Cry2Aa Delta-Endotoxin Confers Strong Resistance Against Brinjal Fruit and Shoot Borer in Transgenic Brinjal (Solanum melongena L.) Plants

Shruti Yadav1,2*, Kamana Singh2, Pratap Adinath Divekar3 and

Suhas Gorakh Karkute1,3*

1ICAR-National Institute for Plant Biotechnology, New Delhi, India

2Deshbandhu College, University of Delhi, New Delhi, India

3ICAR-Indian Institute of Vegetable Research, Varanasi, Uttar Pradesh, India

Shruti Yadav and Kamana Singh have made equal contributions in this article.

ABSTRACT

Eggplant or brinjal (Solanum melongena L.) is an important fruit vegetable of Solanaceae family that has originated from India and is widely cultivated in tropical and temperate regions across the world. The major constraint for brinjal production is severe damage caused by a Lepidopteran insect pest brinjal shoot and fruit borer (BSFB; Leucinodes orbonalis) leading to almost 60% lossess. In the present study, a codon-modified synthetic Cry2Aa gene was introduced into brinjal through Agrobacterium mediated transformation. Presence of Cry2Aa gene was confirmed by PCR and Southern blot analysis showed single copy insertions in plants of six independent transgenic events. Cry2Aa gene was highly expressed in transgenic plants and its protein level was as high as 30.94 µg/g in fresh leaves and 20.57µg/g in fruits. Insect bioassay showed the BSFB larval mortality between 90% to 100%. Altogether it was observed that expression of the Cry2Aa protein in the shoots and fruit of transgenic brinjal lead to high BSFB larval mortality. Thus, Cry2Aa is a potential alternate gene to presently used Cry1Ac gene which can also be used for managing the resistance breakdown.


Article Information

Received 16 May 2023

Revised 05 June 2023

Accepted 23 June 2023

Available online 04 September 2023

(early access)

Published 26 July 2024

Authors’ Contribution

SY and SGK conceptualized the work. SY and KS conducted all the experiments. PAD analysed the data. SY and SGK wrote the manuscript. All the authors read and approved the final manuscript.

Key words

Brinjal, Shoot and fruit borer, cry2Aa, Leucinodes orbonalis, Resistance, Transgenic

DOI: https://dx.doi.org/10.17582/journal.pjz/20230516110558

* Corresponding author: [email protected], [email protected]

0030-9923/2024/0005-2235 $ 9.00/0

Copyright 2024 by the authors. Licensee Zoological Society of Pakistan.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).


Introduction

Brinjal or eggplant (Solanum melongena L.) is one of the major solanaceous crops of tropics and sub-tropics acclimatized to different agro-climatic zones grown in South East Asia. It is rich in minerals, vitamins and is a great source of total water-soluble sugars, amide proteins and free reducing sugars among other nutrients (Alam et al., 2003). India is the second largest producer of brinjal worldwide, after China. Brinjal is the fourth largest crop after potato, onion and tomato in terms of consumption in Indian scenario. In India, it is cultivated on 747 thousand hectares with an annual production of 12.98 million tonnes second advance estimates 2021-2022 https://pib.gov.in/). More than 70 species of insect attack brinjal (Subbarathnam and Butani, 1982), shoot and fruit borer (BSFB) being the most destructive insect pest which is not only responsible for a substantial yield loss (85-90%) (Patnaik, 2000), but it also decreases the value of the product, making the product less lucrative.

Therefore, it is crucial for sustainable brinjal production that this pest be controlled. The first choice of farmers is synthetic pesticides, despite the availability of eco-friendly and sustainable pest management options like host plant resistance (HPR) (Divekar et al., 2019), plant secondary metabolites (Divekar et al., 2022), bio-control agents (Dukare et al., 2020), and defence proteins (Divekar et al., 2022). Control by application of insecticides is often ineffective since the larvae remain concealed within fruits and shoots, and therefore, escape contact with the insecticide. The uncontrolled use of insecticides by farmers has also resulted in the development of insect resistance, higher production costs, and potential risks to the environment and human health (Gaur and Chaudhary, 2009). The development of BSFB-resistant cultivars has been significantly hampered by the absence of any natural sources of resistance to BSFB in any of the cultivated and conventionally cross-compatible species of Solanum.

The delta-endotoxin encoded by insecticidal crystal protein (Cry) genes of the gram-negative bacteria Bacillus thuringiensis is known as the most effective proteinaceous insecticide used in agriculture (Kumar and Kumar, 2010). BSFB resistant transgenic brinjal lines have been made possible by plant genetic engineering employing Cry genes from B. thuringiensis (Kumar et al., 1998). In India, several public and private sector research institutions have developed transgenic brinjal resistant to BSFB, by transferring different version of Cry genes (Cry1Ab in cv. Pusa Purple Long, Kumar et al. (1998); Cry1Ac in cv. Kashi Taru, Pal et al. (2009); Cry1Aa3 in cv. Kashi Taru, Rai et al. (2013) and five brinjal hybrids are derived from transgenic BSFB resistant lines (carrying Cry1Ac gene) by Maharastra Hybrid Seeds Company (Mahyco, Jalna, India). Considering the fact that very limited study has been made on the efficacy of Cry2Aa gene particularly in brinjal, we have made an effort to develop BSFB resistant transgenic brinjal lines in the cultivar Pusa Hybrid 6 (male), which could be further used for stacking multiple Cry genes into one variety. Cry2Aa protein has very high toxic activity against larvae of Lepidoptera as well as Diptera (Morse et al., 2001) providing broad spectrum insect resistance to transgenic plants.

Materials and Methods

Construction of the plant transformation binary vector

Synthetic plant codon-optimized Cry2Aa gene was excised from pBluescript KS (+) vector using KpnI and XbaI restriction sites and cloned into the respective sites present in the pBinAR binary vector and confirmed by restriction digestion analysis. Cry2Aa gene was driven under the control of the potato ubiquitin promoter and OCSA terminator. Neomycin phosphotransferase (nptII) marker gene present in the binary vector, regulated by NOS promoter and NOS terminator was used as a plant selection marker. The pBinAR-Ubi-Cry2Aa binary vector constructs were mobilized into Agrobacterium tumefaciens EHA105 by freeze-thaw method. Agrobacterium harboring vector was inoculated in YEM media with 50 mg/l kanamycin (HI Media) and 10 mg/l rifampicin (HI Media) and grown overnight at 28 ºC on a rotary shaker (220 rpm). The Agrobacterium cells were harvested by centrifugation at 5000 g for 10 min at room temperature and further the cells were resuspended in 20 ml Murashige and Skoog (MS) basal salts as inoculation medium (IM) (Fig. 1).

Culture conditions and Agrobacterium mediated transformation

Seeds of brinjal cv. Pusa Hybrid 6 (Male parent) were surface sterilized by rinsing for 1 min in 70% ethanol, followed by three washes with autoclaved double distilled water. Further, the seeds were rinsed using 0.1% commercial Clorox (5.25% sodium hypochlorite) with 0.01% Tween 20 for about 10 min, followed by three washes with autoclaved distilled water (5 min per rinse). Seeds were then sowed and germinated on half strength MS medium with pH 5.8. The cultures in all the experiments were incubated at 25 ºC with a 16 h photoperiod. Cotyledonary leaves of 1 mm size in diameter were excised from 12 day old seedlings and kept on pre-culture medium (MS salts, 3% sucrose, 0.1 mg/l α-naphthalene acetic acid and 2 mg/l 6-benzylaminopurine) with pH 5.8 for two days. Later, the explants were submerged in Agrobacterium suspension for 10 min and incubated in the dark at 28 ºC. After inoculation, the excess of bacterial suspension was removed, and the explants were shifted to the same pre-culture medium for next two days for co-cultivation. The explants were selected for transformants on selection medium (MS salts, B5 vitamins, 3% sucrose, 2 mg/l BAP, 0.1 mg/l IAA, 500 mg/l cefotaxime and 100 mg/l kanamycin), and the surviving proliferating explants were transferred to regeneration medium (MS salts, B5 vitamin, 3% sucrose, 1.0 mg/l Zeatin, 100 mg/l kanamycin and 500mg/l cefotaxime). The regenerated shoot buds were then shifted to shoot induction medium (MS salts, B5 vitamin, 3% sucrose, 0.1 mg/l α-naphthalene acetic acid, 1 mg/l 6-benzylaminopurine, 100 mg/l kanamycin and 500 mg/l cefotaxime). The regenerated shoots were further transferred to rooting medium (MS salts, B5 Vitamin, 3% sucrose, kanamycin 50 mg/l and cefotaxime 300 mg/l) devoid of growth regulators. Further, these plantlets were hardened and transferred to controlled glasshouse conditions and allowed to set seeds.

Molecular characterization of transgenic plants

The putative transgenic plants were confirmed by amplification of Cry2Aa and nptII genes by PCR and by Southern hybridization. The gene specific primers used for Cry2Aa were F 5’ TCAGGGACGTGATCCTCAACGC-3’ and R 5’ TCGCCCTGGTTGCCGAACTT-3’ and for nptII were F 5’ GCTTGGGTGGAGAGGCTATT 3’ and R 5’ AGAACTCGTCAAGAAGGCGA 3’ for amplification of 1kb and 728bp fragments, respectively.

For Southern hybridization, 10 µg of total genomic DNA from the transgenic and wild-type brinjal plants was digested with HindIII restriction enzyme and subjected to electrophoresis on 0.8% agarose gel. Further, the DNA was transferred to a nylon membrane (Hybond-N+; Amersham Co. Ltd., NJ, USA) by capillary blotting. Cry2Aa gene probe of 1 kb was PCR amplified and purified using QI PCR purification kit (Qiagen, USA). The probe was radiolabelled with α [32P]-dCTP by random priming. All Southern blot analysis and hybridizations were performed using Rapid-Hyb buffer according to the manufacturer’s instructions (Amersham Co. Ltd., NJ, USA). The hybridization was performed at 60ºC in Rapid-Hyb buffer plus the denatured probe. Later, the membrane was exposed to X-ray film and was placed in an intensifying cassette under dark conditions and stored at -80ºC for 48-72 h and the exposed X-ray film (Fujifilm, Kodak) was developed to visualize the results.

Segregation analysis

Segregation of the Cry2Aa transgene in T1 progeny seedlings was analyzed for each of the four independent transformation events. T1 generation seeds from self-pollinated T0 fruits were germinated in pots filled with soilrite. The genomic DNA were extracted from leaf tissues of 30-days old seedlings and PCR was performed using the Cry2Aa gene-specific primers as described earlier.

qRT- PCR analysis

Total RNA from the leaves of transgenic Cry2Aa and wild type plants were isolated using Spectrum Total Plant RNA Isolation Kit (Sigma-Aldrich) following the manufacturer’s instructions. Quality and quantity of RNA was analyzed by gel electrophoresis and Nanodrop spectrophotometer (Thermo Scientific, USA) respectively. cDNA was synthesized with 1µg of total RNA using SuperScript-III cDNA Synthesis System (Invitrogen, Carlsbad, USA). Quantitative real-time PCR was performed in Stratagene Mx3005P detection unit, using VeriQuest SYBR Green qPCR Master Mix (Affymetrix, Santa Clara, USA). For each sample, PCR assays were carried out in triplicates. Melting curve analysis was used to confirm the specificity of the method. The PCR cycles used were as follows: 95° C for 3 min, then 40 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s. Brinjal 18S gene was used as an internal control with primers 5’-CCGCGGAAGTTTGAGGCAATAAC-3’ and 5’-CGGCAAGGCTATAAGCTCGTTGAA-3’. and for specific amplification of Cry2Aa, 5’-AAGAACAACATCTACGCCGCCAAC-3, and 5’-TGAAGGTACGCGTCTGGTTGTTCA-3’ were used as forward and reverse primers respectively. For each sample, PCR assays were performed in triplicates. The relative expression of Cry2Aa was calculated by the 2−ΔΔCT method (Livak and Schmittgen, 2001).

ELISA

A double antibody sandwich enzyme linked immunosorbent assay (ELISA) was used to detect the presence of Cry2Aa protein expressed in the leaves of transgenic plants. The experiment was performed with double sandwich quantitative Cry2Aa ELISA plate (Envirologix, Portland, USA). Total protein from the leaf samples of transgenic and wild type brinjal plants was extracted using the protein extraction buffer (Envirologix). The leaf extract was diluted to fit in the linear range of the provided Cry2Aa standards, and steps were performed essentially according to manufacturer’s instructions. Halo MPR-96 microplate reader (Dynamica, 23 Ottawa, Canada), was used to read the plate at 450 nm. The Cry2Aa standard supplied in the kit was used for quantification.

Western blotting

Young leaves of transgenic Cry2Aa brinjal and wild-type plants were used for the experiment. The sample was extracted using a protein extraction buffer (50 mM Tris buffer, 150 mM NaCl, 0.001 M PMSF, β-mercaptoethanol, pH 8). The proteins were quantified using Bradford reagent (Bio-Rad, Hercules, USA) and protein concentrations were determined against a standard of bovine serum albumin. About 100 ng crude protein samples were then run on 10% SDS-PAGE gel with a Dual Mini Slab Chamber (Bio-Rad). This protein gel was transferred to Immobilon-P membrane (Millipore, Billerica, USA) using a Mini Trans-Blot electrophoretic cell (Bio-Rad) by applying 40 V for 2 hours in a cold room and further transferred to a blocking solution having skimmed milk powder (5%) in 1X Tris-buffered saline (TBS). It was incubated with primary antibody (mouse anti-cry2Aa antigen, Envirologix) at 1:4000 dilution, and secondary antibody (goat anti-mouse IgG alkaline phosphatase conjugate, GeNei, Bengaluru, India) at 1:4000 dilutions for one hour each at room temperature followed by washes. The signal was detected using BCIP/NBT substrate (Sigma-Aldrich, St Louis, USA) for 5-10 min.

Insect bioassay

Insect bioassay was performed to assess the efficacy of the Cry2Aa protein in the transgenic plants. Detached leaves and fruits from T2 generation transgenic events (T) and wild type of Pusa Hybrid 6 (C) were used. A shoot bioassay was performed with 4 cm long detached shoots of 30-day old seedlings, grown under glasshouse conditions (28± 2ºC; 70±5% RH); three plants from each transgenic event were used for the experiment. Three mm thick aseptic fruit slices were made from the detached fruits. Each fruit slice/shoot piece was placed in a petri dish (90 X 15 mm) containing water-soaked Whatman paper. Further, laboratory-reared pre-weighed third-instar Leucinodes larva were released into the petri dishes. Later, larval mortality or the weight of surviving larvae was measured on the fruit slices and shoot pieces of both the transgenic events (T) and the wild type (C). The weight gain was recorded after 4 days, and larval mortality was noted on day six.

Results

Transgenic brinjal overexpressing Cry2Aa gene

About 300 cotyledonary leaf explants of Pusa Hybrid-6 brinjal variety were co-cultivated with Agrobacterium EHA105 strain harboring pBinAR-cry2Aa. It was observed that, after three weeks of incubation on the selection medium, around 55% explants formed green calli along the cut surface of the infected leaves whereas wildtype explants (non-infected) completely failed to either proliferate (in to shoots) or show any regeneration response. Wild type explants completely died after three weeks of incubation on the selection medium. The proliferating shoots recovered on selection medium were further transferred to regeneration medium, followed by shoot induction medium and then rooting medium containing 100 mg/l kanamycin and 250 mg/l cefotaxime, to obtain completely regenerated plantlets, which later acclimatized successfully in glass house conditions.

 

Molecular characterization of transgenic plants

Putative cry2Aa brinjal transformants were subjected to PCR analysis. The results of PCR amplifications showed expected amplicon of 1 kb and 750 bp for the cry2Aa and nptII genes respectively in transformed plants whereas; as expected no amplification was detected in the wildtype plants (Fig. 2A, B). A total of 16 plants out of 22 examined were positive for the presence of cry2Aa and nptII gene. To determine the copy number and integration pattern of the transgenes, southern hybridization analysis was performed (Fig. 2C). The analysis revealed the presence of eight independent transgenic events (E1, E2, E3, E4, E5, E6, E7 and E8) of which six lines (E1, E3, E4, E5, E6, E7) showed a single copy of T-DNA insertion while, lines E2 and E8 showed a triple and double copy of T-DNA insertion respectively. As expected, for the left border junction fragment, the hybridization signals were different in sizes and more than 2.6 kb size. Single copy transgene harboring fertile lines, E1, E3, E4 and E7 were further used for molecular and biochemical analysis in this study.

 

Segregation analysis

The T0 transgenic plants were grown in glass house under controlled atmospheric condition like wild type plants. The T0 plants were selfed and after maturity seeds were harvested. The fertile T1 progenies were grown, and genomic DNA from these plants was isolated and PCR were performed with cry2Aa primers. Segregation analysis of four tested independent events (E1, E3, E4, and E7) showed three out of four lines segregated nearly in 3:1 Mendelian segregation ratio indicating one transgene locus (Fig. 3) (Table I) however, one line (E7) showed some distortion from Mendelian segregation ratios (Table I).

 

Table I. Segregation of cry2Aa gene among T1 progenies of four independent transformation events of eggplant Pusa Hybrid-6.

Transgenic event

No. of seedling

χ² value (3:1)

PCR positive

PCR Negative

Event E1

7

4

0.382

Event E3

8

2

3.88

Event E4

7

3

2.5

Event E7

9

6

0.355

Χ² 0.05 df1=3.841. Table shows the segregation analysis of different transgenic events E1, E3, E4 and E7 using the Cry2Aa gene primers.

Expression analysis of transgenic brinjal plants

The relative expression levels of cry2Aa transcript were analyzed by qRT-PCR in the four events (Fig. 2D). The four selected transgenic events showed different Cry2Aa expression levels; the event E1 showed the highest expression level followed by the event E4, E3 and E7. Protein expression levels of brinjal Cry2Aa plants were analyzed with Cry2Aa ELISA kit (Fig. 4A). The average expression levels in terms of percentage of TSP (total soluble protein) of Cry2Aa was minimum in transgenic line E7 and maximum levels of protein expression found in the line E1. Western blot analysis was performed to detect the presence of cry2Aa protein and to confirm the obtained ELISA results (Fig. 4B). A band corresponding to 66 kDa reacted with the polyclonal antibodies raised against Cry2Aa protein.

Insect bioassay

Non-significant differences were noted in transformed and non-transformed brinjal line in terms of pre-weight BSFB, L. orbonalis larvae in shoots (F = 3.241, p= 0.06) and fruits (F = 2.745, p= 0.089). Significant differences were noted in terms of larval mortality of BSFB on shoot as well as fruit tissues (shoot mortality: (F = 380.443, p˂0.001), fruit mortality: (F = 252.477, p˂0.001) when fed on transformed and non-transformed control brinjal (Table II). The mean mortality of BSFB fed on shoot of transgenic brinjal line was significantly higher (83.33 to 91.11%) in comparison to control (6.67). Similarly, in case of fruit tissues, the transformed brinjal plants exhibited 100% mean mortality, whereas, it was only 3.33 % for non-transformed plants.

 

Table II. Larval mortality on shoot and fruit of non-transgenic and transgenic brinjal plants after six days of feeding.

Treatment

Larval mortality (%)

Shoot

Fruit

E1

86.67±1.92bc

100.00±0.00b

E3

91.11±2.22c

100.00±0.00b

E4

88.89±1.11bc

100.00±0.00b

E7

83.33±1.92b

100.00±0.00b

Control

6.67±1.92a

3.33±1.92a

F

380.443

252.477

P

˂0.001

˂0.001

 

Mean values in the same column followed by a different letter (a-c) are significantly different on the basis of Tukey’s test (P ≤0.05).

 

 

Table III. Growth of BSFB third-instar larvae reared on shoot and fruit of transformed brinjal.

Treatment

Shoot bioassay

Fruit bioassay

Pre-weight (mg)

Weight 4 DAI (mg)

Weight gain

(mg)

Weight gain (%)

Pre-weight (mg)

Weight 4 DAI (mg)

Weight gain

(mg)

Weight gain

(%)

E1

15.00±0.42a

23.97±0.84a

9.12±0.92a

59.87±4.95

14.40±0.76a

25.47±0.66a

11.60±0.29a

77.37±5.16

E3

15.80±1.01ab

28.60±0.69b

12.63±1.27a

82.83±14.47

17.47±0.64b

27.90±1.12a

10.53±0.52a

59.70±1.56

E4

16.60±1.10ab

25.60±1.36ab

8.47±0.13a

54.50±2.29

16.10±1.27ab

25.80±1.04a

9.40±0.80a

61.40±8.71

E7

14.07±0.81a

26.80±0.81ab

12.47±1.22a

92.49±17.10

14.10±0.93a

25.40±0.70a

11.43±1.00a

81.62±12.42

Control

18.10±0.78b

48.77±2.25c

30.33±0.98b

169.36±1.26

16.93±0.81ab

59.33±2.97b

41.90±2.97b

251.68±22.14

F

3.241

59.722

51.286

-

2.745

91.872

93.3

-

P

0.060

˂0.001

˂0.001

-

0.089

˂0.001

˂0.001

-

Mean values in the same column followed by a different letter (a-c) are significantly different on the basis of Tukey’s test (P ≤0.05).

 

The mean weight of BSFB larvae at 4 Days after feeding (DAF) on fruit slices from the transformed brinjal plants was found in the range of 25.40-27.90 mg, which was significantly lower than larval weight on fruit slices from non-transformed control brinjal (48.77 mg). Similarly, the mean weight of larvae at 4 DAF on shoots from the transformed brinjal plants was ranged in between 23.97-28.60 mg, which was significantly lower than larval weights measured on shoots from non-transformed control samples (59.33 mg) (Table III). The L. orbonalis larvae reared on transgenic shoots (9.12-12.63 mg) or fruit slices (9.40-11.60 mg) showed significantly less weight gain which resulted into high larval mortality.

Discussion

Brinjal is one of the widely grown vegetable crops in Asia and is susceptible to many diseases and pests including the fruit and shoot borer resulting in huge economic losses. Bacillus thuringiensis is being efficiently used as a source of Cry toxins for insect pest management in crops. The Bt or Cry formulations are safe for other natural enemies of insect pests (Anil and Sharma, 2010) but it has certain limitations as not being cost effective nor providing long term defense. With the advent of transgenic technology for the genetic manipulation of plant species, an enormous progress is observed in basic plant research. Transgenic crop plants expressing different Cry proteins were able to achieve insect resistance and displayed improved yield and reduced use of synthetic pesticides (Perlak et al., 2001; James, 2011). Bt transgenic crops are more reliable against target pests as the Cry toxin has a prolonged expression.

The insecticidal gene from Bacillus thuringiensis was incorporated in brinjal with CryIIIb and Cry1Ab to make it resistant to Colorado beetle and brinjal shoot and fruit borer respectively. These transgenic plants showed significantly higher yields in the field trails (Arpaia et al., 1998; Kumar et al., 1998). Sanyal et al. (2005) has successfully transformed chickpea with Cry2Aa and Cry1Ac with commendable expressions which can further form the basis for combination of these genes to form more robust transgenic lines. Transgenic brinjal with Cry1Ac gene has been commercially released in Bangladesh and by 2018-19 it was cultivated by on the area of 1,213.3 ha (Shelton et al., 2020).

The perusal of pertinent literature shows that not enough evidences of any definite risk is associated with the genetically modified crops if used with proper implementation of regulatory mechanism. Insecticides are not very effective in control of L. orbonolis as it is concealed within the fruit and excessive use of pesticides leads to development of resistance among the target and non-target pests. However, there will always be a certain concern regarding the resistance development in the target pest and secondly lower use of insecticides may not be able to curtail the outbreak of the secondary pest such as mealybugs, aphids and other sucking pest species. (Nagrare et al., 2009) for which gene stacking can be an effective method to counter it. This emphasizes the need of alternative and strong Cry genes that can be used in transgenic programmes for managing the resistance development in insects.

Cry2Aa protein acquires broad insect specificity by displaying high level of definite activity against two insect orders; Lepidopteron and Diptera (Yamamoto and McLaughlin, 1981). The Cry2Aa nucleotide sequence comprises an open reading frame of 1902 bp that encodes a polypeptide of 633 amino acids. Morse et al. (2001) reported that since Cry2Aa protein is way smaller (66kDa) as compared to the Cry1 class proteins (approximately 137kDa) they exhibit higher expression hence higher level of toxicity. Cry2Aa toxins are more lethal compared to the other Cry toxins for the agriculturally important Lepidoptera and display a low level of cross-resistance in Cry1a- resistant insects (Kota et al., 1999). Moreover, to increase the transgene expression in plants for the bacterial gene, plant preferred codon optimization is a major barrier and was succeeding in tobacco, tomato and potato (Perlak et al., 1991, 1993). Hence to improve expression of the bacterial Cry2Aa gene in plants, various limiting factors like the AT content, codon composition and polyadenylation signals were optimized, and care was taken so as not to disturb the amino acid output of the Cry gene (Perlak et al., 2001). The related studies show that the growth rates, chlorophyll content, flowering or seed formation is not affected by the high expression rates of the Cry2Aa in the transgenic plants (Fearing et al., 1997).

Agrobacterium-mediated genetic transformation in brinjal cv. Pusa Hybrid 6 (male parent) was carried out using cotyledonary leaves as explants and Agrobacterium strain harboring pBinAR binary vector containing plant codon optimized Cry2Aa gene. Transformed explants were screened and regenerated efficiently with kanamycin (100mg/l) as reported earlier for leaf explants (Purushothaman et al., 2013). After transformation only 79% survived from the cotyledonary leaf explants and after two subcultures only 62% showed shoot initiation. Elongated shoots were selected on rooting medium and showed 93% rooting efficiency. Rooted plants were eventually hardened and grown on vermi culite for 15 days and were successfully established in the green house. Southern hybridization analysis, with Cry2Aa probe revealed four individual lines with single copy integration of the transgene. These lines with single copy transgene were further selected for molecular and phenotypic studies, to avoid the possibility of transgene silencing in multiple copy transgenics (Hobbs et al., 1993). ELISA analysis of the transgenic events indicated the expression of Cry2Aa. Quantitative estimation of Cry2Aa protein was carried out with an absorbance of 450 nm. The transgenic line, E4 showed the highest protein accumulation, and the protein concentrations varied between 23 to 35-ng/ml in the transformed plants. The results were concurrent with the qRT-PCR results, and collaboratively explained the high mortality rate observed for line E4.

Insect bioassay tests revealed that the larvae weight gain after 4 days feed was significantly higher on wild type as compared to the transgenic lines, further proceeding to the mortality data after 6 days, larvae fed on transformed plants exhibited highest mean mortality (100% for lines E1 and E4) as compared to the wild type plants, concluding that the larvae reared on transgenic shoot and fruit pieces did not increase in weight or starved and displayed a high mortality rate. Similar results in terms of bioassay and expression levels have been reported in case of Cry1Ac gene for BSFB resistant transgenic brinjal (Pal et al., 2009), transgenic brinjal expressing cry1Aa3 (Rai et al., 2013), CryIIIB overexpression in brinjal (Chen et al., 1995) and Cry1A(b) gene for diamondback moth (Plutella xylostella L.) resistance in Brassica oleracea L. var. capitata (Bhattacharya et al., 2002). This suggests that the Cry2Aa gene can be effectively used in development of transgenic brinjals having strong and durable resistance against brinjal shoot and fruit borer.

Conclusion

Present study shows that Cry2Aa is the potential gene with better and durable resistance against BSFB. Significant changes in larval periodic weight, weight gain, and mortality confirmed the results obtained in qRT-PCR and ELISA. Overall, these results demonstrated that Cry2Aa-mediated BSFB resistance was present in all the tested transgenic lines. Considering the extensive use of insecticides to control BSFB, host-plant resistance via Cry2Aa- transformed plants may provide a first line of defence in an integrated pest management programme. Moreover, the developed Pusa Hybrid 6 lines can be used for pyramiding other toxins, so as to delay resistance development as well to enhance toxicity to BSFB.

Acknowledgement

The authors are thankful to the Director, ICAR-NIPB for providing the necessary facilities to carry out the work.

Funding

This work was supported by ICAR-National Institute for Plant Biotechnology, New Delhi, India.

Ethical approval

The research work does not contain any studies with human participants and animals performed by any of the authors.

Data availability statement

The authors confirm that the data supporting the findings of this study are available within the article and its supplementary materials.

Statement of conflict of interest

The authors have declared no conflict of interest.

Reference

Alam, S.N., Rashid, M.A., Rouf, F.M.A., Jhala, R.C., Patel, J.R., Satpathy, S., Shivalingaswamy, T.M., Rai, S., Wahundeniya, I., Cork, A., Ammaranan, C. and Talekar, N.S., 2003. Development of an integrated pest management strategy for eggplant fruit and shoot borer in South Asia. Tech. Bull., 28: AVRDC publication No. 03-548. pp. 56.

Anil and Sharma, C.P., 2010. Bioefficacy of insecticides against Leucinodes orbonalis on brinjal. J. environ. Biol., 31: 399-402.

Arpaia, S., Chiriatti, K. and Giorio, G., 1998. Predicting the adaptation of Colorado potato beetle (Coleoptera: Chrysomelidae) to transgenic eggplants expressing CryIII toxin: The role of gene dominance, migration, and fitness costs. J. econ. Ent., 91: 21-29. https://doi.org/10.1093/jee/91.1.21

Bhattacharya, R.C., Viswakarma, N., Bhatt, S.R., Kirti, P.B. and Chopra, V.L., 2002. Development of insect-resistant transgenic cabbage plants expressing a synthetic cryIA(b) gene from Bacillus thuringiensis. Curr. Sci., 83: 146-150.

Chen, Q., Jelenkovic, G., Chin, C.K., Billings, S., Eherhardt, J., Goffreda, J.C. and Day, P., 1995. Transfer and transcriptional expression of coleopteran CryIIIB endotoxin gene of Bacillus thuringiensis in eggplant. J. Soc. Hortic. Sci., 120: 921-927. https://doi.org/10.21273/JASHS.120.6.921

Divekar, P., Kumar, P. and Suby, S.B., 2019. Screening of maize germplasm through antibiosis mechanism of resistance against Chilo partellus (Swinhoe). J. Ent. Zool. Stud., 7: 1115-1119.

Divekar, P.A., Narayana, S., Divekar, B.A., Kumar, R., Gadratagi, B.G., Ray, A., Singh, A.K., Rani, V., Singh, V., Singh, A.K., Kumar, A., Singh, R.P., Meena, R.S. and Behera, T.K., 2022. Plant secondary metabolites as defense tools against herbivores for sustainable crop protection. Int. J. mol. Sci., 23: 2690. https://doi.org/10.3390/ijms23052690

Divekar, P.A., Rani, V., Majumder, S., Karkute, S.G., Molla, K.A., Pandey, K.K., Behera, T.K. and Govindharaj, G.P.P., 2022. Protease inhibitors: An induced plant defense mechanism against herbivores. J. Pl. Growth Regul., 2022: 1-17. https://doi.org/10.1007/s00344-022-10767-2

Dukare, A., Paul, S., Mhatre, P.H. and Divekar, P.A., 2020. Biological disease control agents in organic crop production system. In: Pesticide contamination in freshwater and soil environs: Impacts, threats, and sustainable remediation (Hard ISBN: 9781771889537). Apple, https://doi.org/10.1201/9781003104957-10

Fearing, P.L., Brown, D., Vlachos, D., Meghji, M. and Privalle, L., 1997. Quantitative analysis of CryIA (b) expression in Bt maize plants, tissues, and silage and stability of expression over successive generations. Mol. Breed., 3: 169-176. https://doi.org/10.1023/A:1009611613475

Gaur, K. and Chaudhary, B., 2009. The development and regulation of Bt brinjal in India (Eggplant/Aubergine). ISAAA Brief No. 38.

Hobbs, S.L., Warkentin, T.D. and DeLong, C.M., 1993. Transgene copy number can be positively or negatively associated with transgene expression. Pl. mol. Biol., 21: 17-26. https://doi.org/10.1007/BF00039614

IHD, Indian Horticulture Database. 2018. National Horticulture Board, Ministry of Agriculture. Government of India, Gurgaon, India. pp. 148.

James, C., 2011. Global status of commercialized Biotech/GM crops - ISAAA Briefs No 43, Ithaca, NY, USA.

Kota, M., Daniell, H., Varma, S., Garczynski, S.F., Gould, F. and Moar, W.J., 1999. Overexpression of the Bacillus thuringiensis (Bt) Cry2Aa2 protein in chloroplasts confers resistance to plants against susceptible and Bt-resistant insects. Proc. natl. Acad. Sci. U.S.A., 96: 1840–1845. https://doi.org/10.1073/pnas.96.5.1840

Kumar, B.K. and Kumar, P.A., 2010. Pests and pathogens: Management strategies. BS Publication, Hyderabad.

Kumar, P.A., Mandaokar, A., Srinivasu, K., Chakraborty, S.K., Bisaria, S., Sharma, S.K., Kaur, S. and Sharma, R.P., 1998. Insect resistant transgenic brinjal plants. Mol. Breed., 4: 33e37. https://doi.org/10.1023/A:1009694016179

Livak, K.J. and Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods, 25: 402-408. https://doi.org/10.1006/meth.2001.1262

Morse, R.J., Yamamoto, T. and Stroud, R.M., 2001. Structure of Cry2Aa suggests an unexpected receptor binding epitope. Structure, 9: 409-417. https://doi.org/10.1016/S0969-2126(01)00601-3

Nagrare, V.S., Kranthi, S., Biradar, V.K., Zade, N.N., Sangode, V., Kakde, Shukla, G.R.M., Shivare, D., Khadi, B.M., and Kranthi, K.R., 2009. Widespread infestation of the exotic mealybug species, Phenacoccus solenopsis (Tinsley) (Hemiptera: Pseudococcidae), on cotton in India. Bull. entomol. Res., 99: 537-541. https://doi.org/10.1017/S0007485308006573

Pal, J.K., Singh, M., Rai, M., Satpathy, S., Singh, D.V. and Kumar, S., 2009. Development and bioassay of Cry1Ac-transgenic eggplant (Solanam melongena L.) resistant to shoot and fruit borer. J. Hortic. Sci. Biotechnol., 84: 434–438. https://doi.org/10.1080/14620316.2009.11512545

Patnaik, H.P., 2000. Flower and fruit infestation by brinjal shoot and fruit borer, Leucinodes orbonalis Guen damage potential vs. weather. Veg. Sci., 27: 82-83.

Perlak, F.J., Oppenhuizen, M., Gustafson, K., Voth, R., Sivasupramaniam, S., Heering, D., Carey, B., Ihrig, R.A. and Roberts, J.K., 2001. Development and commercial use of Bollgard® cotton in the USA–early promises versus today’s reality. Pl. J., 27: 489-501. https://doi.org/10.1046/j.1365-313X.2001.01120.x

Perlak, F.J., Roy, L.F., Duff, A.D., Sylria, L., McPherson and Fischoff, D.A., 1991. Modification of the coding sequences enhances plant expression of insect control protein genes. Proc. natl. Acad. Sci. U.S.A., 88: 3324-3328. https://doi.org/10.1073/pnas.88.8.3324

Perlak, F.J., Stone, T.B., Muskopf, Y.M., Peterson, L.J., Parker, G.B., McPherson, S.A., Wyman, J., Love, S., Reed, G., Blever, D. and Fischoff, D.A., 1993. Genetically improved potatoes: Protection from damage by Colorado potato beetles. Pl. mol. Biol., 22: 313-321. https://doi.org/10.1007/BF00014938

Purushothaman, G., Sudhkar, D. and Jothieswari, M., 2013. Engineering insect resistance in brinjal against fruit and shoot borer Leucinodes orbonalis. Int. J. Adv. Res. Technol., 6: 206-217.

Rai, N.P., Rai, G.K., Kumar, S., Kumari, N. and Singh, M., 2013. Shoot and fruit borer resistant transgenic eggplant (Solanum melongena L.) expressing cry1Aa3 gene: Development and bioassay. Crop Prot., 53: 37-45. https://doi.org/10.1016/j.cropro.2013.06.005

Sanyal, I., Singh, A.K., Kaushik, M. and Amla, D.V., 2005. Agrobacterium-mediated transformation of chickpea (Cicer arietinum L.) with Bacillus thuringiensis cry1Ac gene for resistance against pod borer insect Helicoverpa armigera. Pl. Sci., 168: 1135-1146. https://doi.org/10.1016/j.plantsci.2004.12.015

Shelton, A.M., Sarwer, S.H., Hossain, M.J., Brookes, G. and Paranjape, V., 2020. Impact of Bt brinjal cultivation in the market value chain in five districts of Bangladesh. Front. Bioengin. Biotechnol., 498. https://doi.org/10.3389/fbioe.2020.00498

Subbarathnam, G.V. and Butani, D.K.,1982. Chemical control of insect pest complex of brinjal. Entomology, 7: 97-100.

Yamamoto, T. and McLaughlin, R.E., 1981. Isolation of a protein from the parasporal crystal of Bacillus thuringiensis var. kurstaki toxic to the mosquito larva, Aedes taeniorhynchus. Biochem. biophys. Res. Commun., 103: 414-421. https://doi.org/10.1016/0006-291X(81)90468-X