., Mo, Z.Q., Qin, Q.W., Li, Y.W., and Dan, X.M., 2018. Outbreak of a novel disease associated with Citrobacter freundii infection in freshwater cultured stingray, Potamotrygon motoro. Aquaculture, 492: 35-39. https://doi.org/10.1016/j.aquaculture.2018.03.058
Wang, P.C., Lin, Y.D., Liaw, L.L., Chern, R.S., and Chen, S.C., 2008. Lactococcus lactis subspecies lactis also causes white muscle disease in farmed giant freshwater prawns Macrobrachium rosenbergii. Dis. Aquat. Organ., 79(1): 9-17. https://doi.org/10.3354/dao01868
Xu, H., Xu, R., Wang, X., Liang, Q., Zhang, L., Liu, J., Wei, J., Lu, Y. and Yu, D., 2022. Co-infections of Aeromonas veronii and nocardia seriolae in largemouth bass (Micropterus salmoides). Microb. Pathogen., pp. 105815. https://doi.org/10.1016/j.micpath.2022.105815
Yan, X., Zhenyu, L., Gregg, W.P. and Dianmo, L., 2001. Invasive species in China. An overview. Biodivers. Conserv., 10: 1317-1341. https://doi.org/10.1023/A:1016695609745
Yuan, G., Zhu, L., Jiang, X., Zhang, J., Pei, C., Zhao, X., Li, L., and Kong, X., 2021. Diagnosis of co-infection with white spot syndrome virus and Aeromonas veronii in red swamp crayfish Procambarus clarkii. Aquaculture, 532: 736010. https://doi.org/10.1016/j.aquaculture.2020.736010
Zhang, X., Qin, G., Bing, X., Yan, B., and Bi, K., 2011. Phenotypic and molecular characterization of Photobacterium damselae, a pathogen of the cultured tongue sole Cynoglossus semilaevis in china. N. Z. J. Mar. Freshw. Res., 45: 1-13. https://doi.org/10.1080/00288330.2010.531745
Zhao, C., Wen, H., Huang, S., Weng, S. and He, J., 2022. A novel disease (water bubble disease) of the giant freshwater prawn Macrobrachium rosenbergii caused by Citrobacter freundii: Antibiotic treatment and effects on the antioxidant enzyme activity and immune responses. Antioxidants, 11: 1491. https://doi.org/10.3390/antiox11081491
Zhou, J.F., Fang, W.H., Yang, X.L., Zhou, S., Hu, L.L., Li, X.C., Qi, X.Y., Su, H., and Xie, L.Y., 2012. A nonluminescent and highly virulent Vibrio harveyi strain is associated with bacterial white tail disease of Litopenaeus vannamei shrimp. PLoS One, 7: https://doi.org/10.1371/journal.pone.0029961