In Vivo Evaluation of purD Gene Deleted Brucella abortus in Mice as Potential Vaccine Candidate for Control of Brucellosis
Muhammad Ilyas Riaz1, Masood Rabbani1*, Sohail Raza1, Ali Raza Awan2, Aleena Kokab1, and Rida Haroon Durrani1
1Institute of Microbiology, University of Veterinary and Animal Sciences, Lahore, Pakistan.
2Institute of Biochemistry and Biotechnology, University of Veterinary and Animal Sciences, Lahore, Pakistan.
ABSTRACT
Brucella abortus (B. abortus) RB51 is a globally recognized and widely practiced vaccinal strain for the control of bovine brucellosis but has several reported drawbacks including pathogenic potential for humans and excreted in body fluids of vaccinated animals. In the present study, we constructed a more attenuated B. abortus ΔpurD mutant by deleting the purD gene from the RB51 strain through site-directed mutagenesis. For virulence attenuation comparison with the parent RB51 strain, the constructed mutant was evaluated for attenuation estimation and clearance in BALB/c mice. The B. abortus ΔpurD mutant exhibited significant attenuation of virulence and cleared from the mice spleen after 20th DPI when inoculated at the dose of 108 CFU per mice. In contrast to this, the parent RB51 strain induces splenomegaly and showed higher persistence with significantly higher splenic CFUs in the mice group at 10th and 20th DPI as compared to B. abortus ΔpurD mutant. The histopathological comparison of spleens from both groups also revealed much infiltration of giant macrophages in the B. abortus ΔpurD mice group as compared to the parent RB51 mice group indicating superior immune response generation. The findings of this study revealed that the highly attenuated B. abortus ΔpurD mutant can be used effectively as a potential live attenuated vaccine candidate for the control of bovine brucellosis both in local and international settings.
Article Information
Received 01 September 2022
Revised 19 September 2022
Accepted 08 October 2022
Available online 15 February 2023
(early access)
Published 17 April 2024
Authors’ Contribution
Conceptualization MR, SR. Methodology MR, SR, MIR. Formal analysis MIR. Writing original draft preparation MIR, MR, SR, AK and ARA. Writing, review and editing SR, MR, MIR, ARA, AK, and RHD.
Key words
Brucella abortus, purD gene deletion, Mice evaluation, Attenuation, Histopathology
DOI: https://dx.doi.org/10.17582/journal.pjz/20220901090919
* Corresponding author: [email protected]
0030-9923/2024/0003-1271 $ 9.00/0
Copyright 2024 by the authors. Licensee Zoological Society of Pakistan.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
INTRODUCTION
Brucellosis is one of the prime and globally recognized infections of public health significance, disseminated to humans through direct contact with the diseased animal and by consumption of contaminated dairy and meat products of affected animals (Saeedinia et al., 2015). According to World Health Organization (WHO) annually more than 50,000 new cases of human brucellosis are reported all over the world (Ezama et al., 2018). Bovine brucellosis is caused by Brucella abortus and is characterized as a chronic infection targeting the reproductive system which leads to reproductive losses in the form of abortion in cattle and buffalo, reduced fertility in bulls, and, dreadful illness in humans (Ficht, 2003).
Previously, several vaccines have been developed and these vaccines are considered a key factor for the mitigation and control of bovine and ovine brucellosis in different disease control programs. Among these vaccines, live attenuated rough vaccine strain RB51 has been widely used in different geographical regions including Pakistan, both in the field and commercial dairy sector for control of bovine brucellosis (Schurig et al., 2002). Vaccination with RB51 strain does not generate immunoglobulins against the O-side chain of LPS in vaccinated animals, eliminating the serological issue of disease detection associated with smooth B. abortus strain S19 immunization (Olsen, 2000). In the past, the safety and stability of the RB51 strain have been investigated and published in different studies (Lord et al., 1998; Palmer et al., 1997).
However, the RB51 strain has several disadvantages including residual virulence, secreted in different body secretions, and could be isolated from vaccinated cows and buffalo fetuses, showing the possibility of enormous bacterial multiplication in the vaccinated animals (Galiero et al., 2006; Longo et al., 2009). The immunization with the RB51 strain also reported abortion in heifers, pregnant cows, and buffalo in many studies (Kreeger et al., 2000). In humans, the occupational and accidental exposure to the RB51 strain leads to severe local and systemic disorders (Ashford et al., 2004; Prevention, 2008). Therefore, the safety of the RB51 strain for human exposure is mainly undermined.
In this study, intending to enhance the safety of the RB51 vaccine, we developed a more attenuated mutant of the RB51 strain by deleting the purD (phosphoribosylamine-glycine ligase) gene through site-directed mutagenesis. The purD gene is involved in the de novo purine nucleotide biosynthesis pathway of the RB51 strain which has a pivotal role in the intracellular survival and replication inside the host. Further, in comparison to the parent RB51 strain, the ΔpurD deleted RB51 mutant was characterized by evaluation in the mouse models to comprehend its attenuation, replication, clearance from the body, and splenic effects through histopathological investigations (Truong et al., 2015).
MATERIALS AND METHODS
Bacterial strain and media
The RB51 strain of Brucella abortus was taken from the Diagnostic Laboratory of Central Lab Complex (CLC), of University of Veterinary and Animal Sciences, Lahore, Pakistan (UVAS) and was used by adopting strict biosafety practices as recommended by OIE (2018) for the culture of B. abortus. The culture of BA15 was done in Tryptone Soy Agar (TSA, Oxoid Ltd, Basingstoke, UK) supplemented with rifampicin (250 μg/ mL) and 1% fetal bovine serum (Gibco, Life Technologies Ltd, Paisley, UK) for the period of 4-5 days in CO2 incubator at 37oC (Saxena and Raj, 2018). Similar conditions were also adopted for culture in Tryptone Soy Broth (TSB, Oxoid Ltd, Basingstoke, UK) in CO2 shaking incubator for 24 h at 37o C and 150 rpm culturing conditions (Sergueev et al., 2017). Initially, the single isolated colonies were identified for characteristic B. abortus colony morphology and further processed for Gram staining technique for confirmation of Gram-negative and coccobacilli features of B. abortus. Afterwards, the molecular confirmation was done through PCR by using primers listed in Table1 targeting the IS711 repetitive region of the bacterial genome by adopting conditions published by (O’Leary et al., 2006).
Construction of purD gene deletion cassette
For the construction of the purD gene deletion plasmid cassette (pUC19-Kana-Up-Down) we choose kanamycin (K) resistant pUC19 (Thermoscientific, Vilnius, Lithuania) cloning vector and transformed it into Escherichia coli DH5α competent cells and positive colonies were screened on kanamycin supplemented (30µg/mL) LB media agar plate. For the cloning of the K gene into the pUC19 vector, the K sequence was amplified through PCR by using the pEP- kan DNA Template (Raza et al., 2016) and K-specific primers as mentioned in Table I and confirmed on agarose gel electrophoresis and confirmed amplicons were gel purified (Gene JET Gel Extraction and DNA Cleanup Micro Kit, Thermoscientific, USA). The K purified PCR product and pUC19 were subjected to restriction enzyme digestion analysis by using KpnI (Thermoscientific, Vilnius, Lithuania) and BamHI (Thermoscientific, Vilnius, Lithuania) restriction enzyme and confirmed on agarose gel electrophoresis. Afterward, K and pUC19 confirmed restriction enzyme digested products were gel purified and ligated by using T4 DNA Ligase (Thermoscientific, Vilnius, Lithuania) and transformed into E. coli DH5α cells which were further screened on K supplemented LB agar plat and named as pUC19-Kanamycin.
Table I. List of primers used in this study.
|
Primer |
Name |
Sequence (5’to 3’) |
Product size (bp) |
References |
|
Br. abortus |
B.A (F) |
GACGAACGGAATTTTTCCAATCCC |
498 |
(O’Leary et al., 2006) |
|
B.A (R) |
TGCCGATCACTTAAGGGCCTTCAT |
|||
|
Kanamycin |
KM (F) |
GCGGTACCTAGGGATAACAGGGTAATCGATTT (Kpn1) |
1004 |
(Raza et al., 2016) |
|
KM (R) |
CGGGATCCGCCAGTGTTACAACCAATTAACC (BamH1) |
|||
|
Upstream |
UP (F) |
GCGAATTCTCCTGATCGACCAGATCATTATAG (EcoR1) |
492 |
(Riaz et al., 2022) |
|
UP (R) |
CGGGTACCCATGCCTTGCTCCCTGCGCTTAAGATC (Kpn1) |
|||
|
Downstream |
DN(F) |
GCGGATCCTGATCGGTTTATGTTTCAGGTTACATG ((BamH1) |
482 |
(Riaz et al., 2022) |
|
DN(R) |
CGCTGCAGTCGCCGTGGCTTCGACCGTCACGT (Pstl) |
|||
|
purD |
PD(F) |
AACTGCAGGATGAAAGTTCTGTTGATC |
1280 |
(Truong et al., 2015) |
|
PD(R) |
GCTCTAGAGTCAGCGATTAGCCTTCTCA |
Bold letter indicates sequence of restriction sites inserted.
Cloning of upstream and downstream sequences into purD gene deletion cassette
For deleting the purD gene we designed two sets of primers to amplify DNA fragments in the upstream (Up) and downstream (Down) regions of the purD gene of B. abortus for cloning into the purD gene deletion cassette. The primer sequences of both upstream and downstream are shown in Table I. The purified DNA fragments of Up sequence and pUC19-Kanamycin were subjected to KpnI, EcoRI (Thermoscientific, Vilnius, Lithuania) restriction enzyme digestion and cloned into E. coli DH5α cells, and the resulting plasmid was isolated from transformed E. coli and confirmed through restriction enzyme digestion and named pUC19-Kanamycin-Up. Similarly, the purified DNA fragment of Down sequence and pUC19-Kanamycin-Up plasmid were subjected to BamHI, and PstI (Thermoscientific, Vilnius, Lithuania) restriction enzyme digestion and cloned into E. coli DH5α cells, and the resulting plasmid was isolated from transformed E. coli and confirmed through restriction enzyme digestion and named pUC19-Kanamycin-Up-Down.
Construction and confirmation of B. abortus ΔpurD mutant
The confirmed pUC19-Kanamycin-Up-Down gene deletion plasmid cassette was introduced into electrocompetent B. abortus cells prepared by adopting the method of (McQuiston et al., 1995) and electroporation conditions as per the protocol described previously (Lalsiamthara et al., 2020). The B. abortus ΔpurD mutant was screened on kanamycin supplemented TSA agar plate and final confirmation was done through PCR by detecting B. abortus, Kanamycin, and purD sequence by using primers listed in Table I.
Evaluation of B. abortus ΔpurD mutant in bagg and albio (BALB/c) mice
For the evaluation of B. abortus ΔpurD mutant seven-week old female BALB/c mice were purchased from the Department of Theriogenology, UVAS, and kept in three groups in individually ventilated cages in Animal House of Institute of Microbiology, UVAS. The two mice groups including (n= 10 per group) RB51 and B. abortus ΔpurD were intraperitoneally (i.p.) inoculated with standardized 3X108 CFU dose of the vaccinal RB51strain and B. abortus ΔpurD mutant in 0.2 mL of PBS (OIE, 2018) by adopting the method of (Truong et al., 2016). As a control, one mice group (n=10) was intraperitoneally inoculated with sterile PBS.
Virulence of B. abortus ΔpurD mutant in BALB/c mice
The clearance of the RB51 and B. abortus ΔpurD mutant was estimated by calculating the splenic bacterial colony-forming units (CFUs) in both groups as per the protocol described previously (Truong et al., 2015). On the 10th and 20th day post-inoculation (DPI), four mice from each group were sacrificed by following with the Institutional Guidelines of Ethical Review Committee, University of Veterinary and Animal Sciences and their spleens were removed and processed aseptically. The splenic weights were recorded and homogenized in sterile PBS (1 X) solution because of its isotonic and nontoxic nature and processed for ten-fold serial dilutions. The splenic homogenates were plated on TSA plates supplemented with kanamycin and purine bases including 1mM adenine, 1mM guanine, 1mM hypoxanthine, and 0.05 mM thiamine (Sigma-Aldrich, Merck, Darmstadt, Germany) by adopting the method of (Truong et al., 2015). The TSA plates were incubated at 37oC for 5 days and splenic CFUs were estimated to determine virulence and colonization efficiency of both parent RB51 and B. abortus ΔpurD mutant. The CFU results are expressed as the mean ± standard deviation of the log10 (log) for each group of mice.
Investigations of histopathological changes in BALB/c mice spleens
For the analysis of histopathological changes, spleens from each group were taken and processed in the Histopathology Lab, Department of Pathology, UVAS. The cutting of splenic tissues was done into suitable segments. After this, the tissues were fixed in a 10% neutral buffered formalin solution and subjected to multiple steps involving dehydration, clearing, and infiltration. After these steps blocks were prepared and 0.4 μm thick tissue slices were produced. In the final stage, these tissue sections were subjected to Hematoxylin and Eosin staining by adopting the previously described method (Bancroft et al., 1994). The slides were examined by using software DP20 under 40X objective lens of Microscope (Olympus CX31).
Statistical analysis and software used
The graphical maps of the pUC19-Kanamycin up down gene deletion cassette were constructed by using the software SnapGene 6.0.2. The data of the splenic weight and CFUs were analyzed by using the software GraphPad Prism 5. Analysis of variance (ANOVA) test was applied for comparison of B. abortus ΔpurD group with RB51 group. The P-value < 0.05 was considered statistically significant.
RESULTS
Colony morphology and molecular confirmation of Brucella abortus
After 4-5 days of incubation, B. abortus showed characteristics small, circular colonies with smooth margins and yellow honey color morphology on TSA media agar. The single colonies were further processed for Gram staining and under (100 X) oil immersion lens showing pink color coccobacilli appearance. The final confirmation was done through PCR by targeting the IS711 repetitive region of the bacterial genome indicating 498 bp band size on agarose gel electrophoresis.
Confirmation of pUC19-kanamycin-up-down gene deletion plasmid cassette
The pUC19-Kanamycin-Up-Down gene deletion plasmid cassette was constructed through the schematic manner (Fig. 1). The pUC19 cloned E. coli DH5α colonies plasmid confirmed pUC19 insertion by showing 2686 bp band size on agarose gel (Fig. 1B1). The Kanamycin sequence amplified DNA fragment showed 1004 bp band size (Fig. 1C1) and Kanamycin cloning into pUC19 transformed DH5α was confirmed through pUC19-Kanamycin transformed DH5α colonies plasmid restriction enzyme digestion showing two bands of 2686 bp of pUC19 and 986 bp of Kanamycin on agarose gel (Fig. 1C2). The UP fragment sequence amplified product showed 492 bp size (Fig. 1D1) and Up sequence insertion into pUC19-Kanamycin plasmid was confirmed via restriction enzyme digestion of pUC19-Kanamycin-up transformed E. coli DH5α colonies exhibiting two bands 2686 bp of pUC19 and 1455 bp of Kanamycin-Up fragments on agarose gel (Fig. 1D2).The down fragment sequence amplified product showed 482 bp size (Fig. 1E1) and down sequence cloning into pUC19-Kanamycin-Up plasmid was confirmed via restriction enzyme digest analysis of pUC19-Kanamycin Up–Down transformed E. coli DH5α colonies indicating two fragments of 2686 bp of pUC19 and 1909 bp size (Fig. 1E2) of Kana-Up-Down on agarose gel electrophoresis.
BALB/c mice splenic weight estimation
The splenic weights of both groups were also recorded for comparison and estimation of splenomegaly at 10th and 20th DPI (Fig. 2). The weighted analysis revealed that the mice group inoculated with B. abortus ΔpurD mutant exhibited significantly lower splenic weight at both time intervals in comparison to the other group inoculated with RB51, as was apparent by the lack of splenomegaly due to its less persistence and rapid clearance from spleen in comparison to parent RB51 strain. These findings indicate that the B. abortus ΔpurD mutant is more attenuated than the RB51 parent strain and also support our presumption that the purD gene of the purine biosynthesis pathway played a crucial role in the survival of RB15 in mice host.
Virulence of B. abortus ΔpurD mutant in (BALB/c) mice
The splenic CFUs count in both RB51 and B. abortus ΔpurD showed significant differences at 10th and 20th DPI. The B. abortus ΔpurD mutant enormously affected bacterial persistence in the spleen as compared to the parent RB51 strain by showing significantly lower CFUs count in the spleen (3.90-log CFU; P <0.001) in comparison to the parent RB51 strain (5.12-log CFUs) at 10th DPI. At 20th DPI, splenic CFUs decreased distinctly as no CFUs were observed in the B. abortus ΔpurD mutant mice group. However, 3.85 log CFUs counts were recorded from the spleens of the mice group inoculated with RB51strain as shown in (Fig. 3).
B. abortus ΔpurD mutant induced splenic histopathological changes
The splenic tissue histopathological investigation of the RB51 mice group revealed atrophy of follicular area and dead tissue masses with few giant cells in the focused area in the figure (Fig. 4A). However, in the B. abortus ΔpurD mutant mice group, the spleen showed numerous phagocytic cells with phagocytized bacterial cells inside with much infiltration of lymphocytes observed in the area focused in the figure (Fig. 4B). In the spleen of the control group, no tissue changes were observed and normal tissue parenchyma was noticed when observed (Fig. 4C).
DISCUSSION
Even though B. abortus RB15 live attenuated strain is widely used and recommended vaccinal strain for the mitigation and control of bovine brucellosis all over the globe. However, this strain has several documented side effects and limitations reported in both animals and human beings (Arellano-Reynoso et al., 2004; Yazdi et al., 2009). Therefore, the prime objective of this study was to construct and evaluate a gene-deleted B. abortus mutant by targeting a crucial gene responsible for intracellular replication and survival inside the host by improving the safety and enhancing the attention of the RB51 strain. To our knowledge, this is the first study in Pakistan reporting the in vivo evaluation of gene deleted B. abortus in mice model in comparison to the parent RB51 strain.
In our study, we targeted the purD (phosphor ribosylamine-glycine ligase) gene which played a key role in bacterial de novo purine biosynthesis during its replication in the targeted host. In several bacterial species, the mutations in de novo purine biosynthesis pathways have been studied, and established that these pathways played a critical role in bacterial virulence and survival inside host cells. The search for different virulence factors in Brucella has recognized several purine biosynthesis genes contributing to replication and survival within the host (Drazek et al., 1995; Kim et al., 2003). One of the studies reported that mutation in the purE gene outstandingly attenuate the B. melitensis in goat and mice and, protection against brucellosis with this mutant’s vaccine recommended that purine auxotrophy could be a prime choice to construct and develop more attenuated and much safer vaccines for brucellosis mitigation (Drazek et al., 1995).
In this study, kanamycin gene sequence insertion in the purD gene of B. abortus showed auxotrophy for de novo purine bases, which are the prime source of DNA and RNA nucleotide synthesis and imperative for Brucella proliferation and survival inside the host system (Köhler et al., 2002). We developed a B. abortus ΔpurD mutant by constructing a pUC19-Kanamycin-Up-Down gene deletion plasmid cassette and transfecting it into electrocompetent B. abortus cells through electroporation. Before the construction of the plasmid cassette, the RB51 strain was cultured and its final confirmation was done through PCR against the IS711 repetitive region similar to the study published on biocontrol of B. abortus (Shaheen et al., 2021).
The pUC19-Kanamycin-Up-Down gene deletion plasmid cassette was constructed by cloning the pUC19 vector into E. coli DH5α cells and transformed DH5α colonies plasmid size 2686 bp confirming transformation similar to the results reported by (Schweizer, 1991). The kanamycin gene amplification was done through PCR on gel electrophoresis and the amplicon size 1004 bp was similar to a previous study published by (Raza et al., 2016). The purD gene upstream and downstream sequences were amplified, cutted, and inserted into the previously transformed pUC19-Kanamycin vector and confirmed on gel electrophoresis allied to mentioned (Saeedinia et al., 2015). The B. abortus ΔpurD mutant was constructed successfully by transfecting constructed purD gene deletion plasmid cassette into B. abortus electrocompetent cells and mutant colonies characteristics on TSA agar were quite similar to an earlier study published by (Lalsiamthara et al., 2020). The final confirmation of constructed B. abortus ΔpurD mutant was done through PCR with no band of purD gene in the deleted mutant observed which was similar to the preceding study reported by (Truong et al., 2015).
In the present study, we also aimed to evaluate B. abortus ΔpurD mutant persistence and attenuation status in the mice model in comparison to the parent RB51 strain. The constructed B. abortus ΔpurD mutant showed remarkably reduced splenomegaly at both 10th and 20th DPI as compared to the mice group inoculated with RB51 strain. Furthermore, distinctly reduced splenomegaly linked with mice inoculation recommended that B. abortus ΔpurD mutant have higher attenuation for virulence as compared to the parent RB51 strain, which instigates splenomegaly in the RB51 mice group and these findings are similar to one of the studies published by (Truong et al., 2016).
Moreover, the splenic persistence evaluation results of both groups revealed that B. abortus ΔpurD mutant showed minimal persistence in spleen and was cleared from mice spleen at 20th DPI as compared to RB51 mice group which showed higher splenic persistence even at 20th DPI. Additionally, the splenic CFUs count was quite lower in the B. abortus ΔpurD group at 10th DPI with no CFUs count at 20th DPI, while high splenic CFUs count was recorded in the RB51 mice group at both 10th and 20th DPI indicating lower attenuation status of RB51 strain as compared to B. abortus ΔpurD mutant which coincides with the findings of (Truong et al., 2015).
In this study, we also investigated histopathological changes within the spleen of all three mice groups. In the RB51 mice group, splenic changes were characterized by a lower degree of aggregates of macrophage giant cells with some degree of the atrophic area also noticed during microscopic analysis. In the B. abortus ΔpurD mutant group a higher degree of aggregates of giant macrophage infiltration and tissue, spaces are well occupied by these infiltrating giant bacterial engulfed cells which closely resembled the findings published by (Stranahan et al., 2019). In the control group without any bacterial inoculation, no cellular changes were noticed and normal parenchyma was observed.
CONCLUSION
These findings collectively stipulated that higher attenuation and lower splenic persistence inside the host make B. abortus ΔpurD mutant an attractive and suitable live attenuated vaccinal candidate from a safety and virulence attenuation point of view for control of bovine brucellosis all over the globe.
Funding
For this study, all resources are provided by Institute of Microbiology, UVAS, Lahore.
IRB approval
The study was approved by Advanced Studies and Research Board (ASRB), UVAS (DAS/1072/250518).
Ethical statement
The housing and handling of lab animals during animal experimentation was performed in accordance with the University of Veterinary and Animal Sciences, Lahore guidelines for the care and use of lab animals. All procedures were approved by the Ethical Review Committee of University of Veterinary and Animal Sciences, Lahore (Permit Number 442-291021).
Statement of conflict of interest
The authors have declared no conflict of interest.
REFERENCES
Arellano-Reynoso, B., Dı́az-Aparicio, E., Leal-Hernández, M., Hernández, L. and Gorvel, J.P., 2004. Intracellular trafficking study of a RB51 B. abortus vaccinal strain isolated from cow milk. Vet. Microbiol., 98: 307-312. https://doi.org/10.1016/j.vetmic.2003.10.024
Ashford, D.A., di Pietra, J., Lingappa, J., Woods, C., Noll, H., Neville, B., Weyant, R., Bragg, S.L., Spiegel, R.A., and Tappero, J., 2004. Adverse events in humans associated with accidental exposure to the livestock brucellosis vaccine RB51. Vaccine, 22: 3435-3439. https://doi.org/10.1016/j.vaccine.2004.02.041
Bancroft, J.D., Cook, H.C., and Stirling, R.W., 1994. Manual of histological techniques and their diagnostic application. In: Manual of histological techniques and their diagnostic application. pp. 457-457.
Drazek, E.S., Houng, H., Crawford, R.M., Hadfield, T.L., Hoover, D.L., and Warren, R.L., 1995. Deletion of purE attenuates Brucella melitensis 16M for growth in human monocyte-derived macrophages. Infect. Immun., 63: 3297-3301. https://doi.org/10.1128/iai.63.9.3297-3301.1995
Ezama, A., Gonzalez, J.P., Majalija, S., and Bajunirwe, F., 2018. Assessing short evolution brucellosis in a highly brucella endemic cattle keeping population of Western Uganda: A complementary use of Rose Bengal test and IgM rapid diagnostic test. BMC Publ. Hlth., 18: 1-5. https://doi.org/10.1186/s12889-018-5228-9
Ficht, T.A., 2003. Intracellular survival of Brucella: Defining the link with persistence. Vet. Microbiol., 92: 213-223. https://doi.org/10.1016/S0378-1135(02)00367-X
Galiero, G., Martucciello, A., Astarita, S., Iovane, G., Pagnini, U., Fusco, G., and Guarino, A., 2006. Isolation of Brucella abortus strain RB51 from two buffalo fetuses. Vet. Rec., 159: 563. https://doi.org/10.1136/vr.159.17.563
Kim, S., Watarai, M., Kondo, Y., Erdenebaatar, J., Makino, S.I. and Shirahata, T., 2003. Isolation and characterization of mini-Tn 5 Km2 insertion mutants of Brucella abortus deficient in internalization and intracellular growth in HeLa cells. Infect. Immun., 71: 3020-3027. https://doi.org/10.1128/IAI.71.6.3020-3027.2003
Köhler, S., Foulongne, V., Ouahrani-Bettache, S., Bourg, G., Teyssier, J., Ramuz, M., and Liautard, J.P., 2002. The analysis of the intramacrophagic virulome of Brucella suis deciphers the environment encountered by the pathogen inside the macrophage host cell. Proc. natl. Acad. Sci., 99: 15711-15716. https://doi.org/10.1073/pnas.232454299
Kreeger, T.J., Miller, M.W., Wild, M.A., Elzer, P.H., and Olsen, S.C., 2000. Safety and efficacy of Brucella abortus strain RB51 vaccine in captive pregnant elk. J. Wildl. Dis., 36: 477-483. https://doi.org/10.7589/0090-3558-36.3.477
Lalsiamthara, J., Kaur, G., Gogia, N., Ali, S.A., Goswami, T.K., and Chaudhuri, P., 2020. Brucella abortus S19 rfbD mutant is highly attenuated, DIVA enable and confers protection against virulent challenge in mice. In Biologicals. pp. 62-67. https://doi.org/10.1016/j.biologicals.2019.11.005
Longo, M., Mallardo, K., Montagnaro, S., De Martino, L., Gallo, S., Fusco, G., Galiero, G., Guarino, A., Pagnini, U., and Iovane, G., 2009. Shedding of Brucella abortus rough mutant strain RB51 in milk of water buffalo (Bubalus bubalis). Prev. Vet. Med., 90: 113-118. https://doi.org/10.1016/j.prevetmed.2009.03.007
Lord, V., Schurig, G., Cherwonogrodzky, J., Marcano, M., and Melendez, G., 1998. Field study of vaccination of cattle with Brucella abortus strains RB51 and 19 under high and low disease prevalence. Am. J. Vet. Res., 59: 1016-1020.
McQuiston, J.R., Schurig, G.G., Sriranganathan, N., and Boyle, S.M., 1995. Transformation of Brucella species with suicide and broad host-range plasmids. In: Electroporation protocols for microorganisms. (Springer), pp. 143-148. https://doi.org/10.1385/0-89603-310-4:143
O’Leary, S., Sheahan, M., and Sweeney, T., 2006. Brucella abortus detection by PCR assay in blood, milk and lymph tissue of serologically positive cows. Res. Vet. Sci., 81: 170-176. https://doi.org/10.1016/j.rvsc.2005.12.001
OIE, 2018. Manual of diagnostic tests and vaccines for terrestrial animals. In: Biosafety and biosecurity: Standard for managing biological risk in the veterinary diagnostic laboratories and animal facilities. World Organisation for Animal Health.
Olsen, S.C., 2000. Immune responses and efficacy after administration of a commercial Brucella abortus strain RB51 vaccine to cattle. Vet. Ther., 1: 183-191.
Palmer, M., Olsen, S., and Cheville, N., 1997. Safety and immunogenicity of Brucella abortus strain RB51 vaccine in pregnant cattle. Am. J. Vet. Res., 58: 472-477.
Prevention, C.F.D.C., 2008. Update: Potential exposures to attenuated vaccine strain Brucella abortus RB51 during a laboratory proficiency test United States and Canada, 2007. MMWR Morb. Mortal. Wkly. Rep., 57: 36-39.
Raza, S., Deng, M., Shahin, F., Yang, K., Hu, C., Chen, Y., Chen, H., and Guo, A., 2016. A bovine herpesvirus 1 pUL51 deletion mutant shows impaired viral growth in vitro and reduced virulence in rabbits. Oncotarget, 7: 12235. https://doi.org/10.18632/oncotarget.7771
Saeedinia, A.R., Zeinoddini, M., Soleimani, M., and Sadeghizadeh, M., 2015. A new method for simultaneous gene deletion and down-regulation in Brucella melitensis Rev. 1. Microbiol. Res., 170: 114-123. https://doi.org/10.1016/j.micres.2014.08.007
Saxena, H.M., and Raj, S., 2018. A novel immunotherapy of brucellosis in cows monitored non invasively through a specific biomarker. PLoS Negl. Trop. Dis., 12: e0006393. https://doi.org/10.1371/journal.pntd.0006393
Schurig, G.G., Sriranganathan, N., and Corbel, M.J., 2002. Brucellosis vaccines: Past, present and future. Vet. Microbiol., 90: 479-496. https://doi.org/10.1016/S0378-1135(02)00255-9
Schweizer, H., 1991. Escherichia-pseudomonas shuttle vectors derived from pUC18/19. Gene, 97: 109-112. https://doi.org/10.1016/0378-1119(91)90016-5
Sergueev, K.V., Filippov, A.A., and Nikolich, M.P., 2017. Highly sensitive bacteriophage-based detection of Brucella abortus in mixed culture and spiked blood. Viruses, 9: 144. https://doi.org/10.3390/v9060144
Shaheen, A.Y., Sheikh, A.A., Rabbani, M., Shehzad, W., Abbas, Z., and Maqbool, M., 2021. Isolation, propagation and biocontrol activity of indigenous bacteriophages against Brucella abortus. Int. J. Agric. Biol., 25: 1066-1074. https://doi.org/10.17957/IJAB/15.1765
Stranahan, L.W., Khalaf, O.H., Garcia-Gonzalez, D.G., and Arenas-Gamboa, A.M., 2019. Characterization of Brucella canis infection in mice. PLoS One, 14: e0218809. https://doi.org/10.1371/journal.pone.0218809
Truong, Q.L., Cho, Y., Barate, A.K., Kim, S., Watarai, M., and Hahn, T.W., 2015. Mutation of purD and purF genes further attenuates Brucella abortus strain RB51. Microb. Pathog., 79: 1-7. https://doi.org/10.1016/j.micpath.2014.12.003
Truong, Q.L., Cho, Y., Park, S., Kim, K., and Hahn, T.W., 2016. Brucella abortus ΔcydCΔcydD and ΔcydCΔpurD double-mutants are highly attenuated and confer long-term protective immunity against virulent Brucella abortus. Vaccine, 34: 237-244. https://doi.org/10.1016/j.vaccine.2015.11.030
Yazdi, H.S., Kafi, M., Haghkhah, M., Tamadon, A., Behroozikhah, A., and Ghane, M., 2009. Abortions in pregnant dairy cows after vaccination with Brucella abortus strain RB51. Vet. Rec., 165: 570. https://doi.org/10.1136/vr.165.19.570