Research Article

Molecular Prevalence of Theileriosis in Calf at Babylon, Iraq

Ahmed Kareem Kadhim Al-Wasmee1, Waddah Salam Hassone2, Hawraa Talib Al-Janabi3, Hamed AH Al-Jabory1

1College of Veterinary Medicine, Al-Qasim Green University, Babylon City, Iraq; 2Ministry of Agriculture, Babylon City, Iraq; 3College of Biotechnology, Al-Qasim Green University, Babylon City, Iraq.

Abstract | Theileria annulata, a tick-borne hemoprotozoan parasite that result in a tropical theileriosis in bovine herds and causes significant economic losses in the cattle sector. We estimated and interpreted the frequency of theileriosis in the calf herds in Babylon Province. We carried out the study from July until the end of December 2022 in several regions of Babylon Province. Ninety jugular vein blood samples were collected. The calves ranged from <1 M to ≥4 M and both sexes were represented. Two ml of blood were placed in sterile, EDTA-treated tubes, and were sent to the parasitology lab in an ice pack. The blood was put in a deep freezer set at -20oC for DNA extraction. This genomic DNA purification was used following the instructions provided in the kit to extract the parasite DNA. The results revealed that the rates of infection of calves with T. anullata in Babylon Province were 36/90. The infection rate of T. anullata was recorded for females (47.5%) and males (34 %). Results showed that the highest infection rate (62.5%) was recorded at the <1 M, (39.1%), at 1-2 M, (20%) at 2-3 M, (22.7%) at the 3-4 M, and the lowest infection rate (14.3%) was recorded at the ≥4 M. The infection rate of calves with T. anullata (46.7%) was recorded in July. The highest infection rate (66.7%) was recorded in August and September; (33.3%) in October, and the lowest infection rate (13.3%) was recorded in November and December. There was a greater infection in female calves compared to males. Furthermore, there was an association between the disease and the surrounding temperature. These results serve as a starting point and make it easier to conduct future extensive epidemiological studies on tropical theileriosis in the calf herd on a national scale.

Keywords | Prevalence, Calf, Theileriosis, Molecular study


Received | January 24, 2024; Accepted | February 27, 2024; Published | April 16, 2024

*Correspondence | Waddah Salam Hassone, Ministry of Agriculture, Babylon City, Iraq; Email: [email protected]

Citation | Al-Wasmee AKK, Hassone WS, Al-Janabi HT, Al-Jabory HAH (2024). Molecular prevalence of theileriosis in calf at Babylon, Iraq. Adv. Anim. Vet. Sci., 12(6):1061-1065.

DOI | https://dx.doi.org/10.17582/journal.aavs/2024/12.6.1061.1065

ISSN (Online) | 2307-8316

Copyright: 2024 by the authors. Licensee ResearchersLinks Ltd, England, UK.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).



INTRODUCTION

Bovine Tropical Theileriosis, also referred to as Theileriosis, is a tick-borne disease (TBD) that is ubiquitous around the world but is most prevalent in Southern Europe, Northern Africa, the Middle East, and Asia. Theileria annulata, a hemoprotozoan parasite, is the culprit. Geographically, it is also known as Mediterranean Theileriosis. Tropical bovine theileriosis, which has a major negative impact on animal productivity, especially in developing countries, poses a threat to about 250 million cattle (El-Damaty et al., 2022).

When the right tick vectors are present, members of the family Theileridae (order Piroplasmida, genus Theileria) parasitize both wild and domestic animals, causing theileriosis (Kiara et al., 2018). According to Valente et al. (2023), tropical bovine theileriosis is a serious illness spread by ticks. Due to immediate contact with infected ticks, which are more active in the summer and rainy seasons, the newborn calves displayed a high-risk group (Singh et al., 2017). Calves born to dams who had received the cell culture vaccination for tropical theileriosis were likewise susceptible to the disease.

There is little information available on the hematological investigations on the disease in these native pure breed calves, despite theileriosis becoming a major and fatal condition in young calves (Singh et al., 2017). Strong evidence points to an intrauterine infection with T. annulata, and the infection appears to have started before conception (Sudan et al., 2012). T. annulata increases the degree of impermanence on a farm, reduces output, and restricts the growth plans of various breeds (Ullah et al., 2021).

PCR has been demonstrated to be a susceptible and accurate method for diagnosing bovine tropical theileriosis, especially in identifying samples that were negative on blood and lymph smears (Madkour et al., 2023). Thus, we aimed to estimate and interpret the frequency of theileriosis in calf herds of Babylon. They carried out the study from July until the end of December 2022 in several regions of Babylon.

MATERIALS AND METHODS

Period of study

The study was carried out in Babylon Province between July and the end of December 2022. Several cooling technologies inside the brans were used to control temperature and relative humidity including ventilation, outside cooling systems with heat exchangers, evaporation and desiccant systems were employed to manage the climatic conditions needed to raise the calves used for the study.

Calves are fed on milk and green hay and have access to clean, fresh water, and are not contaminated by dung, feedstuff, or additional environmental pollutants.

Natural lighting source, regular rodenticide and insecticide disinfection were used in the calf housing, and the absence of any treatment program for the calves employed in this study.

Blood collection

90 animals of both sexes between the ages of one month and four months had their jugular vein blood samples collected. Two milliliters of blood had to be drawn into sterile, EDTA-treated tubes (Thermo Fisher Scientific, Spain), moved quickly with an ice pack, and then frozen at -20°C to extract the DNA.

DNA extraction

The parasite DNA was extracted using the Geneaid (Korea) genomic DNA isolation kit as directed by the product’s instructions. 200 µl of frozen blood was used as the initial substance for the first stage of the DNA extraction process. The final DNA product was NanoDrop, Thermo Scientific/ UK which was found to be both excellent quality and quantity.

PCR

T. annulata was identified using the rRNA gene as a molecular target primers: F: ATTGCTTGTGTCCCTCTGGG and R: TCCACCAACTAAGAACGGCC. The 18S rRNA gene was used to identify T. annulata (620 bp), (Hailemariam et al., 2017). For the PCR, the 20µl reaction mixture included 10μl of the green master mix, 1μl of each upstream and downstream primer, 2μl of the DNA template, 5.5μl of water for molecular usage, and 0.5μl of MgCl2. 72ºC for 5 minutes was used for the one-cycle initial denaturation, 39-cycle main denaturation, annealing, and main extension, and one cycle for a final extension. The thermocycler settings were 95ºC for 5 minutes (Denaturation 95ºC for 35s, Annealing 57ºC for 35s, and Extension72ºC for the 40s). 0.5 μg/ml ethidium bromide was used with 2% agarose gel for the electrophoresis. After that, a UV imager was used to study the bands.

Statistical analysis

Analysis was done using SPSS (Statistical Package for Social Sciences) version 26. The association between infection rate and each of the animals was detected using the Chi-square test. Probability values of P <0.05 were considered statistically significant (SAS, 2012).

RESULTS AND DISCUSSION

Prevalence study

Total rates of infection of calves with T. anullata

The total infection rate of calves with T. anullata from July to the end of December 2022 in different regions of Babylon Province was (36/90) Table 1.

Table 1: Total rates of infection of calves with T. anullata at Babylon Province.

No. of samples examined

No. of positive samples

90

36

Infection rate of T. anullata according to sex

Females recorded 47.5% while males recorded 34% as shown in Table 2.

Infection rates of T. anullata according to age groups

Results showed that the highest infection rate 62.5% was recorded at <1 M, 39.1% at 1-2 M, 20% at 2-3 M age, 22.7% at 3-4 M age, while lowest infection rate 14.3% was recorded at ≥4 M Table 3.

 

Table 2: Infection rate of T. anullata according to sex.

Sex

No. of samples examined

No. of infected calves

(%)

Female

40

19

47.5

Males

50

17

34

Total

90

36

40

P-value

0.193931

X2

1.687500 NS

 

NS: Non-significant differences at (P≤0.05).

 

Table 3: Infection rates of T. anullata according to age groups.

Age group

No. of samples

No. of infected calves

(%)

<1 M

24

15

62.5

1-2 M

23

9

39.1

2-3 M

20

4

20

3-4 M

22

5

22.7

≥4 M

21

3

14.3

Total

90

36

32.7

P-value

0.003291*

X2

15.805652

 

*: Significant differences at (P≤0.05).

 

Infection rate of T. anullata according to months of study

July recorded 46.7% infection rates. The highest infection rate 66.7% was recorded in August and September, 33.3% in October, while the lowest infection rate 13.3% was recorded in November and December as shown in Table 4.

Molecular study

The current study results revealed the occurrence of T. annulata in the confirmed samples of blood from the calves.

T. annulata is a tick-borne pathogen that causes a massive economic and health impact in calf herds, contributing to significant death rates and damage to efficiency as show in Figure 1 (Gomes et al., 2013).

 

Table 4: Infection rate of T. anullata according to months of study.

Month

No. of samples

No. of infected calves

(%)

July

15

7

46.7

August

15

10

66.7

September

15

10

66.7

October

15

5

33.3

November

15

2

13.3

December

15

2

13.3

Total

90

36

40

P-Value

0.002556*

X2

18.333333

 

*: Significant differences at (P≤0.05).

 

 

In the current study, many epidemiological aspects of a herd of calves of both sexes in Babylon Province were examined. This demonstrated a greater prevalence of female T. annulata infection (47.5%) compared to male infection (34%). Although there were more males than females in this study, this contradicts Valente et al. (2023), who found that females were more likely to be infected with T. annulata than males were, and Calleja-Bueno et al. (2017), who found that newly younger calves are less likely to be exposed to infectious and parasitic diseases.

Moreover, in this study, the possibility of infection with T. annulata in calf decreases suggestively with increasing age. Results showed that the highest infection rate (62.5%) was documented at <1 M, 39.1% at 1-2 M, 20% at 2-3 M, 22.7% at 3-4 M, and the lowest 14.3% infection rate was documented at ≥4 M.

Furthermore, the infection rate of T. annullata in the present study was recorded according to months of the year: in July, was 46.7%; in August and September, the highest infection rate was 66.7%; in October was 33.3%; and the lowest infection rate was 13.3% in November and December. This variation in infection in this study month may be due to the spread of tick-borne diseases and higher temperatures (Moumouni et al., 2015).

According to particular studies on many classes of ticks, habitats with higher temperatures also result in more eggs being produced and eggs that are more likely to hatch (Esteves et al., 2015).

PCR-based molecular diagnostics may be done to detect out the parasite’s prevalence in an group of cattle while disregarding the limitations of blood smear testing (Faraj et al., 2019; Al-Abedi and Al-Amery, 2021).

CONCLUSIONS and Recommendations

In female calves there was a high infection established compared to males. Additionally, there had been a relationship between the temperature of the environment and diseases.

ACKNOWLEDGMENT

The authors are thankful to the all staff researcher.

Novelty Statement

The majority of this study has been devoted to the identification and measurement of T. annulata DNA in blood samples using molecular PCR technique. Ideas differ over the best objectives to employ, and the inadequacy of diagnostic tools make it challenging to compare labs.

AUTHOR’S CONTRIBUTION

Every author made an equal contribution.

Ethical statement

The writers took into account all ethical concern, such as plagiarism, and duplicate research.

Conflict of interest

The authors have declared no conflict of interest.

REFERENCES

Al-Abedi G, Al-Amery A (2021). Molecular diagnosis and phylogenetic analysis of babesia species isolated from ticks of infested cattle in Wasit Governorate, Iraq. Iraqi J. Agric. Sci., 52(1). https://doi.org/10.36103/ijas.v52i1.1245

Calleja-Bueno L, Sainz Á, García-Sancho M, Rodríguez-Franco F, González-Martín JV, Villaescusa A (2017). Molecular, epidemiological, haematological and biochemical evaluation in asymptomatic Theileria annulata infected cattle from an endemic region in Spain. Ticks Tick Borne Dis., 8: 936–941. https://doi.org/10.1016/j.ttbdis.2017.08.006

El-Damaty HM, Yousef SG, El-Balkemy FA, Nekouei O, Mahmmod YS, Elsohaby I (2022). Seroprevalence and risk factors of tropical theileriosis in smallholder asymptomatic large ruminants in Egypt. Front. Vet. Sci., (9): 1004378. https://doi.org/10.3389/fvets.2022.1004378

Esteves E, Pohl PC, Klafke GM, Reck J, Fogaça AC, Martins JR, Daffre S (2015). Low temperature affects cattle tick reproduction but does not lead to transovarial transmission of Anaplasma marginale. Vet. Parasitol., 214: 322–326. https://doi.org/10.1016/j.vetpar.2015.07.010

Faraj A, Hade B, Al-Amery AM (2019). Conventional and molecular study of Babesia spp. of natural infection in dragging horses at some areas of Baghdad city, Iraq. Iraqi J. Agric. Sci., 50(3): 909-915. https://doi.org/10.36103/ijas.v50i3.707

Gomes J, Soares R, Santos M, Santos-Gomes G, Botelho A, Amaro A, Inácio J (2013). Detection of Theileria and Babesia infections amongst asymptomatic cattle in Portugal. Ticks Tick Borne Dis., 4: 148–151. https://doi.org/10.1016/j.ttbdis.2012.07.002

Hailemariam Z, Krücken J, Baumann M, Ahmed JS, Clausen PH, Nijhof AM (2017). Molecular detection of tick-borne pathogens in cattle from Southwestern Ethiopia. PLoS One, 12(11): 1-16. https://doi.org/10.1371/journal.pone.0188248

Kiara H, Steinaa L, Nene V, Svitek N (2018). Theileria in ruminants. Parasitic protozoa of farm animals and pets, pp. 187-213. https://doi.org/10.1007/978-3-319-70132-5_8

Madkour BS, Karmi M, Youssef MA, Abdelraouf A, Abdel-Rady A (2023). Epidemiological and diagnostic investigation on bovine theileriosis in Aswan Governorate, Egypt. J. Parasit. Dis., 47(1): 124-130. https://doi.org/10.1007/s12639-022-01547-6

Moumouni PFA, Aboge GO, Terkawi MA, Masatani T, Cao S, Kamyingkird K, Jirapattharasate C, Zhou M, Wang G, Liu M (2015). Molecular detection and characterization of Babesia bovis, Babesia bigemina, Theileria species and Anaplasma marginale isolated from cattle in Kenya. Parasit. Vectors, 8: 496. https://doi.org/10.1186/s13071-015-1106-9

SAS Statistical Analysis System (2012). User’s guide, statistical. Version 9.1th ed. SAS. Inst. Inc. Cary. N.C. USA.

Singh J, Acharya AP, Panda SK, Patra BK, Behera K (2017). Theilerial infection in young bovine calves in Odisha, India. J. Entomol. Zool., Stud., 5(5): 1201-1204.

Sudan V, Sharma RL, Borah MK, Mishra R (2012). Acute bilateral proptosis in a cross bred calf naturally infected with Theileria annulata. J. Parasitic Dis., 36(2): 215-219. https://doi.org/10.1007/s12639-012-0111-6

Ullah R, Shams S, Khan MA, Ayaz S, Akbar NU, Din QU, Khan A, Leon R, Zeb J (2021). Epidemiology and molecular characterization of Theileria annulata in cattle from central Khyber Pakhtunkhwa, Pakistan. PLoS One, 16: e0249417. https://doi.org/10.1371/journal.pone.0249417

Valente D, Dutra AP, Carolino N, Gomes J, Coelho AC, Espadinha P, Carolino I (2023). Prevalence and risk factors associated with Theileria annulata infection in two bovine portuguese autochthonous breeds. Pathogens, 12(5): 669. https://doi.org/10.3390/pathogens12050669