Identification of Nine Gastropod Species with Three New Records using Cytochrome Oxidase Sub-Unit 1 Marker

Qurat-ul-Ain Ijaz1, Amna Sulaman1, Dost Muhammad Baloch2,

Muhammad Shafi2, Faiz Muhammad1* and Shahnaz Rashid1

1Center of Excellence in Marine Biology, University of Karachi, Karachi-75270, Pakistan

2Lasbella University of Agriculture, Water and Marine Sciences, Lasbella, Uthal

ABSTRACT

Gastropods are ecologically significant and can be found in a wide range of habitats. Their taxonomy is complicated by their perplexing morphological characteristics. Therefore, a molecular based identification approach was used to confirm the variety of gastropod species commonly found on the coast during low tide at rocky shores. In the present investigation, nine species of gastropods were identified using the foresaid modern technique such as (Thalessa savignyi, Purpura persica, Turbo sparverius, Lunella coronata, Cellana karachiensis, Nerita albicilla, Nerita tristis, Ischnochiton australis, Astralium tentorriformis). T our knowledge among them three are news records (A. tentoriiformes, Ischnochiton australis and, Nerita tristis). The highest evolutionary divergence within the family of Nacellidae (0.917) followed by Turbinidae (0.169) and Neritidae (0.100) was noted. The results of this study will be helpful to taxonomists because meager attention was given to molecular- based identification from this region.


Article Information

Received 01 July 2022

Revised 15 August 2022

Accepted 14 September 2022

Available online 27 April 2023

(early access)

Published 15 June 2024

Authors’ Contribution

QI and AS collected samples and conducted experiments, participated in data analysis. MS and FM designed experiment, generated funds and wrote article.

Key words

DNA Barcode, Nine species, Gastropods, Rocky shore, Pakistan

DOI: https://dx.doi.org/10.17582/journal.pjz/20220701070727

* Corresponding author: [email protected]

0030-9923/2024/0004-1989 $ 9.00/0

Copyright 2024 by the authors. Licensee Zoological Society of Pakistan.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).



The gastropods, a dominant class of Mollusca are ecologically important animals, dwell in variety of environments and have perplexing morphological characteristics (Loker, 2010; Ran et al., 2020). Marine gastropods are abundant in intertidal zone and are exposed during low tide. These can be grazers, scavengers, and predators, these have variety of colour patterns, and Euryhaline in marine environment (Mienis, 1973; Vermeij, 1984; Krijnen et al., 1996; Haynes, 2005; Tan and Clements, 2008).

The complex morphological characteristics confuse the identification of species, therefore, it becomes intuitive to identify the species accurately to understand the diversity, determine the reference basis of fishery resources and assess potential natural resources of the region (Fontanilla et al., 2014; Ran et al., 2020) using modern techniques like the DNA barcode-based identifications are appreciated worldwide especially for the animals of similar morphological characteristics, juveniles, or the animals that undergo different life stages (Hausmann et al., 2009). 

The mitochondrial DNA (mtDNA) are potential markers because of maternal inheritance, fast evolutionary rate. Among mtDNA markers the Cytochrome oxidase subunit 1 has been extensively used to identify the species, construct a phylogenetic relationship, and monitor the population for conservation (Liu and Cordes, 2004). 

In Pakistan, with exception of a few studies, the gastropod species are traditionally identified, the molecular-based taxonomic investigations on the subject species are limited to the work of (Zafar et al., 2016; Humayun et al., 2019; George et al., 2021); whereas the gastropods have significant variations in morphological features at different growth stages which creates confrontations to morphologically based identifications (Wilke and Falinowski, 2001). Therefore, present study was designed to identify the molluscan species using molecular based approaches and with support of morphological characteristics.

Materials and methods

Bulleji rocky shore is popular in Karachi division of Sindh. It supports variety of animals including gastropod species because of boulders, flat rocks and tide pools (Afsar et al., 2012, 2013; Rahman and Barkati, 2010; Karim et al., 2021). Target samples were handpicked and brought to the laboratory. The morphological based identifications were completed using the authentic local and international keys (Tirmizi and Zehra, 1982; Bosch et al., 1995).

Genomic DNA (gDNA) was isolated from muscle tissue using the phenol-chloroform method (Sambrook et al., 1989). The cytochrome oxidase subunit 1 (COX1) gene was amplified by polymerase chain reaction (PCR) using universal primers LCO1490:5’~ and HCOR2:5’,~ their sequences were GGTCAACAATCATAAAGATATTGG~ 3’ and TAAACTTCAGGGTGACCAAAAAATCA~ 3’ (Folmer et al., 1994). The PCR was performed using 100mg DNA template, 2.5 μL dNTP (2.5mM each), 2.5 μL10 X buffer, 2 μL Mgcl2, (20mM), 1 μM primers (10 μM each) and 0.25 μLOf Taq polymerase (5 μU Μl*1). PCR conditions were as: denaturation at 94 °C for 5 min; 35 cycles, each of 94 °C for 30 s, annealing at 50°C for 30 s, and a final extension for 7 min at 72 °C. Successful amplification was verified by visualizing PCR product on 1 % agarose gel with ethidium bromide. 

PCR products were subsequently sequenced with the Sanger sequencing method. Necessary insertion and deletion were done using software like Molecular evolutionary genetic analysis (MEGA) and BIOEDIT (Tamura et al., 2013; Hall, 1999). The maximum likelihood option was used to construct the phylogenetic relationship among species using MEGA 6 (Tamura et al., 2013). The average evolutionary distance analysis was also detected using MEGA 6.

Results and discussion

The samples were carefully identified and found to be nine species belonging to six families. The brief morphological characters are described in (Supplementary Table I), whereas, the photo morphs of these species are shown in Supplementary Figure 1. Each sequence of 640 base pair (bp) fragments of COX1 was analyzed using NCBI nucleotide blast parameters which confirmed the identification of nine species of gastropods such as Thallesa savignyi, Purpura persica, Turbo sparverius, Lunella coronata, Cellana karachiensis, Nerita albicilla, Nerita tristis, Ischnochiton australis, Astralium tentorriformis, among them three are new records (A. tentoriiformes, Ischnochiton australis and, Nerita tristis) for this region. The sequences of the present study were submitted to National Center for Biotechnology Information (NCBI) under accession numbers (OL373543, OL373542, OL373868, OL372634, OL373916, OL362012, OL362211, OL373913, OL355305), respectively. 

  1. Tylothais savignyi (Deshayes 1844): The blast result revealed 96.73% resemblance with Thallesa savignyi (HE584390) (Supplementary Fig. 1A). This species is commonly found on the rocky shores of Pakistani coastal waters and was reported by Tirmizi and Zehra (1982), Nasreen et al. (2000), Afsar et al. (2012), Ghani et al. (2018), Aslam et al. (2020) (Supplementary Fig. 1A). Nasreen et al. (2000) reported this species as Thais hippocastanum.

 

  1. Purpura persica (Linnaeus, 1758): Nucleotide blast result showed 94.3% similarity with the sequence of P. persica submitted under accession number HE584363 (Supplementary Fig. 1B). In Pakistani coastal waters, it was reported as Thais rudolphi by Khan and Dastgir (1971) and Afsar et al (2012). The T. rudolphi is an unacceptable name for this species (https://www.marinespecies.org/aphia.php?p=taxdetailsandid=208648)
  2. Turbo sparverius (Gmelin 1791): It showed 89.47% identity with the sequence (HE584363) of similar species. Tirmizi and Siddiqui (1984) reported this species as Turbo (Marmarostomachrysostomus (Supplementary Fig. 1C).
  3. Lunella coronata (Gmelin 1791): It showed 94% affinity with the similar (LC154936) sequence (Supplementary Fig. 1D). Khan and Dastagir (1971) reported it as Turbo coronatus while Tirmizi and Zehra (1982) also elaborated this species. Furthermore, Afsar et al. (2012) also collected and described this species as L. coronatus. Its present accepted name is L. coronata.
  4. Cellana karachiensis (Winckworth 1930): Its blast results revealed 97.39% homology with the sequence submitted under accession number LC060526 (Supplementary Fig. 1E). Ahmed and Hameed (1999) reported this species from Pakistani marine waters as Patella granularis. Earlier Zafar et al. (2016) described three morphs of this species from Pakistan and the probability to be the same species. The three sequences were submitted to NCBI under accession numbers (OM535909, OM535908 and OM535907) however, it is unclear which sequence belongs to which morph. Poriya et al. (2016) also described three morphs named X, Y and Z, different color pattern; but using COX1 analysis has shown that all three forms belong to one species C. karachinesis. The changes in the color pattern were supposed to be due to environmental factors (Samantaray, 1979; Underwood and Creese, 1976).
  5. Nerita albicilla (Linnaeus 1758): It has a 92.63% resemblance with the sequence submitted under accession of EU253386 (Supplementary Fig. 1F). It was earlier identified using 16S rDNA from Pakistan (Humayun et al, 2019), however, the reference sample is not available for comparison. Khan and Dastaghir (1971) also reported it.
  6. Nerita tristis (d’orbigny 1842): It showed 89.77% affinity with the sequence available under accession number EU732323 (Supplementary Fig. 1G). At present its accepted scientific name in world register of marine species is Puperita pupa (Linnaeus, 1767). This is a new record from Pakistani coastal waters.
  7. Ischnochiton australis (G.B. Soweby II, 1840): Its similarity with another sequence under accession number EF650658 is 99.55%, whereas to our knowledge it has no previous record from the Pakistan coast; therefore it is being considered the first record from the area (Supplementary Fig. 1H).
  8. Astralium tentorriforme (Jonas, 1845): It showed 99.38% similarity with other sequences of Astralium tentorriforme accession number AM403843. This is a new record for this region (Supplementary Fig. 1I).

The average evolutionary distance within the family members of Nacellidae is 0.917 followed by Tubinidae (0.169), Neritidae (0.100), Muricidae (0.034), Melongenidae (0.025) and Ischnochitonidae (0.003). A very high genetic divergence was shown by two sequences of Cellana karachiensis (OM535907 and OM535908), the genetic divergence between the sequences of Cellana karachiensis (OM535909 and OL373916) the later sequence is part of this investigation.

The phylogenetic tree was constructed using 43 sequences (COX1), sequences other than this study were downloaded from NCBI, and the accession number of each is shown in Figure 1. The species of the family Neritidae were showing two separate clades and the N. albicilla from Pakistani coastal waters clustered separately with similar species from other countries and closely related to the Omanian species (Fig. 1). The N. tristis showed distinct clustering within the clade of the Neritidae family. C.karachienesis showed a close relationship with one of the morphs early reported from the area (Zafar et al., 2016), however, two of the morph in the same study separately clustered, and we are unable to describe that which sequence among (OM535909, OM535908, OM535907) these three belongs to morpho1, 2 or 3. Porya et al. (2016) also elaborated 3 morphs as a single species C. karachiensis. T. sparverius clustered with its similar species and showed close relation with the species from Taiwan. A. tentoriiformis showed more closeness with Australian found species, whereas L. coronata showed an affinity with Iranian and United Kingdom species. P. persica showed closeness with a species from China accession number MN389123. T. savignyi from Pakistan depicted differentiation among the same species. Australis sp. from Pakistan showed an affinity with the species from Australia.

The molecular-based studies from Pakistani waters on the subject are very few and the available data is only restricted to the work of George et al. (2021), Ali et al. (2018) and Zafar et al. (2016). The present study re-confirms the identification of nine species, among them, three species A. tentorriformes, I. australis and, N. tristis are new records from the region.

Conclusions

This preliminary study would be helpful for Taxonomists to design a future plan for investigation of Mollusca found in Pakistani coastal waters.

Acknowledgements

Departmental resources were utilized for this research and sequencing cost was supported by PMDC Malir project. Professor Dr. Qudusi B Kazmi is highly acknowledged for her guidance.

Ethics statement

All the methods were carried in line with international norms for invertebrate.

Supplementary material

There is supplementary material associated with this article. Access the material online at: https://dx.doi.org/10.17582/journal.pjz/20220701070727

Statement of conflict of interest

The authors have declared no conflict of interest.

References

Afsar, N., Siddiqui, G., and Ayub, Z., 2013. Pakistan J. Zool., 45: 459-467.

Afsar, N., Siddiqui, G., and Ayub, Z., 2012. Pakistan J. Zool. 44: 267-275.

Ali, S.A., Humayun, F., Munir, I., Ahmad, S., Ayub, Z., Fatima, H., Zehra, L. and Haider, M.S., 2018. J. Fd. Sci., 10. https://doi.org/10.2174/1874256401810010033

Aslam, S., Dekker, H., Siddiqui, G., Mustaquim, J., and Kazmi, S.J.H., 2020. Reg. Stud. Mar. Sci., 39: 101415. https://doi.org/10.1016/j.rsma.2020.101415

Bosch, D.T., Dance, P., Moolenbeek, R.G., and Oliver, P.G., 1995. Seashells of Eastern Arabia. Motivate Publishing, Dubai, United Arab Emirates, pp. 296.

Folmer, O., Hoeh, W.R., Black, M.B., and Vrijenhoek, R.C., 1994. Mol. Mar. Biol. Biotechnol.3: 294-299.

Fontanilla, I.K.C., Sta. Maria, I.M.P., Garcia, J.R.M., Ghate, H., Naggs, F..’// and Wade, C.M., 2014. PLoS One9: e105151. https://doi.org/10.1371/journal.pone.0105151

George, N., Siddiqui, G., Muhammad, F., George, Z., and Lucena, R. 2021. J. Anim. Pl. Sci.31: 1530-1536.

Ghani, A., Afsar, N., and Moazzam, M., 2018. Pak. J. Mar. Sci., 27: 61-71. http://hdl.handle.net/1834/40825

Hall, T.A., 1999. Nucl. Acids Symp. Ser. (London): Inf. Retrieval Ltd., c1979-c2000. 41: 95-98.

Hausmann, M., Schoofs, D., Rosenthal, H.E. and Jordan, K., 2009. Psychoneuroendocrinology, 34: 389-401. https://doi.org/10.1016/j.psyneuen.2008.09.019

Haynes, A., 2005. Mollus Res., 25: 75-84. https://www.marinespecies.org/aphia.php?p=taxdetails&andid=208648

Humayun, F., Ayub, Z., Haider, M.S. and Ali, S.A., 2019. Biology, 65: 1-10. https://www.tehqeeqat.org/downloadpdf/8310

Karim, K.F.M., Ijaz, Q., Sulaman, A., Aslam, M., Tariq, S., and Shafi, M., 2021. Int. J. Biol. Biotech, 18: 753-757.

Khan, M.D. and Dastagir, S.G., 1971. Rec. Zool. Surv. Pak., 1: 17- 129.

Krijnen, C., Celen, F., Delsaerdt, A., Duchamps, R., Notelteirs, L., Revis, N., Severijins, N., and Verhaeghe, M., 1996. Gloria Maris, 34: 65-84.

Liu, Z.J., and Cordes, J.F., 2004. Aquaculture, 238: 1-37. https://doi.org/10.1016/j.aquaculture.2004.05.027

Loker, E.S., 2010. Adv Exp Med Biol., 708: 17-43. https://doi.org/10.1007/978-1-4419-8059-5_2

Mienis, H.K., 1973. Argamon, 4: 21-22. https://doi.org/10.1177/216507997302100306

Nasreen, H., Ahmed, M., and Hameed, S., 2000. Pakistan J. Zool. 32: 343-350.

Poriya, P., Vakani, B., and Kundu, R., 2016. First record and colour banding pattern of Cellana karachiensis (Winckworth, 1930) (Mollusca: Patellogastropoda: Nacellidae) from Gujarat coast, India. http://nopr.niscpr.res.in/handle/123456789/34888

Rahman, S., and Barkati, S., 2010. Int. J. Biol. Biotechnol. (Pakistan), http://www.ijbbku.com/assets/custom/journals/2010/4/

Ran, K., Li, Q., Qi, L., Li, W., and Kong, L., 2020. Fish. Res., 225: 105504. https://doi.org/10.1016/j.fishres.2020.105504

Samantaray, K.C., 1979. Edible limpet cellana radita (Born) (Mollusca: Patellidae) at eraval coast of saurashtra. Doctoral dissertation, Saurashtra University, Rajkot, India.

Sambrook, J., Fritsch, E.F., and Maniatis, T., 1989. Molecular cloning: A laboratory manual. Cold Spring Harbor Laboratory.

Tamura, K., Stecher, G., Peterson, D., Filipski, A., and Kumar, S., 2013. Mol. Biol. Evol., 30: 2725-2729. https://doi.org/10.1093/molbev/mst197

Tan, S.K., and Clements, R., 2008. Zool. Stud., 47: 481-494. https://scholarbank.nus.edu.sg/handle/10635/66269

Tirmizi, N.M., and Siddiqui, F.A., 1984. The marine fauna of Pakistan: Mollusca, Gastropoda. University Grants Commission. Vol. 5.

Tirmizi, N.M., and Zehra, I., 1982. Illustrated key to families of Pakistani marine molluscs.

Underwood, A.J., and Creese, R.G., 1976. J. exp. Mar. Biol. Ecol.23: 211-228. https://doi.org/10.1016/0022-0981(76)90021-6

Vermeij, G.J., 1984. Proc. biol. Soc. Wash., 97: 688-692. https://doi.org/10.1017/S0308229600014549

Wilke, T., and Falniowski, A., 2001. J. Zool. Syst. Evol. Res., 39: 227-234. https://doi.org/10.1046/j.1439-0469.2001.00171.x

Zafar, F.H.S., Ayub, Z., Begum, S., Siddiqui, G., and Roberts, D., 2016. Mitochond. DNA A27: 2868-2872. https://doi.org/10.3109/19401736.2015.1053133