Molecular Identification of Ixodid Tick Species and their Screening for Selected Protozoan Pathogens Collected from Large Ruminants of Azad Kashmir, Pakistan
Anisa Mushtaq1, Murtaz ul Hasan1*, Asim Shamim2, Muhammad Ali Abdullah Shah1, Muhmamad Arif Zafar3, Abdul Asim Farooq4, Aayesha Riaz1, Muhammad Kamran1 and Saif ur Rehman1
1Department of Parasitology and Microbiology, Faculty of Veterinary and Animal Sciences, PMAS Arid Agriculture University, Rawalpindi, Punjab, Pakistan
2Department of Pathobiology, Faculty of Veterinary and Animal Sciences, University of Poonch, Rawalakot, Azad Kashmir, Pakistan
3Department of Clinical Studies, Faculty of Veterinary and Animal Sciences, PMAS Arid Agriculture University, Rawalpindi, Punjab, Pakistan
4Department of Clinical Studies, Faculty of Veterinary Sciences, Bahauddin Zakariya University, Multan, Pakistan
ABSTRACT
Ticks (Acari: ixodid) are notorious blood sucking ecto-parasites of wide range of animals which serve as vector of different types of pathogens like viruses, bacteria, rickettsia and protozoa and cause mortality in humans and animals. This study was focused on morphological and molecular identification of ixodid ticks, using morphological keys and an internal transcribed spacer (ITS-2) Deoxyribonucleic acid (DNA). Moreover, the presence of Babesia and Theileria species was also investigated in ticks using 18S rRNA gene. Identification of ticks collected from 384 cattle and 384 buffaloes screened revealed three tick genera and six tick species: Rhipicephalus microplus, Rhipicephalus decoloratus, Rhipicephalus annulatus, Hyalomma anatolicum anatolicum, Hyalomma anatolicum excavatum and Haemaphysalis punctata. Of those four species were confirmed on morphological basis, two ticks species Rhipicephalus microplus and Hyalomma anatolicum anatolicum whose morphological feature were overlapping with other identified species, were confirmed through molecular tools amplifying ITS-2 gene. Ticks DNA were then examined by PCR employing a genetic marker that target (18S rRNA gene), for the presence of Babesia and Theileria species in identified ticks. The most common pathogen species observed in ticks was Theileria annulata. This study exposed different hard tick species are prevalent in the study area and these ticks are playing major role in transmission of protozoa (Theileria annulata). On the basis of finding of present study an area-wise control strategy for ticks and ticks borne protozoan species have been suggestive.
Article Information
Received 18 January 2023
Revised 25 August 2023
Accepted 09 September 2023
Available online 28 November 2023
(early access)
Published 14 March 2024
Authors’ Contribution
MUH, AR and AS planned and designed the research experiment. AM executed the research trials and wrote the initial draft of manuscript. MAASH, SUR and MK analyzed the data. AAF, AR and AZ critically revised the manuscript and approved the final version.
Key words
Ixodid ticks, Ectoparasites, Theileria sp., ITS 2, Rhipicephalus sp., Hyalomma sp., Haemaphysalis sp., Babesia sp.,
DOI: https://dx.doi.org/10.17582/journal.pjz/20230118080115
* Corresponding author: [email protected]
0030-9923/2024/0003-1007 $ 9.00/0
Copyright 2024 by the authors. Licensee Zoological Society of Pakistan.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
INTRODUCTION
Ecto-parasite acts as a double edge sword, on the one hand they are vector of many diseases and on the other hand they are incurring economic loss to the farmers as these highly compromise the health status of animals and hide quality. Hard ticks are obligatory blood imbibing arthropods, external parasite of animals and humans (Jongejan and Uilenberg, 2009). They have a major effect on the husbandry and productivity of livestock such as reduced weight gain, loss of milk production, blood loss and damage to quality of hide. They are vectors for many diseases including tick-borne protozoan diseases (e.g. theileriosis and babesiosis) and rickettsial diseases (e.g. anaplasmosis and heart water or cowdriosis). Tick-borne pathogens affect 80% of the world cattle population and the estimated annual global loss due to ticks is between US$ 13.9 billion and US$ 18.7 billion (Hussain et al., 2021; Estrada-Pena and Salman, 2013). Among hard-tick taxa on the taxonomic and phylogenetic interactions there is a need for detailed studies and for this purpose morphological methods have been extensively used but relying merely on morphological approaches in some species may be questionable (Guglielmone et al., 2014). Molecular identification methods, which focus on DNA sequence variations, seem to provide a better tool for the evaluation of differences within and among tick species (Cruickshank, 2002). In the tick genome as compared to coding regions there is a rapid assessment of the internal transcribed spacer 2 segments (ITS-2) and to discriminate between closely related species (ITS-2) regions has been used (Hillis and Dixon, 1991). Many molecular studies on ticks have used ITS-2 gene for the identification of different tick species (Brahma et al., 2014; Lempereur et al., 2010). Molecular technique such as PCR has been widely used in veterinary parasitology in recent years to identify several parasitic pathogens including blood protozoa. Several studies documented that PCR is more specific and sensitive than conventional techniques in determining infectious agent carriers (Salih et al., 2015) therefore; testing ticks for the presence of pathogens using polymerase chain reaction-based methods provides distinct advantages over conventional detection methods. Only a single study of Sultana et al. (2015) is available on the topic from this study area earlier to present study associated with certain limitations. On the basis of review of literature and current scenario in the study area present research work has been planned with following objectives: Molecular and morphological identification of ticks infesting bovine (cattle and buffalo), and screening of ticks carrying protozoan pathogens (Babesia and Theileria spp.) in order to devise control measure against ticks in the study area.
MATERIALS AND METHODS
Study area
The study was conducted in District Poonch of Azad Kashmir. Tick specimens were collected from three Tehsils (Rawalakot, Abbaspur, Hajeera) of District Poonch. The study area is located at an approximate geographic coordinate of 33º–36º North latitude and 73º–75º East longitude. The occupied Poonch District of central Kashmir bond the region on East, Rawalpindi city is located on the West, Tatta pani and Kotli on the South and Suddhen Gali Muzaffarabad on the North side of the study area (Sultana et al., 2015).
Sampling and tick identification
A total of 865 tick samples were collected. A total of 768 household animals, (cattle 384 and 384 buffalo) were examined for tick infestations. Of the 768, 325 (42%) were infested with ticks. Samples were randomly collected from different body parts of animal body and preserved in 70% ethanol. Illustrated taxonomic keys of Walker et al. (2014) were used for identification of ticks.
Molecular identification of ticks
The DNA of 50 tick samples of morphologically closely related species was extracted using DNA extraction kit [The WizPrep™gDNA Mini Kit (Cell/Tissue)] Wizbio solutions following the manufacture’s protocol for molecular identification of ticks whose physical characters were overlapping and detection of selected protozoan pathogen in ticks.
ITS 2 region of the extracted DNA was PCR amplified using the pair of previously published specific degenerative primers (Abdigourdarzi et al., 2011).
ITS-F 5´-YTGCGARACTTGGTGTGAAT-3´and
ITS-R 5´TATGCTTAARTTYA GSGGGT-3´
The 40 μL of total PCR reaction mixture consisted of 8 μl of distilled water, 100 ng/μl of genomic DNA as the template, 1 μl of each primer (10 pmol/μL) and 20 μl PCR master mix (The WizPure™ PCR 2X, Wiz Bio Solutions). The amplification conditions for ITS 2 region are as follows: initial denaturation at 94°C for 2.5 minutes (min), denaturation at 94°C for 30 sec, annealing at 50°C for 1 min, extension at 72°C for 1 min and final Extension at 72°C for 30 min. Nuclease free water was used as negative control. PCR amplifications were performed in T-100 thermocycler (Applied Biosystems Veriti 96 wells 2720 thermocycler Germany).
Molecular identification of pathogens
A pair of previously published primers designed for 18S rRNA gene amplification of pathogens was used i.e Forward 5´CACAGGGAGGTAGTGACAAG3´and Reverse 5´AAGAA TTTCACCTATGACAG-3´ (Motavalli-Haghi and Fakhar, 2013). The PCR conditions for 18S rRNA gene amplification were set as follows: Initial denaturation at 95°C for 5 min, denaturation at 94°C for 45 sec, annealing at 56°C for 45 sec, extension at 72°C for 45 sec, final extension at 72°C for 10 min.
PCR product of tick ITS 2 gene ranging in size from 800-1500 bp was separated on 1% agarose gel, while that of pathogen 18S rRNA gene ranging in size from 380-430 bp was separated on 1.5% agarose gel. Ladder from BioLabs® inc (1kb and 100 bp) was used as a size marker. PCR products were later run on horizontal gel electrophoresis system (Wide mini sub® cell GT, Bio-Rad, Pakistan) and visualized under Gel Imaging System (JY04S-3C, Beijing, China).
Sequencing and phylogenetic analysis of ITS 2 and 18S rRNA genes
The positive amplified PCR products and gel bands of tick (6 samples) and pathogen species (2 samples) were investigated and then preceded for sequencing and phylogenetic analysis. For gene sequencing, the samples were sent to Macrogen® Korea for Sanger sequencing using ABI 3730 XL, the standard DNA sequencer. The sequences obtained from the present study were further submitted to GenBank for accession numbers. Sequences derived from this study and other sequences present in GenBank database were aligned using NCBI Blast. A comparison was made among the sequences of ITS 2 gene and 18S rRNA gene from this study with similar gene sequences of other studies. For phylogenetic analysis the gene sequence results were analyzed and the contig file was generated using Geneious prime tool (http://www.geneious.com). The contig file was generated using assemble and align tool available in program. A consensus was generated using chromatogram. The phylogenetic trees were constructed with the help of partial ITS-2 and 18S rRNA gene sequence data. The evolutionary history was inferred by using the Neighbor-joining method (Saitou and Nei, 1987) and evolutionary distances were computed using the maximum composite likelihood method (Tamura et al., 2004). The distances were computed mean-wise and overall using MEGA 10. Sequences were subsequently analyzed with neighbor joining to construct the phylogenetic tree (Kumar et al., 2016).
RESULTS AND DISCUSSION
Tick identification
Three genera (Rhipicephalus, Hyalomma and Haemaphysalis) and six tick species (Rhipicephalus decoloratus, Rhipicephalus annulatus, Rhipicephalus microplus, Hyalomma anatolicum excavatum, Hyalomma anatolicum anatolicum and Haemaphysalis punctata) were identified during present study on the basis of their physical characters (Table I). Rhipicephalus (71.67%) was found to be most prevalent, followed by Hyalomma (21.84%) and Hemaphysalis (6.4%). Table II shows specie wise distribution of ticks. Similar reports on the topic have been published earlier from other parts of the world (Khan et al., 2022; Ali et al., 2016; Gudina et al., 2016; Sultana et al., 2015). The morphologically identified species during the present study were found similar to tick species reported by other researchers (Jabeen et al., 2022; Mossad et al., 2021; Ramzan et al., 2020; Ghaffar et al., 2020; Hosseni et al., 2013; Patel et al., 2013). However, other studies (Jobir and Gure, 2021; Batool et al., 2019; Ramadan et al., 2016) also reported different ticks species found infesting bovines. This difference in results of prevalence percentage of different species in present and other studies are due to climate and topography of the study area, farmer’s knowledge about ticks, husbandry practices, grazing pattern, treatment and control measures. This statement also endorsed several other studies (Iqbal et al., 2014; Ali et al., 2013; Greenfield, 2011; Sajid et al., 2009). On the basis of morphological features numerous species belongs to genus Rhipicephalus and Hyalomma are easy to distinguish. However, Rhipicephalus microplus, and Hyalomma anatolicum anatolicum are closely related to other species of the same genus (Abdigoudarzi et al., 2011). The bodily features of Rhipicephalus microplus and Hyalomma anatolicum anatolicum were overlapping with other species having nearly similar physical appearance so they were further confirmed using molecular tools (Jabeen et al., 2022).
The PCR products for tick ITS-2 gene were subjected to sequencing. BLAST queries of the resulted sequenced nucleotides indicated the sequence identity with ITS-2 gene of Rhipicephalus microplus and Hyalomma anatolicum anatolicum. For comparative purposes, the sequences of Rhipicephalus microplus and Hyalomma anatolicum anatolicum were aligned from NCBI database. The four nucleotide sequences of Rhipicephalus microplus were submitted to GenBank and assinged numbers were: (Genbank: MZ 458595.1, MZ458596.1, MZ452632.1 and MZ458594.1). Two nucleotide sequences of
Table I. Identification characteristics of different tick species.
|
Features |
Rhipicephalus microplus |
Rhipicephalus decoloratus |
Rhipicephalus annulatus |
Hyalomma anatolicum |
Hyalomma excavatum |
Haemaphysalis punctata |
|
Palps |
Short |
Short |
Short |
Long |
Long |
Short |
|
Mouth parts |
Anterior/short |
Anterior/short |
Anterior/short |
Protruding out wards/large |
Protruding out wards/large |
Small/short |
|
Festoons |
Absent |
Absent |
Absent |
Reduced in number |
Reduced in number |
11 in number |
|
Legs |
No pale rings |
No pale rings |
No pale rings |
Patchy marbled pale rings |
Distinct pale rings |
No pale rings |
|
Hyposomal teeth |
4+4 in column |
3+3 in column |
4+4 in column |
-- |
-- |
-- |
Table II. Species wise distribution of tick species.
|
Tick species |
District Poonch |
|
|
Frequency |
% |
|
|
Haemaphysalis punctata |
56 |
6% |
|
R. decoloratus |
86 |
9% |
|
Hy. anatolicum |
93 |
10% |
|
Hy. anatolicum excavatum |
96 |
11% |
|
R. annulatus |
210 |
24% |
|
R. microplus |
324 |
37% |
Hyalomma anatolicum anatolicum were also submitted to Genbank and assigned accession numbers were (GenBank: MZ458373.1 and MZ458374.1). The sequences of ITS-2 gene of Rhipicephalus microplus and Hyalomma anatolicum anatolicum were compared with sequences reported by other researchers. A phylogenetic tree was constructed based on alignment with those sequences retrieved from NCBI database that showed high homology with our sequences (Fig. 1). Phylogenetic analysis demonstrated that the sequence of ITS-2 gene obtained in the present study were showing 85 to 100% homology with most of the ITS-2 gene sequences of Rhipicephalus and Hyalomma ticks’ worldwide. The similarity of Rhipicephalus microplus with the reference strains of the China (Genbank: KU680315.1) is 99% and with the reference of India (Genbank: KC85341.71) is 100%. The similarity of Hyalomma anatolicum anatolicum with the reference strains of the India (Genbank: KR697559.1) and China (Genbank: HQ005303.1) ranged between 99 % and 100%.
Our study supports that ITS-2 gene is a reliable tool for discriminating different genera and species of Ixodidae family members. Molecular identification of Rhipicephalus microplus and Hyalomma anatolicum anatolicum in our study is in parity with the findings of other researchers (Ghaffar et al., 2020; Rehman et al., 2017; Chhillar et al., 2014; Ganjiali et al., 2014; Baker and Walker, 2014; Abdigoudarzi et al., 2011; Lempurer et al., 2010) who confirmed similar tick species on the basis of ITS-2 gene. On the basis of results obtained in present study, it can be concluded that ITS-2 is a suitable molecular marker for distinguishing different genera as well as species of ticks’ including Hyalomma and Rhipicephalus (Labruna et al., 2009; Dergousoff and Chilton, 2007; Kawther et al., 2005).
Molecular characterization of tick borne pathogens
Ticks were also analyzed for the presence of selected protozoan pathogens. Tick DNA samples were examined by PCR for the presence of two pathogens Babesia and Theileria. Interestingly 9 ticks out of 50 samples examined were found positive for only Theileria. All the ticks were found negative for Babesia. The base pair length for Theileria was estimated ≈420-430 bp according to marker size.
The PCR products for tick 18S rRNA gene were further subjected to sequencing and phylogenetic analysis. The results of the sequence analysis showed that enquired sequences were of 18S rRNA gene of Theileria annulata. The two sequences were deposited in GenBank for accession numbers and assinged numbers to the genesequences for Theileria annulata in present study were:
(Genbank: MZ452895.1 and Genbank: MZ452896.1). For comparative purposes, the sequences of Theileria annulata were aligned from NCBI database. The phylogenetic tree was constructed based on Theileria annulata sequences obtained from District Poonch Azad Kashmir with the nucleotide sequences that are 85-100% similar to the reported species (Fig. 2). The similarity index of Theileria annulata with the reference strains of the Mardan Pakistan (Genbank: MT318159.1) is 99% and with the reference strain of Turkey (Genbank: KU714607.1) is 100%. In present study, to evaluate presence of protozoan pathogens in tick the 18S rRNA gene sequence was used. Our study results are in line with those detailed in other parts of world using same gene (Gargano et al., 2021; Ghafar et al., 2020; Ferrolho et al., 2016; Antunes et al., 2016; Irshad et al., 2010). Like our study (Tavassoli et al., 2011) first identified Rhipicephalus, Hyalomma and Hemaphysalis in their study and then Theileria annulata infection in tick vector. Similarly (Lca et al., 2007) reported nearly similar prevalence of Theileria annulata in ticks. The detection of Theileria annulata in ticks can be possibly due to the reason that the main vectors of the said pathogen were first encountered in this study that were further screened for pathogens presence. Microscopic and serological methods are also used for diagnosis of haemo-parasitic infections worldwide (Gubbels et al., 2000). However, these diagnostic methods are of limited value due to several limitations, including lower sensitivity and specificity, cross-reactivity, inability to detect carrier infections, and the requirement of expertise and time (Lew-Tabor, 2016; Igarashi and Parrodi, 2014; Mans et al., 2015). To overcome these limitations the use of highly sensitive molecular methods, including conventional PCR (cPCR), quantitative PCR (qPCR), nested PCR (nPCR), reverse line blotting (RLB), loop mediated isothermal amplification (LAMP), high-resolution melting (HRM) assays, high-throughput microfluidics-based real-time PCR and the next-generation sequencing (NGS) is in practice (Wang et al., 2019; Alessandra and Santo, 2012; Schnittger et al., 2004).
CONCLUSIONS
Present study confirms the existence of different tick species in the study area and ticks carry single protozoan species. The prevalence of ticks species and pathogen in the area may associate with the production losses in bovines. Therefore, it is recommended that a proper control measure plan should be formulated and implemented.
ACKNOWLEDGEMENTS
The authors are grateful to the farmer community of the study area for their cooperation during samples collection. Authors are also very thankful to Veterinary Officers, field staff of Livestock Department of Poonch District of Azad Kashmir and DVM students of University of Poonch for their support during tick collection.
Funding
Authors are grateful to Pakistan Agriculture Research Council (PARC) Animal Science Division Islamabad, Pakistan for financial support to complete present study under project No: AS-052.
IRB approval
The study was approved by PMAS AAUR Advanced Studies and Research Board under Notification No: PMAS AAUR- /DAS/624.
Ethical statement
Before ticks collection from infested cattle and buffalo prior consent was obtained from the owners.
Statement of conflict of interest
The authors have declared no conflict of interest.
REFERENCES
Abdigoudarzi, M., Noureddine, R. and Seitzer, U., 2011. rDNA-ITS2 identification of Hyalomma, Rhipicephalus, Dermacentor and Boophilus spp. (Acari: Ixodidae) collected from different geographical regions of Iran. Adv. Stud. Biol., 3: 221–238.
Alessandra, T. and Santo, C., 2012. Tick-borne diseases in sheep and goats: Clinical and diagnostic aspects. Small Rumin. Res., 106: S6–S11. https://doi.org/10.1016/j.smallrumres.2012.04.026
Ali, A., Parizi, L.F. and Ferreira, B.R., 2016. A revision of two distinct species of Rhipicephalus: R. microplus and R. australis. Cienc. Rural., 46: 1240–1248. https://doi.org/10.1590/0103-8478cr20151416
Ali, Z., Maqbool, A. and Muhammad, K., 2013. Prevalence of Theileria annulata-infected hard ticks of cattle and buffalo in Punjab, Pakistan. J. Anim. Pl. Sci., 23: 20–26.
Antunes, S., Ferrolho, J. and Domingues, N., 2016. Anaplasma marginale and Theileria annulata in questing ticks from Portugal. Exp. appl. Acarol., 70: 79–88. https://doi.org/10.1007/s10493-016-0057-y
Barker, S.C. and Walker, A.R., 2014. Ticks of Australia. The species that infest domestic animals and humans. Zootaxa, 3816: 1-144. https://doi.org/10.11646/zootaxa.3816.1.1
Batool, M., Nasir, S., Rafique, A., Yousaf, I. and Yousaf, M., 2019. Prevalence of tick infestation in farm animals from Punjab, Pakistan. Pak. Vet. J., 39: 2074-7764. https://doi.org/10.29261/pakvetj/2019.089
Brahma, R.K., Dixit, V., Sangwan, A.K. and Doley, R., 2014. Identification and characterization of Rhipicephalus (Boophilus) microplus and Haemaphysalis bispinosa ticks (Acari: Ixodidae) of North East India by ITS2 and 16S rDNA sequences and morphological analysis. Exp. appl. Acarol., 62: 253–265. https://doi.org/10.1007/s10493-013-9732-4
Chhillar, S., Chhilar, J.S. and Kaur, H., 2014. Investigations on some hard ticks (Acari: Ixodidae) infesting domestic buffalo and cattle from Haryana. J. Ent. Zool. Stud., 2: 99–104.
Cruickshank, R.H., 2002. Molecular markers for the phylogenetics of mites and ticks. Syst. appl. Acarol., 7: 3–14. https://doi.org/10.11158/saa.7.1.1
Dergousoff, S.H.J. and Chilton, N.B., 2007. Differentiation of three species of Ixodid tick Dandersoni, varabralis, albipictis by PCR-based approaches using markers in ribosomal DNA. Mol. Cell. Probes., 21: 343-348. https://doi.org/10.1016/j.mcp.2007.04.003
Estrada-Pena, A. and Salman, M., 2013. Current limitations in the control and spread of ticks that affect livestock: A review. Agriculture, 3: 221-235. https://doi.org/10.3390/agriculture3020221
Ferrolho, J., Antunes, S. and Santos, A.S., 2016. Detection and phylogenetic characterization of Theileria spp. and Anaplasma marginale in Rhipicephalus bursa in Portugal. Ticks Tick Borne Dis., 7: 443–448. https://doi.org/10.1016/j.ttbdis.2016.01.004
Ganjali, M., Dabirzadeh, M. and Sargolzaie, M., 2014. Species diversity and distribution of ticks (Acari: Ixodidae) in Zabol County, eastern Iran. J. Arthropod-Borne Dis., 8: 219.
Gargano, V., Blanda, V., Gambino, D., La Russa, F., Di Cataldo, S., Gentile, A. and Vicari, D., 2021. Serological survey and molecular characterization of Theileria annulata in sicilian cattle. Pathogens, 10: 101. https://doi.org/10.3390/pathogens10020101
Ghafar, A., Abbas, T. and Rehman, A., 2020. Systematic review of ticks and tick-borne pathogens of small ruminants in Pakistan. Pathogens, 9: 937. https://doi.org/10.3390/pathogens9110937
Greenfield, B.P.J., 2011. Environmental parameters affecting tick (Ixodesricinus) distribution during the Summer season in Richmond Park, London. Int. J. Stud. Res., 4: 140-148. https://doi.org/10.1093/biohorizons/hzr016
Gubbels, M.J., d’Oliveira, C. and Jongejan, F., 2000. Development of an indirect Tams1 enzyme-linked immunosorbent assay for diagnosis of Theileria annulata infection in cattle. Clin. Diagn. Lab. Immunol., 7: 404-411. https://doi.org/10.1128/CDLI.7.3.404-411.2000
Gudina, E., Getachew, Y. and Asebe, G., 2016. Distribution and prevalence of hard tick in cattle and around Gambella Town, Southwest Ethiopia. Int. J. Agric. Earth Sci., pp. 2489-0081.
Guglielmone, A.A., Robbins, R.G. and Apanaskevich, D.A., 2014. The hard ticks of the world. Springer, New York. https://doi.org/10.1007/978-94-007-7497-1
Hillis, D.M. and Dixon, M.T., 1991. Ribosomal DNA: Molecular evolution and phylogenetic inference. Q. Rev. Biol., 66: 411–453. https://doi.org/10.1086/417338
Hosseini-Chegeni, A., Hosseini, R., Tavakoli, M., Telmadarraiy, Z. and Abdigoudarzi, M., 2014. The Iranian Hyalomma (Acari: Ixodidae) with a key to the identification of male species. Persian J. Acarol., pp. 503–529.
Hussain, S., Saqib, M. and Ashfaq, 2021. First molecular evidence of Coxiella burnetii in ticks collected from dromedary camels in Punjab, Pakistan. Pak. Vet. J., 10: 29261.
Igarashi, I. and Parrodi, F., 2014. Bovine babesiosis. In: OIE Terrestrial Manual. World Organization for Animal Health, Paris, France.
Iqbal, A., Siddique, F. and Mahmood, M.S., 2014. Prevalence and impacts of ectoparasitic fauna infesting goats (Capra hircus) of district Toba Tek Singh, Punjab, Pakistan. Glob. Vet., 12: 158-164.
Irshad, N., Qayyum, M., Hussain, M. and Khan, M.Q., 2010. Prevalence of tick infestation and theileriosis in sheep and goats. Pak. Vet. J., 30: 178-180.
Jabeen, F., Mushtaq, M., Qayyum, M., Hasan, M.U., Zafar, M.A., Riaz, A. and Nasir, F., 2022. Tick taxonomy and nucleotide sequence analysis by internal transcribed spacer 2 (ITS 2) in large ruminants of Pothohar, Pakistan. Pak. Vet. J., 10: 29261.063
Jobir, D. and Gure, M., 2021. Study prevalence of hard tick infestation at South Western Kafa Zone Cheta Woreda. Int. J. Adv. Res. Biol. Sci., 8: 206-223.
Jongejan, F. and Uilenberg, G., 2009. The global importance of ticks. Parasitology, 129: 1-12. https://doi.org/10.1017/S0031182004005967
Kawther, M., El Kammah and El-Fiky, Z.A., 2005. Molecular marker of some tick genera in Egypt based on internal transcribed spaser 2(ITS2):1-Ixodidae (Boophilus and Hyalomma). Arab J. Biotech., 8: 61-66.
Khan, S.S., Ahmed, H., Afzal, M.S., Khan, M.R., Richard., Birtles, J. and Olive, J.D., 2022. Epidemiology, distribution and identification of ticks on livestock in Pakistan. Int. J. environ. Res. Publ. Hlth., 3024: 15-25. https://doi.org/10.3390/ijerph19053024
Kumar, S., Steche, G. and Tamura, K., 2016. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol., 33: 1870–1874. https://doi.org/10.1093/molbev/msw054
Labruna, M.B., Naranjo, V., Mangold, A.J., Thompson, C., Estrada-Pena, A., Guglielmone, A.A. and DeLaFuente, J., 2009. Allopatric speciation in ticks: Genetic and reproductive divergence between geographic strains of Rhipicephalus (Boophilus) microplus. BMC Evol. Biol., 9: 1-12. https://doi.org/10.1186/1471-2148-9-46
Lca, A., Vatansever, Z., Yildirim, A., Duzlu, O. and Inci, A., 2007. Detection of Theileria and Babesia species in ticks collected from cattle. Vet. Parasitol., 148: 156-160. https://doi.org/10.1016/j.vetpar.2007.06.003
Lempereur, L., Geysen, D. and Madder, M., 2010. Development and validation of a PCR–RFLP test to identify African Rhipicephalus (Boophilus) ticks. Acta Trop., 114: 55–58. https://doi.org/10.1016/j.actatropica.2010.01.004
Lew-Tabor, A.E., 2016. Anaplasmosis. In: The Merck Veterinary Manual, Merck & Co., Inc., Whitehouse Station, NJ, USA.
Mans, B.J., Pienaar, R. and Latif, A.A., 2015. A review of Theileria diagnostics and epidemiology. Int. J. Parasitol., 4: 104–118. https://doi.org/10.1016/j.ijppaw.2014.12.006
Mossaad, E., Gaithuma, A., Yassir, O., Mohamed., Suganuma, K., Umemiya-Shirafuji, R., Ohari, Y., Salim, B., Liu, M., Xuan, X., 2021. Molecular characterization of ticks and tick-borne pathogens in cattle from Khartoum State and East Darfur State Sudan. Pathogens, 10: 580. https://doi.org/10.3390/pathogens10050580
MotavalliHaghi, S.M. and Fakhar, M., 2013. Molecular identification of ovine Babesia spp. in North of Iran. Res. Mol. Med., 1: 35-39. https://doi.org/10.18869/acadpub.rmm.1.1.35
Patel, G., Shanker, D., Jaiswal, A.K., Sudan, V. and Verma, S.K., 2013. Prevalence and seasonal variation in ixodid ticks on cattle of Mathura district, Uttar Pradesh. J. Parasit. Dis., 37: 173–176. https://doi.org/10.1007/s12639-012-0154-8
Ramadan, M.Y., Elakabawy, L.M., Elmadawy, R.S. and Kamal, M.M., 2016. Prevalence of hard tick infesting cattle with a special reference to microscopic and molecular early diagnosis of tick born piroplasms. Benha Vet. Med. J., 2: 51-60. https://doi.org/10.21608/bvmj.2016.31329
Ramzan, M., Naeem-Ullah, U., Saba, S., Iqbal, N. and Saeed, S., 2020. Prevalence and identification of tick species (Ixodidae) on domestic animals in district Multan, Punjab Pakistan. Int. J. Acarol., 46. https://doi.org/10.1080/01647954.2020.1711803
Rees, D.J., Dioli, M. and Kirkendall, L.R., 2003. Molecules and morphology: Evidence for cryptic hybridization in African Hyalomma (Acari: Ixodidae). J. Mol. Phylogenet. Evol., 27: 131-142. https://doi.org/10.1016/S1055-7903(02)00374-3
Rehman, A., Nijhof, A.M., Sauter-Louis, C., Schauer, B., Staubach, C. and Conraths, F.J., 2017. Distribution of ticks infesting ruminants and risk factors associated with high tick prevalence in livestock farms in the semi-arid and arid agro ecological zones of Pakistan. Parasites Vectors, 10: 190. https://doi.org/10.1186/s13071-017-2138-0
Saitou, N. and Nei, M., 1987. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol., 4: 406-425.
Sajid, M.S., Iqbal, Z. and Khan, M.N., 2009. In vitro and in vivo efficacies of Ivermectin and Cypermethrin against the cattle tick Hyalomma anatolicum anatolicum (Acari: Ixodidae). Parasitol. Res., 105: 1133-1138. https://doi.org/10.1007/s00436-009-1538-2
Salih, D., El-Hussein, A. and Singla, L., 2015. Diagnostic approaches for tick-borne haemoparasitic diseases in livestock. J. Vet Med. Anim. Hlth., 7: 45–56. https://doi.org/10.5897/JVMAH2014.0345
Schnittger, L., Yin, H., Qi, B., Gubbels, M.J., Beyer, D., Niemann, S., Jongejan, F. and Ahmed, J.S., 2004. Simultaneous detection and differentiation of Theileria and Babesia parasites infecting small ruminants by reverse line blotting. Parasitol. Res., 92: 189–196. https://doi.org/10.1007/s00436-003-0980-9
Sultana, N., Shamim, A., Awan, M.S, Ali, U., Hassan, M. and Siddique, R.M., 2015. First pilot study on the prevalence of tick infestation in livestock of Tehsil Hajira, Rawalakot, Azad Kashmir. Adv. Anim. Vet. Sci., 3: 430-434. https://doi.org/10.14737/journal.aavs/2015/3.8.430.434
Tamura, K., Nei, M. and Kumar, S., 2004. Prospects for inferring very large phylogenies by using the neighbor-joining method. Proc. natl. Acad. Sci., 101: 11030-11035. https://doi.org/10.1073/pnas.0404206101
Tavassoli, M., Tabatabaei, M., Nejad, B.S., Tabatabaei, M.H., Najafabadi, A. and Pourseyed, S.H., 2011. Detection of Theileria annulata by the PCR-RFLP in ticks (Acari, Ixodidae) collected from cattle in West and North-West Iran. PAS Acta Parasitol., 56: 8–13. https://doi.org/10.2478/s11686-011-0001-6
Walker, A.R., Bouattour, A., Camicas, J.L., strada-Pena, A., Harok, I.G., Latif, A.A., Pegram, R.G. and Preston, P.M., 2014. Ticks of domestic animals in Africa: A guide to identification of species, Edinburgh, UK. Biosci. Rep., pp. 1-221.
Wang, J., Liu, A., Zhang, S., Gao, S., Rashid, M., Li, Y., Liu, J., Ma, Q., Li, Z. and Liu, Z., 2019. High resolution melting analysis of the 18S rRNA gene for the rapid diagnosis of bovine babesiosis. Parasit. Vectors, 12: 523. https://doi.org/10.1186/s13071-019-3781-4