Screening of Transcriptional Differential Genes in Antler After Top Pruning and Expression Characteristics of BVES Gene

Hong Chen1,2, Jiawei Liu1,2, Chuan Lin1,2, Hao Lv1,2, Jiyun Zhang1,2, Xiaodong Jia1,2, Qinghua Gao1,2 and Chunmei Han1,2*

1College of Animal Science and Technology, Tarim University, Alar 843300, XinJiang, China.

2Key laboratory of Tarim Animal Husbandry Science and Technology, XinJiang, Production and Construction Corps, Alar 843300 Xinjiang, China

ABSTRACT

The unique mammalian appendage antler is a good model for studying tissue regeneration and its related mechanism. This study explored the mechanism of the rapid growth of regenerated antlers after top pruning damage using transcriptome sequencing technology. A damage repair model was constructed by top pruning treatment on the left antlers of three 10-month-old Tarim red deer, and RNA-seq analysis was performed on the Illumina platform to compare the transcriptome sequencing results of the left regenerated antlers with the right healthy antlers. Among a total of 56 differentially expressed genes (DEGs) that were screened, 37 were up-regulated and 19 were down-regulated; the most significant changes were seen for the BVES gene (up-regulated gene); thus, this gene was further explored. Real-time fluorescence quantitative PCR (qRT-PCR) and immunohistochemistry further indicated a higher expression of BVES in the mesenchymal tissues of regenerated antlers than in the antler skin, cartilage, and bone tissues after top pruning treatment (P < 0.05); the brown immunohistochemical reaction products were concentrated in the mesenchymal cell membranes and intercellular matrix of healthy and regenerated antlers. Our results suggested that the repair process of antler damage after top pruning treatment mainly promotes the proliferation and differentiation of antler chondrocytes, osteoblasts, and T lymphocytes through biological signals such as WNT, IHH, and IL2RA to ensure the development of antler tissue again after top pruning. To sum up, our data implied that BVES gene regulated mesenchymal stem cells’ proliferation and differentiation activities in response to ischemic stimuli to promote the healing and rapid growth of wounded antlers.


Article Information

Received 01 March 2023

Revised 25 August 2023

Accepted 05 September 2023

Available online 11 November 2023

(early access)

Published 03 June 2024

Authors’ Contribution

CMH, QHG provided theme, scope, and guidance. HC conceived the study, prepared the figures and tables, and wrote the manuscript. JWL conducted the part of data analysis. CL, HL performed sample collection and total RNA preparation. JYZ and XDJ performed the qRT-PCR validation. All authors read and approved the final manuscript.

Key words

Antler, Top pruning, RNA-seq, Transcriptional differential genes, BVES gene

DOI: https://dx.doi.org/10.17582/journal.pjz/20230301100336

* Corresponding author: [email protected]

0030-9923/2024/0004-1701 $ 9.00/0

Copyright 2024 by the authors. Licensee Zoological Society of Pakistan.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).



Introduction

Tarim red deer is a species native to Central Asia that lives in harsh environmental conditions in this basin, including high temperature, aridity, and poor nutritional conditions. At present, the Tarim red deer are mainly kept in captivity in the second division of the Xinjiang construction corps, with a stock of around 4,000-5,000 head. They are resistant to rough feeding and have a high antler yield. Compared to the Sika deer, their antler is thicker and more branched (The 6-8 branches in Tarim vs. 4 branches in Sika); the average annual fresh antler yield of adult Tarim male deer is up to 12.61 kg (Liu et al., 2018).

The top pruning technique is often used to increase antler production by sawing off 1-2 cm from the top when the antler is 3-5cm high; this procedure stimulates the growth point, which allows the developing antler to grow at an alarming rate to a two-bar or three-branch antler (Zhao, 2002). In addition, this technique not only increases the weight of the antler but also makes the fully grown antler more beautiful, which undoubtedly brings more profit to the breeder and turns deer farming into an important economic industry.

The unique mammalian appendage antler is a potential model for studying tissue regeneration due to its ability to regenerate completely. Not only do deer antlers regenerate the following year after natural growth, ossification, and shedding, but they also continue to repair wounds and regrow after artificial cuts. Interestingly, antler damage that occurs in natural environments from deer fighting or collisions between deer heals faster, and the antler’s weight exceeds that of naturally growing antlers. However, the molecular mechanism through which antlers can repair themselves and rapidly and circumferentially regenerate remains unknown.

Transcriptome sequencing analysis is a method for direct sequencing of RNA molecules present in a given sample and is widely used to screen for differential genes, identify candidate genes, analyze metabolic pathways, and predict the relationship between genes and target organs (Marguerat and Bahler, 2010; Ramayo-Caldas et al., 2012). Its main advantages are higher dynamic range, specificity, and sensitivity (Marioni et al., 2008). This technique has been developed to provide new tools for transcriptome characterization and gene expression profiling. Using whole transcriptome sequencing analysis, Han et al. (2020) constructed the first regulatory network of ceRNAs associated with antler development and showed that coding and non-coding RNAs regulate antler development through interactions and competition. Furthermore, Chen et al. (2022) conducted a comprehensive analysis of the transcriptome and proteome of antler cartilage tissues at different growth stages, revealing that gene 13546 annotated in the Wnt signaling pathway and its encoded protein 13546 may have important biological functions in the rapid growth of antlers. In this study, the transcriptome sequencing technology was used to analyze the differences between regenerated antlers and normally developing healthy antlers after top pruning treatment in Tarim red deer, and the resulting database was compared to screen key regulatory genes in the regeneration process of antlers after top pruning treatment, which lays the foundation for further explaining the molecular mechanism of rapid antler growth and development in damaged deer.

Materials and Methods

Sample collection

Tarim deer antler tissues were collected from the deer farm of the Thirty-first Group, Second Division, Xinjiang Production, and Construction Corps, and three healthy male deer at 10 months of age with the same feeding environment were randomly selected. When the antlers reached 3-5cm, the left antler of each of the three deer was exposed to top pruning. When the antlers reached 53 days of growth, the deer were first anesthetized with xylazine hydrochloride injection (1.0mL/100kg), and the antler roots were tied with straw rope to prevent excessive blood loss. The whole antler was then cut off 2-3 cm above the antler shank using the sawing method, and the hemostatic drug was applied to the section of the stubble deer antler to stop bleeding. After the blood had clotted and the anesthetic wore off, and the deer could stand up, the bailer was opened, and the deer was released. The antler was quickly cleaned of surface dirt and disinfected with 75% ethanol. Then, the top 5 cm of antler tissue was cut on an ultra-clean workbench. According to the tissue dissection method proposed by Li and Suttie (2003), 100 mg/each of antler skin, mesenchyme, cartilage, and bone tissues were isolated and labeled as trauma group (R1, R2, R3), and healthy antler group (N1, N2, N3). The tissue blocks from the two sample groups were selected and placed flat in a freezing mold. OCT embedding agent was then added and placed in liquid nitrogen for rapid cooling. When free of water vapor, samples were taken out and placed on the freezing bath of the slicer and sliced to 6µm; the slices were absorbed on the rough side of the slide and left at room temperature for 2 h and then placed at -80°C for use (Dong et al., 2021). The remaining tissue blocks were placed in liquid nitrogen and used for RNA extraction from each tissue.

Total RNA extraction, transcriptome library construction, and sequencing

Total RNA was extracted from regenerated antler and healthy antler tissues using the Trizol method. RNA concentration and quality were measured by NanoDrop 2000 spectrophotometry. RNA integrity was measured by agarose gel electrophoresis, and after passing the test, the cDNA library and transcriptome sequencing were sent to Novogene Bioinformatics Technology Co. Ltd.

Transcriptome sequencing data processing and analysis

Raw reads of the trauma and health groups were generated on the Illumina Nova Seq 6000 sequencing platform, and high-quality filtered reads were obtained after passing data quality control (Clean Reads). HISAT2 (2.0.5) (Kim et al., 2019) software was used to compare Clean Reads to the reference genome (Cervus elaphus hippelaphus genome assembly, CerEla1.0). Feature counts (1.5.0-p3) tool was used for quantitative analysis (Liao et al., 2014), and gene expression values for RNA-seq were generally calculated using Fragments per Kilobase transcript per Million Mapped Fragments (FPKM) (Zhao et al., 2021).

Transcriptome differentially expressed genes and functional annotation

Using log2 (Fold change) ≥ 1 and Padj ≤ 0.05 as thresholds, the software DESeq2 (1.16.1) was used (Love et al., 2014).. Differentially expressed genes (DEGs) were compared between the trauma and healthy groups to obtain up-regulated and down-regulated genes. Enrichment analysis of DEGs was performed using the R package and combined with GO (Gene Ontology) functional annotation.

 

Table I. Amplification primer information.

Genes

Primer sequences (5′→3′)

Annealing temperature/ °C

Fragment length/bp

BVES

F: TGACGACCGTCTGAGTATTCTCCTG

61

133

R: TCACCTTTGTGCATCTGGGTTGATC

IHH

F: CCAGAACTGCCCACATGAGT

60

210

R: GAGAGACCATGCCCCATCAC

IL2RA

F: GTGCATAAGTGAAGGGGCGAACG

57

132

R: GTGGGCTTCTGGAAATCTGTGGT

LOC122686105

F: GGAGCCCCAGAATAGAAGCAAGATG

61

137

R: CCACGGACCTATGCCCTTTCAAG

GAPDH

F: TGTTTGTGATGGGCGTGAACCA

58

154

R: ATGGCGTGGACAGTGGTCATAA

 

Validation and analysis of real-time fluorescent quantitative PCR (qRT-PCR) for differential genes

Four genes were randomly selected from the differential genes, and specific primers were designed using Primer 6.0. Bovine GAPDH gene sequence in GenBank (accession number NM_001034034.2) was used as the internal reference gene (Table I). Each cDNA sample was diluted 1:4 with ddH2O according to the 2×S6 Universal SYBR qPCR Mix (EnzyArtisan) kit instructions. Reaction system: 5 μL of 2×S6 Universal SYBR qPCR Mix, 0.2 μL of PCR forward primer, 0.2 μL of PCR reverse primer, 1 μL of cDNA, and 3.6 μL of enzyme-free water. PCR amplification parameters were 95°C for 2 min, (95°C for 15s, 61°C for 20s,72°C for 20s) x 34 cycles.

The relative expression was calculated in qRT-PCR using the 2-ΔΔCt method. Statistical analysis was performed using SPSS23 with a t-test for the significance of differences, with P < 0.01 indicating highly significant differences and P < 0.05 indicating significant differences.

Detection of BVES gene expression in different tissues of antler

The BVES expression levels in each tissue of the regenerated and healthy antler by real-time fluorescent quantitative PCR (qRT-PCR).

Immunohistochemical analysis

Operations were performed following Upender et al. (2009) and Sun et al. (2012) methods. Frozen sections were fixed in cold acetone at 4°C for 10 min, incubated at room temperature for 10 min with an appropriate amount of endogenous peroxidase blocker, and then sealed in a wet box with 10% goat serum for 10 min to block non-specific binding. Next, samples were incubated with primary antibody-rabbit anti-BVES polyclonal antibody (diluted 1:50) overnight at 4°C and then with enzyme-labeled goat anti-rabbit IgG polymer for 20 min at room temperature. Finally, DAB staining (Solarbio) and hematoxylin staining were performed, and samples were observed using an inverted microscope.

Results

Sequencing data analysis

Figure 1 shows that RNA bands were clear and bright with good integrity. The RNA concentration ranged between 1069ng/μl-1350ng/μl and OD260/OD280 between 1.8-2.0, all meeting the transcriptome sequencing requirements.

 

High-throughput sequencing technology was used to sequence RNA from trauma and health group samples. The raw sequencing data were quality-controlled to obtain Clean Reads by excluding data containing splice data, data containing unidentifiable bases, and low-quality data from Raw Reads. The readsQ30 of the six samples sequenced in the two groups was greater than 93%, and the efficiency of comparison between the valid data of each sample and the reference genome ranged from 79.13% to 80.22% (Table II). Comprehensive results showed that the quality of library construction and sequencing was good and met the requirements of subsequent analysis.

 

Table II. Results of data filtering and comparison statistics.

Sample

Raw reads

Clean reads

Percentage (%)

Q30

Total map(%)

R1

45 702 356

44 569 852

97.52

94.06

79.42

N1

43 451 750

42 298 546

97.35

93.98

79.56

R2

42 550 680

40 937 202

96.21

94.01

79.31

N2

45 801 344

44 146 098

96.39

93.90

79.13

R3

44 904 562

43 564 691

97.02

94.10

79.69

N3

42 106 854

41 597 605

98.79

93.75

80.22

 

R, trauma group; N, healthy group; Q30, percentage of bases with Phred values greater than 30 out of the total bases; Total map, number of reads compared to the genome and their percentage.

 

DEGs analysis

The transcriptomic data from the trauma and healthy groups were compared, and 56 DEGs were screened, among which 37 genes were significantly up-regulated and 19 genes were significantly down-regulated in the trauma tissue. The number of up-regulated genes was higher in the trauma group than in the healthy group. The most significant changes were seen for the BVES gene (up-regulated gene); thus, this gene was further explored.

GO functional enrichment analysis of DEGs

Fifty-six DEGs were annotated to the GO database. At p<0.05, 31 significantly enriched secondary entries were found (Fig. 2). The GO annotation results involved biological process (BP) twenty-five secondary items, including skeletal system development (GO: 0001501), cartilage development (GO: 0051216), three secondary entries for cellular component (CC) including extracellular region (GO:0005576), molecular function (MF) 3 secondary entries including protein binding (GO:0005515). BVES genes were significantly enriched in GO entries for epithelial cell-cell adhesion, regulation of cellular processes, developmental tissue processes, and response to ischemic stimuli.

Reliability analysis of transcriptome sequencing results

To verify the reliability of the RNA sequencing results, four genes, including IL2RA, BVES, IHH, and LOC122686105, were randomly selected from the DEGs for qPCR amplification and compared with the sequencing results (Fig. 3). The results showed that the trends of the two methods were consistent, indicating that the transcriptome sequencing results were reliable.

 

 

 

 

Expression of the BVES gene in various tissues of healthy antler and regenerated antler after a top pruning

The expression of the BVES gene was significantly higher in regenerated antler tissues after pruning than in naturally grown healthy antlers (P < 0.05). The gene was expressed in antler skin, mesenchymal, cartilage, and bone tissues. When comparing the expression of each tissue, the BVES gene was not significantly different in healthy and regenerated antlers (P > 0.05). However, the expression of the BVES gene mRNA was significantly up-regulated (P < 0.05) in the regenerated antler mesenchymal tissue after the top pruning treatment (Fig. 4).

The presence of a large number of immunohistochemical brown reaction products in both the cell membrane and intercellular stroma of regenerated antler mesenchymal tissue was observed under the microscope (Fig. 5A, B), whereas the positive expression in healthy antler mesenchymal tissue was weak and low (Fig. 5C, D). No immunoreactivity was observed in antler skin, cartilage, or bone tissues.

Discussion

The transcriptome sequencing results showed a significant increase in up-regulated genes in regenerated antlers after top pruning treatment. Top differential genes, BVES, WNT5B, IHH, AXIN1, and IL2RA, were mainly enriched in biological processes such as bone development and regulation of cellular processes, indicating that top pruning treatment is a stimulus that can activate a large number of genes and regulate cellular physiological processes. Significant up-regulation of connective tissue development and cartilage development suggests that the tendency of connective tissue, cartilage, and bone development in antlers enhanced under traumatic conditions may be one of the reasons for the increased yield of forked antler after top pruning injury in actual production. Guo (2021) reported enriched bone morphogenesis at the initial stage of antler regeneration, suggesting that bone development accompanies both the initial as well as rapid developmental stages of antler regeneration. At the same time, differential genes were found to be predominantly classified as protein binding within the various subcategories of molecular function (MF), suggesting that antler growth and development are closely related to ligand/receptor interactions, including hormone/receptor interactions and signaling molecule/receptor interactions. This is consistent with results of Saito et al. (2002), who first reported homing abilities of MSCs and that chemically injured tissues can attract MSCs, which can be homing to damaged tissues where they exert their therapeutic effects. Thus, we speculated that there might be a large number of influencing factors driving the migration of MSCs to damaged sites during wound healing. When MSCs are mobilized in the antler tip, they can repair the damage and simultaneously continue to differentiate and proliferate, which is the basis for the rapid growth of regenerated antlers after trauma.

Among all DEGs that were different in regenerated antler tissue compared to healthy groups, the most significant was seen for the BVES gene expression, which was significantly up-regulated after top pruning. BVES was discovered by the gene cloning study of heart tissue in 1999 and was later named the vascular epicardial active substance (Reese and Bader, 1999; Reese et al., 1999). Previous studies have revealed that BVES proteins accumulate at the site of cell-to-cell contact (Hager and Bader, 2009), can control the morphology and movement of normal cells, and are a novel cell adhesion molecule (Wada et al., 2001). Osler et al. (2005) found that BVES not only participates in establishing and maintaining epithelial cell integrity by regulating the formation of tight junctions between cells but also promotes the differentiation of epithelial cells (Russ et al., 2011). In addition, BVES can attenuate myocardial ischemic and oxidative damage and have a positive role in myocardial ischemic tolerance (Alcalay et al., 2013). In the present study, BVES genes were significantly enriched in biological processes such as epithelial cell-cell adhesion, regulation of cellular processes, tissue development processes, and response to ischemic stimuli, suggesting that BVES genes may promote antler growth and development by regulating antler cell physiological activities and participate in the healing process of wound tissue repair, which is consistent with most of the previous findings.

BVES gene expression has been reported to be low in cancers, including liver tumors (Han et al., 2015) and colon cancer (Williams et al., 2011), suggesting that BVES has a cancer-suppressive effect. Williams et al. (2011) found that overexpression of BVES in uveal melanoma cells can impair the proliferation of tumor cells, while its down-regulation promotes the invasion and metastasis of liver cancer cells (Han et al., 2015).

The proto-oncogene c-Myc is a transcription factor whose role is to regulate cell growth, differentiation, metabolism, and death; however, it is frequently dysregulated and overexpressed in many human cancers (Koo et al., 2000; Nair et al., 2003; Sorolla et al., 2020; Toon et al., 2014), being an important cause of cancer and tumourigenesis in humans. Recent studies have found that BVES is an important regulator of the inflammatory carcinogenesis program; it can promote c-Myc degradation through interaction with the PR61α-PP2A protein complex, decreasing cellular c-Myc protein levels, thus reducing the probability of carcinogenesis (Parang et al., 2017). Accordingly, BVES can act as an important suppressor of inflammatory tumorigenesis by attenuating excess c-Myc levels.

One of the typical characteristics of deer antler, which is widely known for its traditional medicinal value, is its fast growth rate. Although deer antler cells proliferate faster than cancer cells, they do not proliferate indefinitely like cancer cells (Han et al., 2021). Therefore, antler growth is a more complex regulatory process regulated by various signaling pathways and growth factors (Lord et al., 2007). Recent studies on rapid antler growth have focused on genetic aspects. For example, the proto-oncogene c-Myc is expressed in antler tip tissues at 30, 60, and 90d of development, but the relative expression levels are weaker compared to other growth factors (Francis and Suttie, 1998). Another study explored the expression of c-Myc genes in different antler tissues of Tarim red deer at different growth stages (Han et al., 2012); the c-Myc gene was found to be involved in the proliferation and differentiation of antler skin during the rapid growth phase and was highly expressed in cartilage tissue during the late growth phase to regulate antler cartilage development and bone formation, while c-Myc gene expression was lower in the mesenchymal layer at different times. In this study, BVES genes were expressed in all tissues of 53d healthy antler and regenerated antler; yet, their expression was significantly higher in regenerated antler tissues, suggesting that BVES genes may inhibit the overexpression of proto-oncogenes such as c-Myc in cancer-like growing antlers so that fast-growing antlers do not become cancerous. In addition, after top pruning, antlers that experienced trauma may be more susceptible to disease during the repair and healing process. The BVES gene is up-regulated when there is a tendency of pathological changes to prevent pathological changes in response to dangerous signals occurring in antlers. Surprisingly, the relative expression of BVES genes was significantly higher in regenerated antler mesenchymal tissues than in antler skin, cartilage, and bone tissues after the same period of pruning, suggesting that BVES may regulate the proliferation and differentiation activities of antler stem cells, but the mechanism of regulation is not yet clear. Therefore, understanding the biological roles of BVES genes in antler stem cells is of great significance for antler growth development and regeneration.

Conclusion

Top pruning treatment of the antler can promote the proliferation and differentiation of antler chondrocytes, osteoblasts, and T lymphocytes through upregulation of biological signals such as WNT, IHH, and IL2RA, thus ensuring the re-development of antler tissue after top pruning treatment. Also, a series of screenings and experiments have confirmed that the BVES gene may regulate the proliferation and differentiation of antler mesenchymal stem cells after pruning by responding to ischemic stimuli, promoting antler growth and development, and increasing antler production.

Acknowledgments

The authors appreciated the Tarim Red Deer Breeding Farm of the Second Agricultural Division of Xinjiang Production and Construction Corps for providing the antler samples.

Funding

This work was supported by the Project National Natural Science Foundation of China (NO. 31860629) and Tarim University Graduate Scientific Research and Innovation Project Funding (NO.TDGRI202236).

IRB approval

All animal handling practices are approves by the University of Tarim Animal and Use Committee (NO.DT U20221210).

Ethical statement

This study was conducted in accordance with the specifications of the Ethics Committee of the Tarim University.

Statement of conflict of interest

The authors have declared no conflict of interest.

References

Alcalay, Y., Hochhauser, E., Kliminski, V., Dick, J., Zahalka, M.A. and Parnes, D., Schlesinger, H., Abassi, Z., Shainberg, A., Schindler, R.F., Brand, T. and Kessler-Icekson, G., 2013. Popeye domain containing 1 (Popdc1/Bves) is a caveolae-associated protein involved in ischemia tolerance. PLoS One, 8: e71100. https://doi.org/10.1371/journal.pone.0071100

Chen, Y., Zhang, Z., Jin, W., Li, Z., Bao, C. and He, C., Guo, Y. and Li ,C., 2022. Integrative analyses of antler cartilage transcriptome and proteome of Gansu red deer (Cervus elaphus kansuensis) at different growth stages. Animals, 12. https://doi.org/10.3390/ani12070934

Dong, Z., Li, C. and Coates, D., 2021. PTN-PTPRZ signalling is involved in deer antler stem cell regulation during tissue regeneration. J. cell. Physiol., 236: 3752-3769. https://doi.org/10.1002/jcp.30115

Francis, S.M. and Suttie, J.M., 1998. Detection of growth factors and proto-oncogene mRNA in the growing tip of red deer (Cervus elaphus) antler using reverse-transcriptase polymerase chain reaction (RT-PCR). J. exp. Zool., 281: 36-42. https://doi.org/10.1002/(SICI)1097-010X(19980501)281:1<36::AID-JEZ6>3.0.CO;2-D

Guo, Q.Q., 2021. Research on molecular mechanism of wound healing during the initial stage of antler regeneration. Chin. Acad. Agric. Sci., Classification Code:S825 https://doi.org/10.27630/d.cnki.gznky.2021.000908

Hager, H.A. and Bader, D.M., 2009. Bves: Ten years after. Histol. Histopathol., 24: 777-787.

Han, C.M., Gao, Q.H., Li, S.J., Tang, J.W., Zang, X.Y. and L.J., 2012. Expression of proto-oncogene c-myc in Tarim horse antler at different growth stages. China Vet. J., 32: 1536-1541.

Han, P., Fu, Y., Liu, J., Wang, Y., He, J., Gong, J., Li, M., Tan, Q., Li, D., Luo, Y., Han, J., Liu, J., Tu, W., Wang, Y., Tian, D. and Yan, W., 2015. Netrin-1 promotes cell migration and invasion by down-regulation of BVES expression in human hepatocellular carcinoma. Am. J. Cancer Res., 5: 1396-1409

Han, R., Han, L., Wang, S. and Li, H., 2020. Whole transcriptome analysis of mesenchyme tissue in sika deer antler revealed the CeRNAs regulatory network associated with antler development. Front. Genet., 10. https://doi.org/10.3389/fgene.2019.01403

Han, R., Han, L., Xia, Y., Guo, M. and Li, H., 2021. LncRNA sequencing of antler mesenchymal tissue revealed that the regulatory network of antler cell proliferation and differentiation. Anim. Biotechnol., pp. 1-10. https://doi.org/10.1080/10495398.2021.1924762

Kim, D., Paggi, J. M., Park, C., Bennett, C. and Salzberg, S.L., 2019. Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype. Nat. Biotechnol., 37: 907-915. https://doi.org/10.1038/s41587-019-0201-4

Koo, S.H., Kwon, K.C., Shin, S.Y., Jeon, Y.M., Park, J.W. and Kim, S.H., and Noh, S.M., 2000. Genetic alterations of gastric cancer: Comparative genomic hybridization and fluorescence in situ hybridization studies. Cancer Genet. Cytogenet., 117: 97-103. https://doi.org/10.1016/S0165-4608(99)00152-1

Li, C. and Suttie, J.M., 2003. Tissue collection methods for antler research. Eur. J. Morphol., 41: 23-30. https://doi.org/10.1076/ejom.41.1.23.28106

Liao, Y., Smyth, G.K. and Shi, W., 2014. Feature counts: An efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics, 30: 923-930. https://doi.org/10.1093/bioinformatics/btt656

Liu, L., Wang, M.L., Li, J.X. and Q, W.X., 2018. Effects of dietary protein and phosphorus levels on antler production of Talim deer. Livest. Vet. Med., 50: 139-141.

Lord, E.A., Martin, S.K., Gray, J.P., Li, C. and Clark, D.E., 2007. Cell cycle genes PEDF and CDKN1C in growing deer antlers. Anat Rec. (Hoboken). 290: 994-1004. https://doi.org/10.1002/ar.20562

Love, M.I., Huber, W. and Anders, S., 2014. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol., 15: https://doi.org/10.1186/s13059-014-0550-8

Marguerat, S. and Bahler, J., 2010. RNA-seq: From technology to biology. Cell. Mol. Life Sci., 67: 569-579. https://doi.org/10.1007/s00018-009-0180-6

Marioni, J.C., Mason, C.E., Mane, S.M., Stephens, M. and Gilad, Y., 2008. RNA-seq: An assessment of technical reproducibility and comparison with gene expression arrays. Genome Res., 18: 1509-1517. https://doi.org/10.1101/gr.079558.108

Nair, S.K. and Burley, S.K., 2003. X-ray structures of Myc-Max and Mad-Max recognizing DNA. Molecular bases of regulation by proto-oncogenic transcription factors. Cell, 112: 193-205. https://doi.org/10.1016/S0092-8674(02)01284-9

Osler, M.E., Chang, M.S. and Bader, D.M., 2005. Bves modulates epithelial integrity through an interaction at the tight junction. J. Cell Sci., 118: 4667-4678. https://doi.org/10.1242/jcs.02588

Parang, B., Kaz, A.M., Barrett, C.W., Short, S.P., Ning, W. and Keating, C.E., Mittal, M.K., Naik, R.D., Washington, M.K., Revetta, F.L., Smith, J.J., Chen, X., Wilson, K.T., Brand, T., Bader, D.M., Tansey, W.P., Chen, R., Brentnall, T.A., Grady, W.M. and Williams, C.S., 2017. BVES regulates c-Myc stability via PP2A and suppresses colitis-induced tumourigenesis. Gut, 66: 852-862. https://doi.org/10.1136/gutjnl-2015-310255

Ramayo-Caldas, Y., Mach, N., Esteve-Codina, A., Corominas, J., Castello, A., Ballester, M., Estellé, J., Ibáñez-Escriche, N., Fernández, A.I., Pérez-Enciso, M. and Folch, J.M., 2012. Liver transcriptome profile in pigs with extreme phenotypes of intramuscular fatty acid composition. BMC Genom., 13: 547. https://doi.org/10.1186/1471-2164-13-547

Reese, D.E. and Bader, D.M., 1999. Cloning and expression of hbves, a novel and highly conserved mRNA expressed in the developing and adult heart and skeletal muscle in the human. Mammal. Genome, 10: 913-915. https://doi.org/10.1007/s003359901113

Reese, D.E., Zavaljevski, M., Streiff, N.L. and Bader, D., 1999. Bves: A novel gene expressed during coronary blood vessel development. Dev. Biol., 209: 159-171. https://doi.org/10.1006/dbio.1999.9246

Russ, P.K., Pino, C.J., Williams, C.S., Bader, D.M., Haselton, F.R. and Chang, M.S., 2011. Bves modulates tight junction associated signaling. PLoS One, 6: e14563. https://doi.org/10.1371/journal.pone.0014563

Saito, T., Kuang, J.Q., Bittira, B., Al-Khaldi, A. and Chiu, R.C., 2002. Xenotransplant cardiac chimera: Immune tolerance of adult stem cells. Annls Thorac. Surg., 74: 19-24. https://doi.org/10.1016/S0003-4975(02)03591-9

Sorolla, A., Wang, E., Golden, E., Duffy, C., Henriques, S.T. and Redfern, A.D. and Blancafort, P., 2020. Precision medicine by designer interference peptides: Applications in oncology and molecular therapeutics. Oncogene, 39: 1167-1184. https://doi.org/10.1038/s41388-019-1056-3

Sun, H., Yang, F., Chu, W., Zhao, H., McMahon, C. and Li, C., 2012. Lentiviral-mediated RNAi knockdown of Cbfa1 gene inhibits endochondral ossification of antler stem cells in micromass culture. PLoS One, 7: e47367. https://doi.org/10.1371/journal.pone.0047367

Toon, C.W., Chou, A., Clarkson, A., DeSilva, K., Houang, M. and Chan, J.C., Sioson, L.L., Jankova, L., and Gill, A.J., 2014. Immunohistochemistry for myc predicts survival in colorectal cancer. PLoS One, 9: e87456. https://doi.org/10.1371/journal.pone.0087456

Upender, S., Mohan, H., Handa, U. and Attri, A.K., 2009. Intraoperative evaluation of sentinel lymph nodes in breast carcinoma by imprint cytology, frozen section and rapid immunohistochemistry. Diagn. Cytopathol., 37: 871-875. https://doi.org/10.1002/dc.21120

Wada, A.M., Reese, D.E. and Bader, D.M., 2001. Bves: Prototype of a new class of cell adhesion molecules expressed during coronary artery development. Development, 128: 2085-2093. https://doi.org/10.1242/dev.128.11.2085

Williams, C.S., Zhang, B., Smith, J.J., Jayagopal, A., Barrett, C.W. and Pino, C., Russ, P., Presley, S. H., Peng, D., Rosenblatt, D.O., Haselton, F.R., Yang, J.L., Washington, M.K., Chen, X., Eschrich, S., Yeatman, T.J., El-Rifai, W., Beauchamp, R.D. and Chang, M.S., 2011. BVES regulates EMT in human corneal and colon cancer cells and is silenced via promoter methylation in human colorectal carcinoma. J. clin. Invest., 121: 4056-4069. https://doi.org/10.1172/JCI44228

Zhao, S.Z., 2002. Basic technology of flat stubble dun for antler. Rural Farm. Technol., 12: 20.

Zhao, Y., Li, M., Konaté, M.M., Chen, L., Das, B. and Karlovich, C., Williams, P.M., Evrard, Y.A., Doroshow, J.H. and McShane, L.M., 2021. Tpm, Fpkm, or normalized counts? A comparative study of quantification measures for the analysis of RNA-seq data from the NCI Patient-Derived models repository. J. Transl. Med., 19. https://doi.org/10.1186/s12967-021-02936-w