Determination of Antibiotic Resistance Pattern and Molecular Characterization of Corynebacterium pseudotuberculosis from Lymph Node Samples of Sheep and Goats in Ethiopia
Getaw Yeshitila1*, Huban Gocmen2 and Hazel Tamakan Yesilovali1
1Department of Microbiology, Faculty of Veterinary Medicine, Near East University, Nicosia, 99138, Northern Cyprus, Mersin-10, Turkiye
2Department of Microbiology, Faculty of Veterinary Medicine, Tekirdag Namik Kemal University, PC:59030, Tekirdag, Turkiye
ABSTRACT
Corynebacterium pseudotuberculosis consists of non-motile and pleomorphic rods. The frequent rout of entry of C. pseudotuberculosis into the body of animal is in punctures and scratches of the skin. It results in the development of caseous abscesses in external and internal lymph nodes. Therefore, the following were the objectives of this research: to identify and isolate bacteriologically, to characterize molecularly C. pseudotuberculosis from the external nodes of lymph of sheep and goats, and to determine multiple drug resistance of C. pseudotuberculosis in sheep and goats in Halal Food Industries, Modjo, Ethiopia. A total of 450 animals (100 sheep and 350 goats) were examined during antemortem and postmortem inspections. Bacteriological isolation and identification of the collected lymph nodes were performed and then confirmed by PCR. Then, the antibiotic resistance profile was revealed. Seven (17.7%) of goat isolates from Oromia, 5 (12.5%) from Southern Nations, nationalities and peoples regional states and 4 (10%) sheep isolates from Oromia were evaluated as positive for C. pseudotuberculosis in molecular diagnosis. C. pseudotuberculosis was moderately susceptible to gentamicin (68.75%) and highly susceptible to penicillin G (100%), doxycycline (100%), and ciprofloxacin (100%) had been observed. In conclusion, risk associated factors and seroepidemiology of caseous lymphadenitis in sheep and goats should be investigated in Ethiopia.
Article Information
Received 24 January 2023
Revised 25 April 2023
Accepted 17 May 2023
Available online 31 August 2023
(early access)
Published 26 July 2024
Authors’ Contribution
GY and HG designed the study. GY conducted the experiment. GY, HG and HT wrote the manuscript.
Key words
Antibiotic resistance, Caseous lymphadenitis, Corynebacterium pseudotuberculosis, Lymph node, PCR
DOI: https://dx.doi.org/10.17582/journal.pjz/20230124090155
* Corresponding author: [email protected]
0030-9923/2024/0005-2255 $ 9.00/0
Copyright 2024 by the authors. Licensee Zoological Society of Pakistan.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
INTRODUCTION
In Ethiopia, about 42.9 million sheep and 52.5 million goats are estimated to be found. Among these, around 9.7 million sheep and 8.4 million goats are believed to be constituted by Oromia regional state where as 4.5 million sheep and 5.5 million goats by Southern, Nations, Nationalities and Peoples regional state (CSA, 2021). The national economy of Ethiopia and the livelihoods of many Ethiopians both greatly depend on the livestock subsector. It contributes roughly 35.6% of the country’s agricultural GDP and 16.5% of the overall GDP. Additionally, it produces 15% of export revenue and 30% of agricultural employment. 80% of the rural population’s livelihoods are currently supported and sustained by it. Among livestock, sheep and goats are economically important (Leta and Mesele, 2014).
Caseous lymphadenitis (CLA), a disease that affects sheep and goats, is widespread. CLA is caused by Corynebacterium pseudotuberculosis. CLA in sheep and goats shows clinical signs of abscess formation in the external lymph nodes at different sites and with variable sizes of either closed and opened which discharges whitish milky to creamy caseated pus. In some cases, alopecia over the lesion can be seen. Some infected sheep and goats show progressive emaciation and loss of appetite are observed (Al-Gaabary et al., 2009).
In vitro testing has shown that C. pseudotuberculosis is susceptible to numerous antibiotic compounds. Inhibition of C. pseudotuberculosis isolates growth and multiplication have been shown by the most commonly used antibiotic classes. Clinical CLA, however, typically resists antibiotic treatment. This is most likely caused by the caseous nature of the pus contained within lesions and the thick encapsulation around them. In addition, C. pseudotuberculosis is somewhat protected against several regularly used antibiotics due to the organism’s intracellular presence during some of the disease cycle (Baird and Fontaine, 2007).
Treatment in sheep and goats affected by CLA consists of draining the abscesses and surgical removal of the affected external lymph nodes followed by cleansing and chemical cauterization, usually with 10% iodine. Due to the presence of internal abscesses this procedure might not be as effective as expected in the case of CLA disease even though it is a crucial treatment measure (Saeed and Alharbi, 2014)
Applying vaccination against CLA, which slows the spread of diseases, is the main method of CLA disease control in a number of nations. Despite this, there is currently no proprietary CLA vaccine that provides complete protection against C. pseudotuberculosis infection. As a result, the disease will continue to develop, but at a lower intensity. Through the culling/segregation of affected animals, the serological diagnosis offers a potent alternative to vaccination for disease prevention. This method is used to totally remove CLA from infected flocks, but because to its possible expense, it is not widely employed. It may only be useful in flocks where the disease does not occur frequently because the majority of farmers would not be prepared to give up the majority of their animals (Fontaine and Baird, 2008).
Sheep and goats in Ethiopia are affected by different diseases which hinder the economic benefit the country gains. Abscess forming diseases are more common post mortem findings in abattoirs which result in organ and carcass condemnation. There was insufficient study done on molecular characterization, assessment of molecular prevalence, and the significance of C. pseudotuberculosis as a cause of CLA in sheep and goats in Ethiopia, aside from the studies carried out to establish baseline data. Therefore, the purpose of this study is to characterize C. pseudotuberculosis from sheep and goat external lymph nodes bacteriologically and molecularly, as well as to identify antibiotic resistance profile of C. pseudotuberculosis in sheep and goats in Halal Food Industries, Modjo, Ethiopia.
MATERIALS AND METHODS
Study animals
The investigation was conducted on sheep and goats that were slaughtered at Halal Food Industries plc’s export abattoir. In Ethiopia’s Oromia Regional State’s Eastern Shewa Administrative Zone, Modjo town, Lume District, is home to the abattoir. At an elevation of 1777 meters above sea level, Modjo Town is situated at 8o35’ N and 39o10’ E, 70 kilometres to the southeast of Addis Abeba. The animals originated in low-lying pastoral regions of the nation, specifically in the Southern Nations, Nationalities, and Peoples and Oromia regional states. Female animals are not slaughtered because of their production importance. Therefore, adult male sheep and goats were the only species that were slaughtered at the abattoir. The sheep and goats were raised in extensive farming systems, and when they were ready for slaughter, the sheep and goats were purchased and transported by merchants and sent to the abattoir.
This study used a cross-sectional study design on sheep and goats that were brought to the slaughterhouse for slaughter and appeared to be in good health. Systematic random sampling was applied during sampling in the abattoir line. Detail post mortem inspection of systematic random sampled lymph nodes and carcass were carried out by palpation, visualization, and incision immediately after the animals were slaughtered.
Sample size and sampling
Total of 450 animals (100 sheep and 350 goats) were examined during antemortem and postmortem inspections. Of 100 sheep from Oromia Regional state and 350 goats (200 goats from Oromia and 150 goats from Southern Nations, Nationalities and Peoples regional states (SNNPR)) were examined. During post mortem inspection at the slaughter line, the presence of gross abnormalities of lymph nodes were examined. Lymph nodes with swelling, enlargement and inflammation were cut, detached, and intact lymph nodes were transferred to sterile bottle and transported under the cold chain to National Veterinary Institute of Ethiopia.
Bacteriological isolation and identification
In the laboratory, swabs were taken aseptically while the collected lymph nodes were excised. The swabs were inoculated on 7% sheep blood agar (Biomerieux, 43041) for 72h at 37oC. After incubation and suspected colonies were stained by Gram staining (Biomerieux, 55542) and tested on reverse CAMP (with Staphylococcus aureus), catalase (Biomerieux, 55561), urease (Liofilchem, 30081) and sugar fermentation tests (TSI agar, Oxoid, CM0277) C. pseudotuberculosis is also identified different biochemical tests (Oreiby, 2015).
Molecular detection
A few pure colonies were put into eppendorf tubes
Table I. The oligonucleotides used in this study.
|
Target gene |
Sequence (5′→3′) |
Length of PCR products |
Source/ reference |
|
Putative oligopeptide/ dipeptide ABC transporter |
F CCTTACCGAGACAACGTCAT |
285bp |
(D’Afonseca et al., 2010) |
|
R GCCTGGTGCTTATCATTGAT |
|||
|
NADP oxido_reductase coenzyme F420dependent |
F CTGCGACATAGCTAGGCACT |
382bp |
|
|
R CCGCCAGACTTTTCTCTACA |
|||
|
Proline iminopeptidase |
F AACTGCGGCTTTCTTTATTC |
551bp |
|
|
R GACAAGTGGGAACGGTATCT |
from the isolated on blood agar plates. According to the manufacturer’s instructions, the bacterial genomic DNA was extracted using the QIAGEN DNeasy blood and tissue kit (Qiagen, 69504). The DNA was kept at -20°C until usage and its purity were verified using 0.8% agarose gel electrophoresis.
Proline iminopeptidase (551 bp), putative oligopeptide/dipeptide ABC transporter (285bp), and oxidoreductase coenzyme F4200-dependent gene (382bp) were the three most conserved genes of C. pseudotuberculosis that the researchers synthesized and used for PCR amplification (D’Afonseca et al., 2010) (Table I). Table I lists the forward and reverse oligonucleotide primer sequences for amplification of these genes, as well as their product sizes. In three independent thermocyclers, PCR was conducted in a final volume of 25 μl of reaction mixture consisting of 1X PCR buffer, 2 mM MgCl2, 200 µM dNTPs mix, 0.2 mM of each forward and reverse primer, 1.25 units of Taq DNA polymerase, and 5l of DNA template. A total of 35 cycles of denaturation at 94 °C for 30 sec, annealing at 54°C for 45 sec, extension at 72°C for 45 sec, and final extension at 72°C for 5 min were utilized in each PCR condition used to amplify each of the three gene fragments.
The amplicons were separated on a 2% (wt/vol) agarose gel, stained with ethidium bromide, and visualized using UV light and photographed. A positive control was provided by the department of Microbiology, National Veterinary Institute of Federal Democratic Republic of Ethiopia.
Antimicrobial susceptibility testing
To determine antibiotic resistance C. pseudotuberculosis, four different antibiotic classes or drug categories (Beta-lactams, Tetracyclines, Aminoglycosides and Fluoroquinolones) were selected. Accordingly; Penicillin G (10IU), Doxycline (30µg), Gentamicin (10µg) and Ciprofloxacin (5µg) were selected from each antibiotic classes (Algammal, 2016). Kirby Bauer Disk Diffusion technique according to Clinical Laboratory Standards Institute (CLSI) was used to carry out antibiotic resistance test (CLSI, 2018). Growth inhibition zones were measured in millimeters and classified as resistant, moderate, or susceptible based on their sizes. Since specific guidelines for testing of C. pseudotuberculosis has not been published, Clinical and Laboratory Standards Institute (CLSI) breakpoints adapted from (Quinn et al., 2004).
Statistical analyses
The data in the tables were compared using statistical tests. The analyses were performed using IBM SPSS Statistics. Statistics were considered significant for P values under 0.05.
RESULTS
From 450 samples (100 sheep and 350 goats) collected from animals, suspicious lesions of CLA were observed in a total of 40 animals (8.9 %). Of these, 9 (2 %) were in sheep and 31 (6.9 %) were in goats. Of the goats 18 (4 %) were in Oromia and 13 (2.9 %) were in Southern Nations, Nationalities and Peoples regional states (Table II).
Table II. Relative prevalence of caseous lymphadenitis (CLA) in slaughtered sheep and goats in post mortem inspection findings.
|
Origin of animals |
Number of examined |
Proportion of affected caseous lymphadenitis No (%) |
||
|
Goat |
Sheep |
Goat |
Sheep |
|
|
Oromia region |
200 |
100 |
18(4) |
9(2) |
|
SNNPR |
150 |
- |
13(2.9) |
- |
|
Total |
450 |
40 (8.9) |
||
Among the animals which were postmortem examined, suspected lesions of CLA were observed in only two different types of lymph nodes in this study. Forty suspected CLA lesions were observed in 35 prescapular (7.8%) and 5 prefemoral lymph nodes (1.1%) (Table III).
Table III. Relative prevalence of caseous lymphadenitis in sheep and goats in external lymph nodes.
|
Origin of animals |
Proportion of affected lymph nodes No. (%) |
|||
|
Prescapular |
Prefemoral |
|||
|
Goat |
Sheep |
Goat |
Sheep |
|
|
Oromia region |
15(3.4) |
9(2) |
3(0.7) |
- |
|
SNNPR |
11(2.4) |
- |
2(0.4) |
- |
|
Total |
35(7.8) |
5(1.1) |
||
Table IV. Relative prevalence of caseous lymphadenitis in slaughtered sheep and goats in bacteriological isolation and identification and PCR results.
|
Origin of animals |
Bacteriological isolation and identification results No. (%) |
Molecular characterization (PCR results) No, % |
||
|
Goat |
Sheep |
Goat |
Sheep |
|
|
Oromia region |
7(17.5) |
4(10) |
7(17.7) |
4(10) |
|
SNNPR |
5(12.5) |
- |
5(12.5) |
- |
|
Total |
16(40) |
16(40) |
||
A total of 16 colonies (40%) suspected to be C. pseudotuberculosis were isolated from 40 CLA suspected lesion samples in bacteriological isolation and identification, providing a total prevalence of 3.6% among the total number of animals examined in post mortem. Around 11 isolates (27.5%) were isolated from prescapular and 5 isolates (12.5%) from prefemoral lymph nodes (Table IV). Of total 100 sheep, bacterial growth was observed in 4 (10%) samples and identified as C. pseudotuberculosis then isolates were confirmed to be positive in the PCR. Of total 350 goats, bacterial growth was observed in 12 samples (30%) (7 samples (17.5%) from Oromia and 5 samples (12.5%) from SNNPRS) and identified as C. pseudotuberculosis then isolates were positive in the PCR (Table IV). Amplifications of 285, 382 and 551 bp fragments were produced for each of the 16 isolates using the C. pseudotuberculosis-specific PCR to identify the isolates (Figs. 1, 2 and 3).
All the 16 C. pseudotuberculosis isolates all of which were positive to PCR were tested for susceptibility to 4 antibiotics that were selected from 4 drug classes or categories. As shown in Table V, the antibiotic sensitivity test revealed that most of the examined isolates of C. pseudotuberculosis were highly susceptible to penicillin G (100%), doxycycline (100%), ciprofloxacin (100%), and moderately susceptible to gentamicin (68.75%) had been observed (Table V).
Table V. The resistance pattern of C. pseudotuberculosis isolates to antimicrobial agents from their respective drug families.
|
Drug classes |
Antimicrobials |
Susceptibility pattern of C. pseudotuberculosis, No. (%) |
||
|
Resistant |
Intermediate |
Susceptible |
||
|
B-lactams |
Penicillin G |
- |
- |
16(100) |
|
Tetracyclins |
Doxycycline |
- |
- |
16(100) |
|
Fluoroquinolones |
Ciprofloxacin |
- |
- |
16(100) |
|
Aminoglycosides |
Gentamicin |
5(31.25) |
- |
11(68.75) |
DISCUSSION
The present study had revealed 8.9% lesions suspicious of CLA among postmortem examined animals in which sheep (9%) and goats (8.9%) ((goats (9 %) Oromia and goats (8.7%) Southern Nations, Nationalities and Peoples regional states) and these suspicious lesions of CLA had been observed in prescapular (7.8%) and prefemoral (1.1%) lymph nodes. The previous study conducted in Ethiopia had found 10.67% abscesses or CLA in which, like the current study identified, prescapular (5.54%) and prefemoral lymph nodes (3.91%) in goats were the most frequent sites of abscesses (Abebe and Tessema, 2015). In a study conducted at the Tanta abattoir in Egypt to determine some epidemiological and histological aspects related to CLA on slaughtered animals (sheep and goats), CLA was found to be present in 26.92% of the animals, with prevalence rates of 33.23% and 10.74% for sheep and 10.74% for goats, respectively (Al-Gaabary et al., 2010). On the basis of a clinical examination, a different study carried out in Egypt to evaluate some epidemiological, clinical, and preventive strategies related to CLA reported a prevalence of 19.23% (Al-Gaabary et al., 2009). Study in Tabrith had revealed 42.09% cases were suspected to have CLA with signs of prominent enlargement in one of the lymph nodes (Zavoshti et al., 2012).
In bacteriological isolation, C. pseudotuberculosis growth was observed in giving an overall prevalence of 7% and all the isolates were confirmed to be positive in the PCR, providing a total prevalence of 7% in sheep. In the same fashion in goats, bacteriological isolation results had shown growth of C. pseudotuberculosis providing a total prevalence of 3.4% (3.5% in Oromia and 3.3% SNNPRS) and the whole isolates subjected to PCR were positive providing a total prevalence of 3.4% (3.5% in Oromia and 3.3% SNNPRS) with a total prevalence of 3.4% in goats. From the processed samples only 72% (59/82) C. pseudotuberculosis isolates were recovered in bacteriological isolation with a total prevalence of 7.68% in previously carried out study in Ethiopia which was relatively a little higher than this study revealed (Abebe and Tessema, 2015). According to Al-Gaabary et al. (2010), who discovered prevalence rates higher than those found in the present study 32.65% and 5.55% in sheep and goats, respectively on the basis of bacteriological investigation, the overall prevalence was 25.05%. According to a bacteriological study, there was a 17.32% overall prevalence, with 22.10% in sheep and 7.77% in goats (Al-Gaabary et al., 2009). C. pseudotuberculosis isolates were identified with the frequency of 11.3% in sheep in Kosovo (Robaj et al., 2017). The frequency of CLA based on bacteriological culture was 12.60% was revealed (Zavoshti et al., 2012). The isolation rate of 39.22% C. pseudotuberculosis in abscess of goats was reported for the first time in southwestern China (Li et al., 2018). C. pseudotuberculosis was isolated from 55.1% of abscessed lymph nodes of sheep in Turkey (Ilhan, 2013). In contrast to the current study, the Dakahlia governorate in Egypt reported an isolation rate of 1.7% C. pseudotuberculosis in sheep abscess (Ahmed et al., 2021). Studying the morphological, cultural, and biochemical traits of Sirohi breed goats on a managed farm in Rajasthan, India’s semi-arid tropical region, revealed 2.4% C. pseudotuberculosis (Kumar et al., 2012). On the basis of physical, cultural, and biochemical traits, the same research was done on sheep. In Rajasthan, India’s semi-arid tropical region, 1.1% of bacterial isolates from abscesses were C. pseudotuberculosis, which was lower than the prevalence found in the current investigation, which was conducted in extensive (pastorals). The management system may be the cause of this discrepancy.
A PCR assay targeting the putative oligopeptide-dipeptide ABC transporter, nicotinamide adenine dinucleotide phosphate, oxidoreductase coenzyme F420, and proline iminopeptidase genes of C. pseudotuberculosis was developed and revealed 14 abscess samples as positive with an overall prevalence of 1.29% (Kumar et al., 2013). This study found lower prevalence than the current study, which may be related to the management strategy previously mentioned. Another investigation that confirmed all 14 bacterial isolates with an overall incidence of 2.4% used a PCR assay targeting the proline iminopeptidase gene unique to C. pseudotuberculosis (Kumar et al., 2012).
In this study, the antibiotic sensitivity test revealed that, most of the examined isolates of C. pseudotuberculosis were highly susceptible to penicillin G (100%), doxycycline (100%), ciprofloxacillin (100%), and moderately susceptible to gentamycin (68.75%). The previous study conducted in Ethiopia by Abebe and Tessema (2015) confirmed that C. pseudotuberculosis isolates were susceptible to doxycycline. Contrary to the present study, C. pseudotuberculosis isolates showed resistance to penicillin and they were highly sensitive to ciprofloxacin (Algammal, 2016) similar to the present study. Similar to the present study by (Robaj et al., 2017) revealed that C. pseudotuberculosis isolates were highly susceptible to gentamicin.
CONCLUSIONS
By this research, for the first time in Ethiopia, C. pseudotuberculosis was identified with PCR assay targeting three conserved genes specifically, nicotinamide adenine dinucleotide phosphate oxidoreductase coenzyme F420-dependent, proline iminopeptidase and Putative oligopeptide/-dipeptide ABC transporter. No multiple drug resistance C. pseudotuberculosis isolates were observed. This research concludes that risk associated factors and seroepidemiology of caseous lymphadenitis in sheep and goats should be investigated.
ACKNOWLEDGEMENTS
This study is doctorate thesis publication of Res. Assist. PhD. student Getaw Yesithila. I gratefully thank Ministry of Education, Federal Democratic Republic of Ethiopia and Near East University for their help.
Funding
This study received no funding.
IRB approval and ethical statement
Not applicable
Statement of conflict of interest
The authors have declared no conflict of interest.
REFERENCES
Abebe, D. and Tessema, S.T., 2015. Determination of Corynebacterium pseudotuberculosis prevalence and antimicrobial susceptibility pattern of isolates from lymph nodes of sheep and goats at an organic export abattoir, Modjo, Ethiopia. Lett. appl. Microbiol., 61: 469–476. https://doi.org/10.1111/lam.12482
Ahmed, M.S., Magdy, A.S., Gedawy, E., Abdullah, A. and Elsayed, Y.E., 2021. Epidemiological , bacteriological and molecular studies on caseous lymphadenitis in sheep of. Anim. Biotechnol., 0: 1–6.
Al-Gaabary, M.H., Osman, S.A., Ahmed, M.S. and Oreiby, A.F., 2010. Abattoir survey on caseous lymphadenitis in sheep and goats in Tanta, Egypt. Small Rumin. Res., 94: 117–124. https://doi.org/10.1016/j.smallrumres.2010.07.011
Al-Gaabary, M.H., Osman, S.A. and Oreiby, A.F., 2009. Caseous lymphadenitis in sheep and goats: Clinical, epidemiological and preventive studies. Small Rumin. Res., 87: 116–121. https://doi.org/10.1016/j.smallrumres.2009.10.008
Algammal, A., 2016. Molecular characterization and antibiotic susceptibility of Corynebacterium pseudotuberculosis isolated from sheep and goats suffering from caseous lymphadenitis. Zagazig Vet. J., 44: 1–8. https://doi.org/10.21608/zvjz.2016.7826
Baird, G.J. and Fontaine, M.C., 2007. Corynebacterium pseudotuberculosis and its role in ovine caseous lymphadenitis. J. comp. Pathol., 137: 179–210. https://doi.org/10.1016/j.jcpa.2007.07.002
CLSI, 2018. Performance standards for antimicrobial susceptibility testing; twenty eight informational supplement. Clinical Laboratory, Wayne, PA, USA.
CSA (Central Statistical Authority), 2021. Ethiopian agricultural sample survey. Vol II. Report on livestock and livestock characteristics. Statistical Bulletin, 589. CSA, Addis Ababa, Ethiopia.
D’Afonseca, V., Prosdocimi, F., Dorella, F.A., Pacheco, L.G.C., Moraes, P.M., Pena, I. and Azevedo, V., 2010. Survey of genome organization and gene content of Corynebacterium pseudotuberculosis. Microbiol. Res., 165: 312–320. https://doi.org/10.1016/j.micres.2009.05.009
Fontaine, M.C. and Baird, G.J., 2008. Caseous lymphadenitis. Small Rumin. Res., 76: 42–48. https://doi.org/10.1016/j.smallrumres.2007.12.025
Ilhan, Z., 2013. Detection of Corynebacterium pseudotuberculosis from sheep lymph nodes by PCR, pp. 60–66.
Kumar, J. and Tripathi, B.N., 2013. Rapid detection of Corynebacterium pseudotuberculosis in clinical samples fromF sheep. https://doi.org/10.1007/s11250-013-0381-8
Kumar, J., Singh, F., Tripathi, B.N., Kumar, R., Dixit, S.K. and Sonawane, G.G., 2012. Epidemiological, bacteriological and molecular studies on caseous lymphadenitis in Sirohi goats of Rajasthan, India. Trop. Anim. Hlth. Prod., 44: 1319–1322. https://doi.org/10.1007/s11250-012-0102-8
Kumar, J., Tripathi, B.N., Kumar, R., Sonawane, G.G. and Dixit, S.K., 2013. Rapid detection of Corynebacterium pseudotuberculosis in clinical samples from sheep. Trop. Anim. Hlth. Prod., 45: 1429–1435. https://doi.org/10.1007/s11250-013-0381-8
Leta, S. and Mesele, F., 2014. Spatial analysis of cattle and shoat population in Ethiopia: Growth trend, distribution and market access. Springer Plus, 3: 1–10. https://doi.org/10.1186/2193-1801-3-310
Li, H., Yang, H., Zhou, Z., Li, X., Yi, W., Xu, Y. and Hu, S., 2018. Isolation, antibiotic resistance, virulence traits and phylogenetic analysis of Corynebacterium pseudotuberculosis from goats in southwestern China. Small Rumin. Res., 168: 69–75. https://doi.org/10.1016/j.smallrumres.2018.09.015
Oreiby, A.F., 2015. Diagnosis of caseous lymphadenitis in sheep and goat. Small Rumin. Res., 123: 160–166. https://doi.org/10.1016/j.smallrumres.2014.11.013
Quinn, P.J., Carter, M.E., Markey, B. and Carter, G.R., 2004. Clinical veterinary microbiology (6th ed.). Elsevier, USA.
Robaj, A., Hamidi, A., Bytyqi, H. and Sylejmani, D., 2017. Frequency and antimicrobial susceptibility of bacterial isolates from caseous lymphadenitis in sheep in Kosovo. Bulgar. J. agric. Sci., 23: 1033–1036.
Saeed, E. and Alharbi, K., 2014. Morel’s disease and caseous lymphadenitis: A literature review with special reference to Saudi Arabia. IOSR J. agric. vet. Sci., 7: 76–86. https://doi.org/10.9790/2380-07537686
Zavoshti, F.R., Khoojine, A.B.S., Helan, J.A., Hassanzadeh, B. and Heydari, A.A., 2012. Frequency of caseous lymphadenitis (CLA) in sheep slaughtered in an abattoir in Tabriz: Comparison of bacterial culture and pathological study. Comp. Clin. Pathol., 21: 667–671. https://doi.org/10.1007/s00580-010-1154-7