2,4 -Dinitrophenol Trans-Differentiate NIH3T3 Cells into Insulin Producing β-Cells

Shumaila Usman1,2, Irfan Khan2, Kanwal Haneef3 and Asmat Salim2*

1Department of Molecular Medicine, Ziauddin University, Clifton Campus Karachi

2Dr. Panjwani Center for Molecular Medicine and Drug Research, International Center for Chemical and Biological Sciences, University of Karachi, Karachi-75270, Pakistan

3Dr. Zafar H. Zaidi Center for Proteomics, University of Karachi, Karachi-75270, Pakistan

ABSTRACT

Diabetes is one of the most common diseases worldwide. Type I diabetes is characterized by the degeneration of β-cells. The present study is an attempt in the search of a suitable and efficient way to enhance the transdifferentiation ability of mature fibroblasts by using transgene free cellular approach in order to improve the cell-based therapeutics for diabetes. In the present study, we analyzed the effect of 2, 4 - Dinitrophenol (DNP) on the transdifferentiation of NIH3T3 cells into insulin producing β-cells (IPCs). DNP is a lipophilic weak acid that uncouple oxidative phosphorylation by decreasing ATP production. Cells treated with DNP were analyzed for the morphological changes and islet specific markers (MafA, Ngn3, Nkx 6.1, Pdx-1, insulin, glucagon, somatostatin and Sca-1) at gene and protein levels. In the presence of DNP, NIH3T3 cells appeared round, small and contracted while after reoxygenation they regained the normal fibroblast like spindle shaped morphology. The strategy to induce efficient transdifferentiation of NIH3T3 cells into IPCs has shown positive endocrine expression pattern, specifically β-cell specific transcription factors, demonstrating their successful regeneration. It is concluded that DNP has a potential to induce efficient transdifferentiation of NIH3T3 cells into insulin producing β-cells. The study could further be evaluated for their in vivo effect and serve as an improved and effective cellular therapeutic option for type 1 diabetes. It may offer the possibility of improved regeneration of damaged β-cells from mature cell type to functional insulin producing β-cells that could serve as a future therapeutic approach for diabetes.


Article Information

Received 01 August 2022

Revised 25 March 2023

Accepted 20 April 2023

Available online 29 July 2023

(early access)

Published 19 July 2024

Authors’ Contribution

SU methodology, investigation, software, writing- original draft preparation. IK data curation, reviewing and editing. KH methodology, visualization, validation. AS conceptualization, supervision.

Key words

Transdifferentiation, Regeneration, Type 1 diabetes, 2,4- Dinitrophenol, reoxygenation

DOI: https://dx.doi.org/10.17582/journal.pjz/20220801060807

* Corresponding author: [email protected]

0030-9923/2024/0005-2219 $ 9.00/0

Copyright 2024 by the authors. Licensee Zoological Society of Pakistan.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).



Introduction

Type 1 diabetes (T1D) that causes substantial morbidity and mortality, generally fallouts from the autoimmune destruction of pancreatic β-cells, resulting in the elevated blood glucose levels (Atkinson et al, 2014). In order to produce insulin to maintain normoglycemia, the lost β-cells must be replenished (Melton, 2011). Exogenous insulin administration is the only effective management of blood glucose levels. However, insulin treatment comes along with the hypoglycemic episodes and does not eliminate the chronic complications associated with diabetes, like cardiovascular complications, nephropathy, neuropathy, retinopathy and often death (Gerace et al., 2014). Several anti-diabetic drugs including metformin, sulfonylureas, glucagon-like peptide 1 agonists, thiazolidinediones, α-glucosidase inhibitors, and dipeptidyl peptidase-4 inhibitors are available to regulate blood glucose level. However, their continuous administration leads to several pathological outcomes including hypoglycemic episodes, ketoacidosis as well as micro and major complications affecting nervous, retinal, renal, cerebrovascular, and cardiovascular systems (Pandian et al., 2014).

Other therapeutic approach includes pancreas and islet transplantation, though this treatment is hampered because of limited cadaveric donors and the use of lifetime immunosuppressants (Johannesson et al., 2015). The cell replacement therapy constitutes one of the best approaches to target T1D, as it is caused by the destruction of β-cells (Borowiak and Melton, 2009). In the last few years, several promising approaches have been suggested for β-cell regeneration, including reprogramming of non β-cells, direct differentiation of stem cells or trans-differentiation of mature somatic cells, like pancreatic duct cells and hepatocytes into pancreatic β-like cells, thus giving new insight to cure T1D (Lemper et al., 2014).

A transgene-free cellular reprogramming has shown efficient regeneration of a desired cell type by using small molecules. Moreover, this transgene free reprogramming with small molecules is non immunogenic, easier and more conventional than the virus mediated reprogramming approach (Masuda et al., 2013). Small molecules, like the epigenetic enzyme inhibitors and signalling pathway modulators, target key transcription factors, and enhance the direct or indirect differentiation of stem cells or mature cell types into functional insulin producing cells (IPCs) (Pandian et al., 2014). Several small molecules that activate or inhibit the epigenetic enzymes could enhance the differentiation potential, for example, 5-aza-2′-deoxycytidine (5-AZA), a DNA methyl transferase inhibitor, triggers Ngn3 expression and promotes endocrine cell differentiation in the human pancreatic ductal cell line (PANC-1) (Lefebvre et al., 2010). XW4.4, an aminopyrrole derivative has been shown to differentiate MSCs into IPCs via HNF3b (hepatocyte nuclear factor 3b) induction (Ouyang et al., 2014). Moreover, combined treatment of selenite, 5-AZA, retinoic acid and trichostatin A (TSA), chromatin remodelling regulator proteins like insulin and transferrin resulted in direct differentiation of insulin producing cells from rat liver epithelial stem-like WB-F344 cells (WB cells) (Liu et al., 2013).

In the present study, we analyzed the effect of DNP on the transdifferentiation of NIH3T3 cells into insulin producing β-cells. DNP is a lipophilic weak acid that uncouple oxidative phosphorylation by decreasing ATP production (Shavell et al., 2012). Cells treated with DNP were analyzed for the morphological changes and islet specific markers (MafA, Ngn3, Nkx 6.1, Pdx-1, insulin, glucagon, somatostatin and Sca-1) at gene and protein levels.

The choice of defined transcription factors and islet specific markers hold key to efficient transdifferentiation. Some of these factors play important roles in pancreatic beta cell development. MafA is a basic leucine zipper, the homologue of v-Maf oncoprotein and belongs to musculoaponeurotic fibrosarcoma oncogene family. It is expressed in the initial stages of β-cell production and involved in insulin gene expression. It is the principal transcription factor for β-cell development, maturation, reprogramming, production and maintenance of insulin producing cells. MafA is considered a potent transactivator of insulin gene (Matsuoka et al., 2007). During pancreas development, MafA expression is first detected at the beginning of the principal phase of insulin-producing cell production. Neurogenin3 (Ngn3) belongs to basic helix loop helix transcription factor family, and is known to play an important role in pancreatic development and endocrine differentiation (Dominguez et al., 2005). Ngn3 is also involved in the regulation of a variety of pancreatic transcription factors such as NeuroD, Pax4 and Nkx2.2 (Watada et al., 2003). Early pancreatic marker, Sca-1 is co-expressed with Pdx-1 and Ngn3 (Ma et al., 2012). Sca-1 is expressed especially in islets and ductal cells (Seaberg et al., 2004).

The present study is an attempt in the search of a suitable and efficient way to enhance the transdifferentiation ability of mature fibroblasts by using transgene free cellular approach in order to improve the cell based therapeutics for diabetes.

Materials and Methods

Cell culture

Mouse embryonic fibroblast cell line, NIH3T3 was purchased from American Type Culture Collection (ATCC) by the Bio-bank facility of the Dr. Panjwani Center for Molecular Medicine and Drug Research (PCMD). The cells were seeded in high glucose Dulbecco’s modified Eagle’s medium/F12 (DMEM/F12) supplemented with 20% fetal bovine serum (FBS); 100 units/mL penicillin and 100 μg/mL streptomycin.

DNP treatment

70% confluent NIH3T3 cells were treated with 2, 4 dinitrophenol (DNP). To find out optimal concentration of DNP, cells were treated with different concentrations of DNP (0.025-2 mM) for 10 and 20 min. The optimal concentration of 0.1 mM for 20 min was selected on the basis that cells at this concentration only experienced temporary shock. Initially, medium was aspirated and cells were washed twice with incomplete medium. 0.1 mM DNP with FBS free medium was added for 20 min and cells were incubated at 37 °C. After 20 min, medium was aspirated and cells were washed with incomplete medium. Finally, cells were reperfused in the presence of complete medium for 48 h in CO2 incubator.

Morphological examination of DNP treated cells

After DNP treatment and 48 h of reperfusion, cells were analyzed for morphological changes and compared with that of untreated control.

Analysis of pancreatic genes in DNP treated cells

Total RNA was isolated using SV total RNA system kit (Promega, USA) by spin method according to manufacturer’s instructions. 1 μg of the isolated RNA was subjected to cDNA synthesis by using SuperScript III first-strand synthesis kit (Invitrogen Life Technology, USA). Primer 3 design program was used to design primers for each gene at http://frodo.wi.mit.edu/primer3/, and purchased from Integrated DNA technologies (IDT, USA). Gene expression analysis of islet specific genes, insulin, somatostatin, Neurogenin3 (Ngn3), glucagon, NK6 homeobox 1 (Nkx 6.1) and MafA was performed by RT-PCR (Table I). DNA was amplified with initial denaturation at 95°C for 2 min, followed by 35 cycles of denaturation, annealing, and extension at 95°C, 58-64°C and 72°C, respectively, and then final extension at 72°C for 10 min. The amplified products were stored at -20°C until further use. GAPDH was used as positive control.

Analysis of pancreatic proteins in DNP treated cells

After 48 h reoxygenation, cells were dissociated with cell dissociation solution, centrifuged and analyzed for the expression of pancreatic proteins by flow cytometry using the protocol described by Haneef et al. (2014). Primary antibodies against insulin, MafA, Ngn3, Pdx1, glucagon and Sca1 were used at 1:40 dilution. Alexa fluor goat anti-mouse or anti-rabbit secondary antibody at 1:500 dilution was used for detection. Unlabelled cells or cells labelled with the secondary antibody were used as control. Labelled cells were observed in FL-1 filter. FSC was selected as threshold parameter and threshold was set to a value of 52 which eliminate small debris.

Statistical analysis

Significance of difference among the groups was analyzed by using One-way ANOVA. The results were illustrated as mean ± S.E.M. P-value <0.05 was considered statistically significant. Analysis was done by using SPSS program (version 13, SPSS Inc, Chicago, IL, USA).

Results

Morphological characteristics

NIH3T3 cells treated with different concentrations of DNP (0.025 mM – 2 mM) for 20 min showed round and contracted morphology as compared to the untreated control. After 48 h of reoxygenation, cells regained normal morphology at all concentrations except in case of 1 mM and 2 mM at which most of the cells died (Fig. 1A-B). We selected 0.1 mM concentration of DNP for 20 min for all subsequent experiments as cells only shrunk at this concentration and their normal morphology was restored after reoxygenation.

 

Table I. Forward and reverse primer sequences, accession numbers, annealing temperatures and expected product sizes.

Gene PCR primer

Accession No.

Primer Sequence (5’- 3’)

Annealing temperature (°C)

Product size (bp)

GAPDH

BC09593

F GGAAAGCTGTGGCGTGATGG

R GTAGGCCATGAGGTCCACCA

60

414

Insulin

NM_008386

F CCACCCAGGCTTTTGTCAAG

R TCCAGCTGGTAGAGGGAGCA

64

251

MafA

NM_194350

F ATCATCACTCTGCCCACCAT

R AGTCGGATGACCTCCTCCTT

58

208

Somatostatin

NM_0092151

F CCCCAGACTCCCGTCAGTTTC

R TGGGTTCGAGTTGGCAGACC

63

200

Ngn3

NM_009719

F GAGTTGGCACTCAGCAAAC

R TCTGAGTCAGTGCCCAGAT

56

350

Glucagon

NM_008100

F CCCAGACAGAAGCGCATGAG

R GAATTCCTTTGCTGCCTGGCC

63

251

Nkx 6.1

NM_144955.2

F TCAGGTCAAGGTCTGGTTCC

R CGATTTGTGCGTTTTTCAGCA

56

211

 

 

Pancreatic genes expression after DNP treatment

To check the effect of DNP on transdifferentiation of NIH3T3 cells, pancreatic transcription factors (MafA, Ngn3, Nkx 6.1) and pancreatic genes (insulin, glucagon, somatostatin) were analyzed at mRNA level by RT-PCR. Treated cells expressed insulin, MafA, and Ngn3 whereas somatostatin expression was found to be down regulated after DNP treatment (Fig. 2A). Significant increase in the expression of insulin, glucagon (p< 0.05), Ngn3 and Nkx6.1 (p<0.01) while significantly decreased (p< 0.05) expression of somatostatin was observed after DNP treatment. No significant change was observed in MafA expression levels as compared to untreated control (Fig. 2B).

Pancreatic proteins expression after DNP treatment

To evaluate the effect of DNP on the differentiation of NIH3T3 cells, expression of pancreatic proteins, insulin, glucagon, MafA, Ngn3, Pdx-1, and Sca1 were analyzed by flow cytometry (Fig. 3A). Treated NIH3T3 cells showed significant increase (p <0.001) in insulin, MafA, Pdx1, glucagon and Ngn3 expressions as compared to untreated control (Fig. 3B).

Discussion

Oxygen plays a critical role in maintaining cellular homeostasis, regulation of stem cells function and development of several organs, including pancreas (Shah et al., 2011). Typically, in normal cells oxygen deficiency contributes in the cell death, while in stem cells it controls cellular properties including self-renewal and differential potential by regulating signalling pathways and expression of key regulatory transcription factors (Hakim et al., 2014). It has been known to control differentiation of various cell types including pancreatic cells (Fraker et al., 2007) neural cells (Freitas-Correa et al., 2013) and cardiomyocytes (Khan et al., 2016).

 

In the present study DNP was used to analyze its role in the trans differentiation of mouse embryonic fibroblasts to insulin producing beta cells. DNP is a metabolic inhibitor, it uncouples the oxidative phosphorylation by decreasing ATP production (Shavell et al., 2012). It is commonly used to chemically induce the low oxygen environment and metabolic stress in different cell types (Khan et al., 2016). Earlier our group has reported the role of DNP in cell survival and angiogenic genes induction (Ali et al., 2015), increased fusion potential of cardiomyocytes and rat MSCs (Haneef et al., 2014). We further reported that preconditioning of bone marrow derived mesenchymal stem cells with DNP increased expression of angiogenic factors including Angiopoietin 1, erythropoietin, VEGF and FGF (Ali et al., 2015). VEGF is a hypoxia marker and is found to be involved in the process of angiogenesis (Han et al., 2016).

In this study the effect of DNP on the expression of pancreatic genes and proteins in the NIH3T3 cells was analysed. We optimized DNP concentration by treating cells with different concentrations (0.025 – 2 mM) followed by 48 h of reperfusion. DNP treated cells appeared small and shrunken, displaying stress condition. However, they attained normal morphology after reoxygenation. The concentration of 0.1 mM was selected on the basis of having lesser number of apoptotic cells. After treatment, expression of almost all pancreatic genes was upregulated in NIH3T3 cells. Ngn3, Nkx6.1, insulin, and glucagon expressions were significantly increased (p<0.01, p<0.01, p<0.05 and p<0.05, respectively). MafA expression was also increased but the change was not significant. In contrast, somatostatin was significantly decreased (p<0.001) after DNP treatment. Also, protein concentrations of insulin, MafA, glucagon, Pdx1 and Ngn3 were significantly increased (p<0.001) after DNP treatment.

The enhanced expression of endocrine markers, specifically β-cell specific transcription factors demonstrate the successful regeneration of insulin producing β-cells. Furthermore, significant change in glucagon expression suggests that the cells are also differentiating to glucagon producing α-cells. DNP was used to give stress and it has been shown to enhance the differential potential of NIH3T3 cells by significantly increasing the endocrine marker (Ngn3). A high O2 condition during the early stage of differentiation is reported to increase the percentage of Ngn3-expressing endocrine progenitor and insulin positive cells in both mESC and hiPSC at the terminus of differentiation via HIF-1α inhibition and stimulation of Ngn3 gene expression (Hakim et al., 2014). However, during hypoxia, HIF-1α expression was enhanced which results in the activation of Notch signalling. Activation of Notch results in the inhibition of β-cell differentiation by inhibiting Ngn3 expression. DNP is also used to give chemical hypoxia to the cells as it depletes ATP production (Jovanović et al., 2009). However, DNP treatment is reported to suppress HIF-1α expression and enhance Ngn3 expression, as well as it is reported to improve Nrp1 (Ali et al., 2015) and VEGF expression (Shavell et al., 2012). This increase in Nrp1 expression or enhanced Ngn3 expression via HIF-1α suppression may have led to the increase in insulin level in the treated NIH3T3 cells.

In our study, the strategies to induce efficient trans-differentiation of NIH3T3 cells into IPCs have shown positive endocrine expression pattern, specifically β-cell specific transcription factors, demonstrating their successful regeneration. The study could further be evaluated for their in vivo effect and serve as an improved and effective cellular therapeutic option for type 1 diabetes.

Conclusion

It is concluded that DNP has a potential to induce efficient transdifferentiation of NIH3T3 cells into insulin producing β-cells. This study may offer the possibility of improved regeneration of damaged β-cells from mature cell type to functional insulin producing β-cells that could serve as a future therapeutic approach for diabetes.

Funding

No external funding received.

IRB approval and ethical statement

Not applicable as the study involves no animals or human subjects.

Statement of conflict of interest

The authors have declared no conflict of interest.

References

Ali, A., Akhter, M.A., Haneef, K., Khan, I., Naeem, N., Habib, R., Kabir. N. and Salim, A., 2015. Dinitrophenol modulates gene expression levels of angiogenic, cell survival and cardiomyogenic factors in bone marrow derived mesenchymal stem cells. Gene, 555: 448-457. https://doi.org/10.1016/j.gene.2014.10.045

Atkinson, M.A., Eisenbarth, G.S. and Michels, A.W., 2014. Type 1 diabetes. Lancet, 383: 69-82. https://doi.org/10.1016/S0140-6736(13)60591-7

Borowiak, M. and Melton, D.A., 2009. How to make β cells? Curr. Opin. Cell Biol., 21: 727-732. https://doi.org/10.1016/j.ceb.2009.08.006

Domínguez-Bendala, J., Klein, D., Ribeiro, M., Ricordi, C., Inverardi, L., Pastori, R. and Edlund, H., 2005. TAT-mediated neurogenin 3 protein transduction stimulates pancreatic endocrine differentiation in vitro. Diabetes, 54: 720–726. https://doi.org/10.2337/diabetes.54.3.720

Fraker, C.A., Alvarez, S., Papadopoulos, P., Giraldo, J., Gu, W., Ricordi, C., Inverardi, L. and Domínguez-Bendala, J., 2007. Enhanced oxygenation promotes β-cell differentiation in vitroStem Cells25: 3155-3164. https://doi.org/10.1634/stemcells.2007-0445

Freitas-Correa, L., Lourenco, M.V., Acquarone, M., Da Costa, R.F.M., Galina, A., Rehen, S.K. and Ferreira S.T., 2013. 2, 4-dinitrophenol induces neural differentiation of murine embryonic stem cells. Stem Cell Res.11: 1407-1416. https://doi.org/10.1016/j.scr.2013.09.016

Gerace, D., Martiniello-Wilks, R., O’brien, B. and Simpson, A., 2014. The use of β-cell transcription factors in engineering artificial β cells from non-pancreatic tissue. Gene Ther., 22: 1-8. https://doi.org/10.1038/gt.2014.93

Hakim, F., Kaitsuka, T., Raeed, J.M., Wei, F.Y., Shiraki, N., Akagi, T., Yokota, T., Kume, S. and Tomizawa, K., 2014. High oxygen condition facilitates the differentiation of mouse and human pluripotent stem cells into pancreatic progenitors and insulin-producing cells. J. biol. Chem., 289: 9623-9638. https://doi.org/10.1074/jbc.M113.524363

Han, K.H., Kim, A.K., Kim, M.H., Kim, D.H., Go, H.N. and Kim, D.I., 2016. Enhancement of angiogenic effects by hypoxia-preconditioned human umbilical cord-derived mesenchymal stem cells in a mouse model of hindlimb ischemia. Cell Biol. Int.40: 27-35. https://doi.org/10.1002/cbin.10519

Haneef, K., Naeem, N., Khan, I., Iqbal, H., Kabir, N., Jamall, S., Zahid, M. and Salim, A., 2014. Conditioned medium enhances the fusion capability of rat bone marrow mesenchymal stem cells and cardiomyocytes. Mol. Biol. Rep., 41: 3099-3112. https://doi.org/10.1007/s11033-014-3170-1

Johannesson, B., Sui, L., Freytes, D.O., Creusot, R.J. and Egli, D., 2015. Toward beta cell replacement for diabetes. EMBO J., 34: 841-855. https://doi.org/10.15252/embj.201490685

Jovanovic, S., Du, Q., Sukhodub, A. and Jovanovic, A., 2009. A dual mechanism of cytoprotection afforded by M-LDH in embryonic heart H9C2 cells. Biochim. biophys. Acta, 1793: 1379-1386. https://doi.org/10.1016/j.bbamcr.2009.04.007

Khan, I., Ali, A., Akhter, M.A., Naeem, N., Chotani, M.A., Mustafa, T. and Salim, A., 2016. Preconditioning of mesenchymal stem cells with 2,4-dinitrophenol improves cardiac function in infarcted rats. Life Sci.162: 60-69. https://doi.org/10.1016/j.lfs.2016.08.014

Lefebvre, B., Belaich, S., Longue, J., Vandewalle, B., Oberholzer, J., Gmyr, V., Pattou, F. and Kerr-Conte, J., 2010. 5′-AZA induces Ngn3 expression and endocrine differentiation in the PANC-1 human ductal cell line. Biochem. biophys. Res. Commun., 391: 305-309. https://doi.org/10.1016/j.bbrc.2009.11.054

Lemper, M., Leuckx, G., Heremans, Y., German, M., Heimberg, H., Bouwens, L. and Baeyens, L., 2014. Reprogramming of human pancreatic exocrine cells to β-like cells. Cell Death Differ., 22: 1117–1130. https://doi.org/10.1038/cdd.2014.193

Liu, J., Liu, Y., Wang, H., Hao, H., Han, Q., Shen, J., Shi, J., Li, C., Mu, Y. and Han, W., 2013. Direct differentiation of hepatic stem-like WB cells into insulin-producing cells using small molecules. Sci. Rep., 3: 1-8. https://doi.org/10.1038/srep01185

Ma, F., Chen, F., Chi, Y., Yang, S., Lu, S. and Han, Z., 2012. Isolation of pancreatic progenitor cells with the surface marker of hematopoietic stem cells. Int. J. Endocrinol., 948683. https://doi.org/10.1155/2012/948683

Masuda, S., Wu, J., Hishida, T., Pandian, G.N., Sugiyama, H. and Belmonte, J.C.I., 2013. Chemically induced pluripotent stem cells (CiPSCs): A transgene-free approach. J. mol. cell Biol., 5: 354-355. https://doi.org/10.1093/jmcb/mjt034

Matsuoka, T.A., Kaneto, H., Stein, R., Miyatsuka, T., Kawamori, D., Henderson, E., Kojima, I., Matsuhisa, M., Hori, M. and Yamasaki, Y., 2007. MafA regulates expression of genes important to islet beta cell function. Mol. Endocrinol., 21: 2764–2774. https://doi.org/10.1210/me.2007-0028

Melton, D.A., 2011. Using stem cells to study and possibly treat type 1 diabetes. Phil. Trans. R. Soc. B, 366: 2307-2311. https://doi.org/10.1098/rstb.2011.0019

Ouyang, J., Huang, W., Yu, W., Xiong, W., Mula, R.V., Zou, H. and Yu, Y., 2014. Generation of insulin-producing cells from rat mesenchymal stem cells using an aminopyrrole derivative XW4. 4. Chem. Biol. Interact., 208: 1-7. https://doi.org/10.1016/j.cbi.2013.11.007

Pandian, G.N., Taniguchi, J. and Sugiyama, H., 2014. Cellular reprogramming for pancreatic β-cell regeneration: Clinical potential of small molecule control. Clin. Transl. Med., 3: 1-12. https://doi.org/10.1186/2001-1326-3-6

Seaberg, R.M., Smukler, S.R., Kieffer, T.J., Enikolopov, G., Asghar, Z., Wheeler, M.B., Korbutt, G. and Van Der Kooy, D., 2004. Clonal identification of multipotent precursors from adult mouse pancreas that generate neural and pancreatic lineages. Nat. Biotechnol., 22: 1115–1124. https://doi.org/10.1038/nbt1004

Shah, S.R., Esni, F., Jakub, A., Paredes, J., Lath, N., Malek, M. and Guo, P., 2011. Embryonic mouse blood flow and oxygen correlate with early pancreatic differentiation. Dev. Biol.349: 342-349. https://doi.org/10.1016/j.ydbio.2010.10.033

Shavell, V.I., Fletcher, N.M., Jiang, Z.L., Saed, G.M. and Diamond, M.P., 2012. Uncoupling oxidative phosphorylation with 2,4-dinitrophenol promotes development of the adhesion phenotype. Fertil. Steril., 97: 729-733. https://doi.org/10.1016/j.fertnstert.2011.12.009

Watada, H., Scheel, D.W., Leung. J. and German, M.S., 2003. Distinct gene expression programs function in progenitor and mature islet cells. J. biol. Chem., 278: 17130–17140. https://doi.org/10.1074/jbc.M213196200