Special Issue
Veterinary Medicine between Sustainable Development and Public Health to Confront Global Changes
Control of Vibrio spp. in Commercially Sold Fish Using Bioactive Natural Antimicrobials
Sohaila Fathi El-Hawary1, Nermeen M.L. Malak2, Reda A. Gomaa3, Hesham Z. Tawfeuk3, Suzan Ismail4, Nady Khairy Elbarbary5*
1Biology Department, Collage of Science, Jazan University, P.O. Box 114, Jazan 45142, Kingdom of Saudi Arabia; 2Food Hygiene and Control Department, Faculty of Veterinary Medicine, Cairo University, Cairo, 12211, Giza, Egypt; 3Food Science and Technology Department, Faculty of Agriculture and Natural Resources, Aswan University, Aswan 81528, Egypt; 4Microbiology Department, Animal Health Research Institute (AHRI), Aswan Branch, Agriculture Research Center (ARC), 44516, Giza, Egypt; 5Food Hygiene and Control Department, Faculty of Veterinary Medicine, Aswan University, Aswan 81528, Egypt.
Abstract | Vibrio species are significant pathogenic bacteria found in fish that induce gastroenteritis, a major public health issue. The present research investigated the occurrence, virulence gene detection, antibiotic resistance profile, and the antibacterial influence of lemon juice and pomegranate peel extract on V. cholerae and V. parahaemolyticus. Samples were 150 fish (30 of each Nile tilapia, Nile perch, sardine, Mugil cephalus, and Sea bass) from fish supermarkets. Sardine samples had the highest Vibrio count (4.77±1.22 log10 CFU/g), followed by and Sea bass (4.62±1.35 log10 CFU/g), Mugil cephalus (3.50±1.74 log10 CFU/g), Nile perch (3.24±1.05 log10 CFU/g), while Nile tilapia had the lowest count (2.90±0.78 log10 CFU/g), and 42% of all fish tested positive for Vibrio species. The most prevalent isolated Vibrio species were V. cholerae (38.2%), V. parahaemolyticus (31.7%), V. vulnificus (19%), and V. fluvialis (11.1%). According to a polymerase chain reaction analysis, most Vibrio isolates had one or more virulence genes. Antibiotic sensitivity tests showed that the isolates were highly resistant to many commonly used antimicrobial drugs in Egypt. These drugs included ampicillin, tetracycline, and sulfamethoxazole. The average MAR score was 0.530 indicating that the isolates have acquired a hereditary resistance that poses a public health hazard to customers. Moreover, the marinate with 5% lemon juice (LJ) and 3% pomegranate peel (PPE) extract had a positive impact on the diminution of V. cholerae and V. parahaemolyticus counts during the storage period by 48.47% and 37.3% for the LJ solution and by 41.51 and 40.13% for the PPE. It exhibited the most significant improvement in sensual characteristics. As a result, there is a need to authorize hygienic measures to regulate fish contamination in aquatic environments and markets. Additionally, marinating with natural components in food is a common approach to control Vibrio spp. with the primary objective of safe consumer health.
Keywords | Vibrio, Fish, PCR, Virulence gene, Natural Antimicrobials
Received | June 06, 2024; Accepted | July 03, 2024; Published | August 15, 2024
*Correspondence | Nady Khairy Elbarbary, Control of Vibrio spp. in commercially sold fish using bioactive natural antimicrobials; Email: [email protected]
Citation | El-Hawary SF, Malak NML, Gomaa RA, Tawfeuk HZ, Ismail S, Elbarbary NK (2024). Control of Vibrio spp. in commercially sold fish using bioactive natural antimicrobials. Adv. Anim. Vet. Sci. 12(special issue 1): 1-13.
DOI | https://dx.doi.org/10.17582/journal.aavs/2024/12.s1.1.13
ISSN (Online) | 2307-8316; ISSN (Print) | 2309-3331
Copyright: 2024 by the authors. Licensee ResearchersLinks Ltd, England, UK.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
INTRODUCTION
Fish is an abundant source of crucial nutrients, such as high-quality protein, fatty acids, phosphates, calcium, and a variety of vitamins (Elbarbary et al., 2024). Despite having a nutrient-dense diet, fish are implicated in the development of numerous foodborne illnesses. Vibrio species are among the most prevalent foodborne bacteria (Trinanes and Martinez-Urtaza, 2021). The existence and spreading of Vibrio spp. are seasonal and temperature reliant. Presently, vibriosis has a worldwide dispersal, in tropical as well as temperate areas (Tilusha et al., 2022). They are natively found in estuarine, marine and freshwater settings around the world, often alongside aquatic creatures. V. parahaemolyticus, V. cholerae, and V. vulnificus are the most significant Vibrio species that are related to the ingesting of under cooked fish (Morshdy et al., 2022). V. cholerae is the causative of cholera, which is transmitted to humans through the ingestion of improperly cooked fish and is characterized by abdominal cramps, nausea, vomiting, and massive acute diarrhoea (Tang et al., 2018). V. parahaemolyticus ranks is one of the most common sources of fish-related diarrhoea in several regions (Fri et al., 2017). Conversely, V. vulnificus can result in severe and fatal infections, including gastroenteritis, skin and soft tissue infections, and primary sepsis, which may lead to necrotizing fasciitis and mortality (Dutta et al., 2021). V. fluvialis has been classified as an “emerging” disease due to a rise in cholera-like diarrheal outbursts and extra-intestinal infections (Ramamurthy et al., 2014).
In addition, virulence is recognized as the capability of microbes to attack a host cell to induce illness, and most bacteria require a variety of virulence factors to prompt infection (Mavhungu et al., 2023). The pathogenicity of Vibrio strains is assisted by a broad variety of virulence issues encoded by virulence genes. In overall, virulence agents permit pathogens to infect and impairment the host, by allowing pathogenic adherence and entrance, creation and growth, prevention of host defenses, destruction to the host, and lastly exodus from the infected host. Five major virulence factors are occur in vibrio: capsular polysaccharides, adhesive factors, cytotoxins, lipopolysaccharides, and flagella (Deng et al., 2020).
Furthermore, Antibacterials are mostly utilized in fish farms to prevent infections, stop them from spreading, and encourage development. This increases the resistance of Vibrio species to various antibacterial and may have an impact on public health because consumers may consume resistant genes or bacteria through food (Binh et al., 2018). Furthermore, the inhibiting effect of certain organic acids on Vibrio species is the reason they are employed to control bacterial infection and deploy fish-borne microorganisms throughout food manufacture and handling. Lemon juice (LJ) and pomegranate peel extract (PPE) are regarded as natural meat preservatives because of their antioxidant and antibacterial properties (Elbarbary and Abdelmotilib, 2023).
Therefore, the current research pointed to examining the occurrence, virulence gene determination, and antimicrobial profile of Vibrio in marketed fish samples at Aswan Governorates, Egypt, in light of the risk of bacterial pathogens in fish and their importance to human health. The antibacterial activity of lemon juice and pomegranate peel extracts against V. cholerae and V. parahaemolyticus was also studied.
MATERIALS AND METHODs
Ethical Approval
The Scientific Research Committee and Bioethics Board of Aswan University, Faculty of Veterinary Medicine (5/2024), reviewed and approved the protocols used for this study which follow the Canadian Council on Animal Care guidelines (CCAC, 2005).
Samples Collection and Preparation
Approximately 150 commercial fresh fish samples (30 each of Nile tilapia, Nile perch, Sardine, Mugil cephalus, and Sea bass) weighting of 200-240 g were obtained from several supermarkets at Aswan City, Egypt, during January and February 2024. Under a septic condition, the scales, head, fins, tails, and bones of the fish were removed using a sterile stainless-steel knife after the fish was eviscerated. The two back fillets were stored in the refrigerator at 4°C for bacteriological analysis at the Meat Hygiene Laboratory, Department of Food Hygiene, Faculty of Veterinary Medicine, Aswan University. All samples were transported in an icebox container.
Vibrio Count Determination
Approximately 25g of fish muscle was standardized in 225mL of sterile alkaline peptone water (APW, Micro Master - India) for 24 h at 37°C incubation. One ml was conveyed to a single tube with 9 ml of peptone water (0.1%), from which a tenfold sequential dilution was set (Elbarbary et al., 2023). Duplicate sterile Petri plates of thiosulfate citrate bile salts sucrose agar media (GM189, HiMedia) at 37°C for 24 h of incubation with one ml of each serial dilution. The number of green or blue-green colonies on plates ranging from 30 to 300 was quantified using a digital colony counter (DC-8 OSK 100086, Kayagaki, Japan), and the outcome was represented as Log10 CFU/g.
Vibrio Isolation and Identification
Thiosulfate-citrate-bile salt-sucrose agar plates (GM189, HiMedia) were streaked with a loopful of each inoculated APW broth for 24 h at 37oC incubation. Flat yellow, green–blue, yellow-green, and yellow or translucent
Table 1: Oligonucleotide primers of genes target for Vibrio spp.
|
Target Species |
Target gene |
Primers sequences |
Cycling conditions |
bp |
|
Vibrio spp. |
16S rRNA |
CGGTGAAATGCGTAGAGAT TTACTAGCGATTCCGAGTTC |
Initial at 94 ◦C/5 min, 35 cycles at 94 ◦C/30 s, 52 ◦C/ 30 s and 72 ◦C/ 60 s. Final extension at 72 ◦C/10 min |
663 |
|
V. cholerae |
OmpW |
CACCAAGAAGGTGACTTTATTGTG GGTTTGTCGAATTAGCTTCACC |
Initial at 94 ◦C/10 min, 30 cycles at 94 ◦C/60 s, 59 ◦C/60 s and 72 ◦C/2 min. Final at 72 ◦C/10 min |
304 |
|
V. parahaemolyticus |
toxR |
TGTACTGTTGAACGCCTAA CACGTTCTCATACGAGTG |
Initial at 94 ◦C/5 min, 35 cycles of 94 ◦C/30 s, 55 ◦C/30 s and 72 ◦C/30 s. Final extension at 72 ◦C/10 min |
503 |
|
V. vulnificus |
vvhA |
ACTCAACTATCGTGCACG ACACTGTTCGACTGTGAG |
366 |
|
|
V. fluvialis |
toxR |
GGATACGGCACTTGAGTAAGACTC GACCAGGGCTTTGAGGTGGACGAC |
Initial at 94 ◦C/5 min, 30 cycles at 94 ◦C/30 s, 57 ◦C/60 s and 72 ◦C/90 s. Final extension at 72 ◦C/7 min |
217 |
Table 2: Primer sets and thermal profile used in the detection of Vibrio virulence genes.
|
Target gene |
Primers sequences |
Cycling conditions |
bp |
Reference |
|
tdh |
GGTCTAAATGGCTGACATC CCACTACCACTCTCATATGC |
Initial at 96 ◦C/5 min, 35 cycles of 94 ◦C/60 s, 55 ◦C/60 s and 72 ◦C/60 s. Final 72 ◦C/7 min |
199 |
Fri et al., 2017 |
|
trh |
CATTTCCGCTCTCATATGC GGCTCAAAATGGTTAAGCG |
250 |
||
|
vcgC |
AGCTGCCGATAGCGATCT CGCTTAGGATGATCGGTG |
Initial at 94 ◦C/5 min, 35 cycles of 94 ◦C/40 s, 56◦C /40 s and 72 ◦C/60 s. Final at 72 ◦C/7 min |
278 |
|
|
vvh |
CCGGCGGTACAGCTTGGCGC CGCCACCCACTTTCGGG |
Initial 96 ◦C/5 min, 30 cycles of 94 ◦C/60 s, 63◦C/90 s and 72 ◦C/90 s. Final at 72 ◦C/7 min |
519 |
Castello et al., 2023 |
|
prVC |
TTAAGCSTTTTCRCTGAGAATG AGTCACTTAACCATACAACCCG |
Initial at 94 ◦C /2 min, 30 cycles of 94 ◦C/60 s, 50◦C for 60 s and 72 ◦C/90 s. Final at 72 ◦C/10 min |
310 |
|
|
ctxA |
CGGGCAGATTCTAGACCTCCTG CGATGATCTTGGAGCATTCCCAC |
Initial denaturation at 94 ◦C /2 min, 30 cycles of 94 ◦C /60 s, 62◦C /60 s and 72 ◦C for 60 s. Final at 72 ◦C/10 min. |
564 |
Tulatorn et al., 2018 |
|
vfh |
GCGCGTCAGTGGTGGTGAAG TCGGTCGAACCGCTCTCGCTT |
Initial at 93 ◦C/15 min, 35 cycles at 92 ◦C/40 s, 50–62 ◦C/60 s and 72 ◦C/90 s. Final at 72 ◦C/7 min |
800 |
Fri et al., 2017 |
|
stn |
GGTGCAACATAATAAACAGTCAACAA TAGTGGTATGCGTTGCCAGC |
375 |
colonies suggesting V. cholerae, V. parahaemolyticus, V. vulnificus, and V. fluvialis, respectively, were selected, purified, and subsequently biochemically identified by ISO/ TS 21872-1 (2007) and ISO/ TS 21872-2 (2007).
Molecular Confirmation of Vibrio spp. and their Virulence Gene Detection
Probable colonies were cultivated in Tryptone Soy Broth (Oxoid, USA) overnight. Following the manufacturer’s instructions, DNA was extracted using a QIAamp DNA GeneJET Genomic DNA Purification Kit (Cat. no.#K0721, Thermo Scientific, USA). 25 μl of the subsequent PCR master mix, 12.5 μl of COSMO PCR RED Master Mix (2x premix), 4.5 μl of PCR grade water, 1 μl each of the forward and reverse primers (20 pmol), and 6 μl of template DNA were included in the reaction. To verify that the isolates were members of the genus Vibrio, a primer that targeted the 16S rRNA gene was employed. The pathogenic species V. cholerae, V. paraheaemolyticus, V. vulnificus, and V. fluvialis were further identified from the confirmed isolates using primers specific to each species as well as their virulence genes by multiplex PCR. Tables 1 and 2 display the primer sets and the thermal conditions utilized following the methods of Fri et al. (2017). The Bacteriology Unit of the Animal Health Institute in Egypt provided the control positive used in this investigation. The amplified products were permitted to move on a 1.5% agarose gel, and a UV transilluminator was employed to observe the bands (Khairy and Abdelmotilib, 2023).
Antimicrobial Sensitivity
The disc diffusion technique was employed to test the identified Vibrio spp., V. cholerae, V. parahaemolyticus, V. vulnificus, and V. fluvialis, following the rules established by the Clinical and Laboratory Standards Institute (CLSI, 2020). The data were evaluated using CLSI Clinical and Laboratory Standards (CLSI, 2018). The antimicrobials that were tested included florfenicol (FFC, 30µg), doxycycline (DO, 30µg), amoxicillin (AX, 25µg), ciprofloxacin (CIP, 5µg), erythromycin (E, 15µg), ampicillin (AM, 10µg), tetracycline (T, 30 µg), penicillin (P, 10µg), nalidixic acid (NAL, 30 µg), sulfamethoxazole (Sul, 25µg), cefoxitin (CEF, 10 µg), norfloxacin (NOR, 10 µg), and gentamicin (G, 10 µg).
Pure colonies of the recognized isolates were cultured overnight in Tryptone Soya Broth (HiMedia) at 28 °C. Subsequently, 100 µL of culture broth was applied to Mueller-Hinton agar (Hi-Media) by sterile glass rods, and antibiotic discs were meticulously smeared and incubated at 28°C for 24 h. Multiple antibiotic resistance (MAR) was calculated following the formula: MAR= A/B, where A is the quantity of the antibiotic to which the isolate is resistant, and B is the quantity of the total antibiotic employed in the investigation. A MAR index< 0.2 suggested that the strain originated from a low-risk supply of contamination. On the other hand, isolates from high-risk sources of pollution have been recognized by a MAR >0.2 (Haifa-Haryani et al., 2022).
In Vitro Vibrio spp. Reduction by Lemon and Pomegranate Peel Extract in Fish Fillets
The technique described by Elbarbary and Abdelmotilib (2023) confirmed that V. cholerae and V. parahaemolyticus were positive for the occurrence of more than one virulence gene, with a few minor modifications. Fish fillets were tested for the presence of Vibrio spp., and the negative fillets were utilized in the current experiments. Five groups of five raw fish fillets (each weighing 100 g) were employed for each experiment. Each fillet in each group was pipetted with one ml of each V. cholerae and V. parahaemolyticus broth, which had been adjusted to 0.5 McFarland concentrations. The fish fillet that had been infected with V. cholerae and V. parahaemolyticus was dipped in solutions of LJ (3% and 5%) and PPE (3% and 5%) that were furnished by the National Research Center. The infected fillets were subsequently maintained at 25°C for 60 minutes. Each inoculation involved five groups: the untreated control group received a bacteria inoculation (C) only; groups were immersed in solutions containing 3% LJ (G1), 5% LJ (G2), 3% PPE (G3), and 5% PPE (G4). The antibacterial impact of LJ and PPE against V. cholerae and V. parahaemolyticus was determined by measuring the total bacterial count in triplicate after exposure time (zero, 12, 24, 48, and 72 h), and the mean values with standard errors were recorded.
Organoleptic Properties of LJ and PPE Marination
A scoring test was employed by 27 panelists who are staff members of the Faculty of Veterinary Medicine, Aswan University, to evaluate the sensory attributes of fish fillet (100 g) samples that were marinated for 60 min at 4°C using different doses of natural LJ and PPE. The fillet samples were randomly assigned codes, and the judges were not informed how the study was done. They were requested to evaluate the overall satisfaction, texture, flavour, odour, and appearance (Nady et al., 2024).
Data Analysis
One-way analysis of difference was utilized to evaluate all statistics (ANOVA). Every value was shown as means ± S.E. p < 0.05 is considered a significant variance.
Table 3: Prevalence total Vibrio count (log10 CFU/g) of examined samples (n = 30 each)
|
Species |
Count log10 CFU/g |
||
|
Minimum |
Maximum |
Mean ± SE |
|
|
Nile tilapia |
2.80 |
3.81 |
2.90±0.78c |
|
Nile perch |
2.71 |
4.92 |
3.24±1.05b |
|
Sardine |
3.88 |
6.72 |
4.77±1.22a |
|
Mugil cephalus |
2.91 |
4.91 |
3.50±1.74b |
|
Sea bass |
3.81 |
5.68 |
4.62±1.35a |
p<0.0001 is considered extremely significantly different. Mean values with the same letters in each column have no significant difference.
RESULTS AND DISCUSSION
The results available in Table 3 demonstrate the differences in the total Vibrio count (log10 CFU/g) found in the examined samples. There were significant differences between the samples (p<0.05). Total Vibrio count was the greatest in Sardine (4.77±1.22 log10 CFU/g) and Sea bass (4.62±1.35 log10 CFU/g), followed by Mugil cephalus (3.50±1.74 log10 CFU/g), Nile perch (3.24±1.05 log10 CFU/g), while Nile tilapia had the lowest count (2.90±0.78 log10 CFU/g). Bacterial investigation of the fish confirmed that Vibrio species exist with an overall ratio of 42% (Table 4). The maximum detected rate was in Nile perch (80%); however, the lowest detected rate was in Sardine and Sea bass samples (60% of each). The main detected Vibrio species were V. cholerae (38.2%), followed by V. parahaemolyticus (31.7%), V. vulnificus (19%), and the lowest percentage was V. fluvialis (11.1%).
It was found that out of 63 positive Vibrio strains depending on conventional identification, 42 isolates belonged to the genus Vibrio depending on the 16S rRNA gene (Figure 1).
Table 4: Prevalence and species of Vibrio isolates in the examined samples (n=30 of each).
|
Species |
Positive No. (%) |
Vibrio species |
||||||||
|
V. parahaemolyticus |
V. cholerae |
V. vulnificus |
V. fluvialis |
|||||||
|
No. |
% |
No. |
% |
No. |
% |
No. |
% |
No. |
% |
|
|
Nile tilapia |
6 |
20% |
2 |
3.2 |
3 |
4.8 |
1 |
1.6 |
0 |
0 |
|
Nile perch |
9 |
30% |
3 |
4.8 |
4 |
6.3 |
1 |
1.6 |
1 |
1.6 |
|
Sardine |
18 |
60% |
5 |
8.0 |
8 |
12.7 |
3 |
4.8 |
2 |
3.2 |
|
Mugil cephalus |
12 |
40% |
4 |
6.3 |
4 |
6.3 |
3 |
4.8 |
1 |
1.6 |
|
Sea bass |
18 |
60% |
6 |
9.5 |
5 |
8.0 |
4 |
6.3 |
3 |
4.8 |
|
Total |
63 |
42% |
20 |
31.7 |
24 |
38.1 |
12 |
19 |
7 |
11.1 |
Positive samples % was calculated from the total examined while Vibrio spp. % was calculated from total positive isolates.
Molecular confirmation of Vibrio spp. revealed that the most detected species were V. cholerae (17/42), V. paraheaemolyticus (12/42), V. vulnificus (9/42), and V. fluvialis (4/42), as shown in Figure 2. It was found that 9/17 and 7/17 V. cholear isolates had prVC and ctxA virulence genes (Figure 3A), 5/12 and 4/12 V. parahaemolyticus isolates had tdh and trh genes (Figure 3B), 5/9 V. vulnificus isolates had one or more of vcg and vvh genes (Figure 3C), and 2/4 V. fluvialis isolates had one or both stn or vfh genes (Figure 3D).
The antimicrobial susceptibility shown in Table 5 shows that V. cholerae strains (n = 17) were completely resistant to ampicillin (100%), while the susceptibility to florfenicol was shown in 64.7% of the isolates, followed by cefoxitin (53%). All verified V. parahaemolyticus strains (n = 12) were resistant to ampicillin and tetracycline (100%), and a large proportion of strains were resistant to all the verified antibiotics. Additionally, all investigated V. vulnificus isolates (n = 9) were susceptible to florfenicol, nalidixic acid, and cefoxitin (100%) while those resistant to tetracycline and sulfamethoxazole reached 100%. Furthermore, all V. fluvialis isolates (n = 4) were resistant to tetracycline (100%), but susceptible to florfenicol and cefoxitin (100%). The MRI of Vibrio strains alternated from 0.214 to 0.846, with an average of 0.530 (Table 6).
On the other hand, Table 7 evaluates the decontamination of V. cholerae and V. parahaemolyticus after altered exposure time following dipping in 3% and 5% LJ solution and PPE. V. cholerae and V. parahaemolyticus in the evaluated samples over 72 h diminished by 4.59 and 3.53 log10 CFU/g (48.47% and 37.3%) in the LJ solution and by 3.93 and 3.80 log10 CFU/g (41.51 and 40.13%) in the PPE. There were not significant differences between the samples at the
Table 5: The interpretation of antimicrobial susceptibility and resistance of V. species (n=42).
|
Antimicrobial agents |
V. cholerae |
V. parahaemolyticus |
V. vulnificus |
V. fluvialis |
||||||||
|
n= 17 |
n= 12 |
n= 9 |
n= 4 |
|||||||||
|
R % |
I % |
S % |
R % |
I % |
S % |
R % |
I % |
S % |
R % |
I % |
S % |
|
|
Florfenicol (30µg) |
29.4 |
17.6 |
64.7 |
50 |
16.7 |
33.3 |
0 |
0 |
100 |
0 |
0 |
100 |
|
Doxycycline (30µg) |
53 |
5.9 |
41.2 |
66.7 |
0 |
33.3 |
44.4 |
22.2 |
33.3 |
75 |
0 |
25 |
|
Amoxicillin (25µg) |
64.7 |
17.6 |
17.6 |
58.3 |
8.3 |
33.3 |
33.3 |
44.4 |
22.2 |
50 |
25 |
25 |
|
Ciprofloxacin (5µg) |
47 |
29.4 |
23.5 |
33.3 |
25 |
41.7 |
44.4 |
22.2 |
33.3 |
75 |
25 |
0 |
|
Erythromycin (15µg) |
35.3 |
23.5 |
41.2 |
41.7 |
25 |
33.3 |
66.7 |
0 |
33.3 |
50 |
0 |
50 |
|
Ampicillin (10µg) |
100 |
0 |
0 |
100 |
0 |
0 |
77.8 |
11.1 |
11.1 |
75 |
25 |
0 |
|
Tetracycline (30µg) |
82.3 |
5.9 |
11.8 |
100 |
0 |
0 |
100 |
0 |
0 |
100 |
0 |
0 |
|
Penicillin (10µg) |
47 |
23.5 |
29.4 |
58.3 |
16.7 |
25 |
77.8 |
22.2 |
0 |
50 |
25 |
25 |
|
Nalidixic acid (30µg) |
35.3 |
35.3 |
29.4 |
50 |
33.3 |
16.7 |
0 |
0 |
100 |
25 |
50 |
25 |
|
Sulfamethoxazole (25µg) |
70.6 |
17.6 |
11.8 |
91.7 |
8.3 |
0 |
100 |
0 |
0 |
75 |
25 |
0 |
|
Cefoxitin (10µg) |
29.4 |
17.6 |
53 |
41.7 |
33.3 |
25 |
0 |
0 |
100 |
0 |
0 |
100 |
|
Norfloxacin (10µg) |
47 |
23.5 |
29.4 |
58.3 |
16.7 |
25 |
55.6 |
0 |
44.4 |
25 |
25 |
50 |
|
Gentamicin (10µg) |
53 |
41.2 |
5.9 |
66.7 |
16.7 |
16.7 |
66.7 |
22.2 |
11.1 |
75 |
25 |
0 |
R: Resistant, I: Intermediate, S: Sensitive
Table 6: Antimicrobial resistance profile of Vibrio species (n=36).
|
Species |
Isolates NO. |
Antimicrobial resistance profile |
No. of antibiotic |
MAR index |
|
V. cholerae |
7 |
FF, DO, AX, CIP, E, AM, T, SUL, CEF, NR, G |
11 |
0.846 |
|
5 |
FF, DO, AX, E, P, N, SUL, AM, NR |
9 |
0.692 |
|
|
3 |
DO, CIP, AM, T, N, SUL, CEF, NR |
8 |
0.615 |
|
|
2 |
AX, CIP, E, AM, T, CEF, G |
7 |
0.538 |
|
|
V. parahaemolyticus |
6 |
FF, DO, AX, E, T, P, AM, SUL, NR |
9 |
0.692 |
|
3 |
FF, DO, E, AM, T, P, N, CEF, G |
9 |
0.692 |
|
|
2 |
DO, AX, AM, T, P, G |
6 |
0.462 |
|
|
1 |
AM, T, SUL, NR |
4 |
0.307 |
|
|
V. vulnificus |
5 |
FF, CIP, T, P, N, CEF, NR, G |
8 |
0.615 |
|
3 |
DO, AX, AM, T, SUL, NR |
6 |
0.462 |
|
|
1 |
DO, AXE, CIP, SUL |
4 |
0.286 |
|
|
V. fluvialis |
2 |
AX, CIP, AM,T, N, SUL, CEF, G |
8 |
0.615 |
|
1 |
DO, AX, CIP, T, SUL |
5 |
0.384 |
|
|
1 |
AX, CIP, T |
3 |
0.214 |
|
|
Average |
0.530 |
|||
MAR: Multiple Antibiotic Resistant indexes. FF: florfenicol, DO: doxycycline, AX: amoxicillin, CIP: ciprofloxacin, E: erythromycin AM: ampicillin, T: tetracycline, P: penicillin, N: nalidixic acid, SUL: sulfamethoxazole, CEF: cefoxitin, NR: norfloxacin, and G: gentamicin.
initial of the treatments but over the time it increased significantly (p<0.05).
A sensory assessment of a fish fillet prepared with an altered concentration of LJ and PPE is shown in Table 8. The study confirmed the group was immersed in a solution of 5% LJ as well as the group was dipped in a solution of 3% PPE possessed superior sensory criteria, with no significant variance in between, but significantly varied in contrast with the control and other treated groups.
Vibrio Count, Isolation and Identification
Fish is critical for supplying a consistent supply of protein for the human diet in quickly expanding coastal countries such as Egypt. This source is susceptible to uncontrollable bacterial diseases, mainly those caused by virulent and drug-resistant pathogens like Vibrio spp. (Saad et al., 2024). Vibrio species are fish-borne bacteria of the water supply that are primarily found in a variety of fish. These pathogens raise humans’ vul
Table 7: Effect of lemon juice and pomegranate peel extract on artificially inoculated fish fillet with V. cholera and V. parahaemolyticus after different exposure times.
|
T (hrs) |
V. cholerae count (log10 CFU/g) |
V. parahaemolyticus count (log10 CFU/g) |
|||||||
|
C |
G1 |
G2 |
G3 |
G4 |
G1 |
G2 |
G3 |
G4 |
|
|
Zero |
7.58±0.13a |
7.55± 0.17a |
7.52±0.73a |
7.56±0.52a |
7.53±0.84a |
7.53± 0.48a |
7.48±0.13b |
7.55±0.24a |
7.52±0.18a |
|
R. count |
0.03 |
0.06 |
0.02 |
0.05 |
0.03 |
0.10 |
0.03 |
0.06 |
|
|
R. % |
0.41 |
0.81 |
0.31 |
0.66 |
0.41 |
1.32 |
0.41 |
0.81 |
|
|
12 |
7.83±0.44a |
7.49± 0.42a |
6.94±0.38b |
7.52±0.73a |
6.95±0.42b |
7.46± 0.73a |
6.83±0.13b |
7.49±0.84a |
6.87±0.64b |
|
R. count |
0.34 |
0.89 |
0.31 |
0.88 |
0.37 |
1.00 |
0.34 |
0.96 |
|
|
R. % |
4.34 |
11.41 |
3.96 |
11.24 |
4.73 |
12.81 |
4.34 |
12.31 |
|
|
24 |
8.64±0.75a |
6.45± 0.64c |
6.27±0.28c |
6.81±0.22b |
6.76±0.16b |
6.40± 0.77c |
5.89±0.13d |
6.83±0.39b |
5.95±0.47d |
|
R. count |
2.19 |
2.37 |
1.83 |
1.88 |
2.24 |
2.75 |
1.81 |
2.69 |
|
|
R. % |
25.35 |
27.34 |
21.18 |
21.81 |
26 |
31.83 |
21 |
31.13 |
|
|
48 |
9.47±0.32a |
6.37± 0.27c |
5.43±0.55d |
6.66±0.72b |
6.29±0.83c |
5.83± 0.36d |
5.63±0.13d |
5.86±0.59d |
5.75±0.83d |
|
R. count |
3.1 |
4.04 |
2.81 |
3.18 |
3.64 |
3.84 |
3.61 |
3.80 |
|
|
R. % |
35.88 |
46.76 |
32.52 |
36.81 |
38.44 |
40.55 |
38.12 |
40.13 |
|
|
72 |
Spoiled |
5.87± 0.84a |
4.88±0.27b |
5.97±0.78a |
5.94±0.47a |
5.69± 0.58b |
5.54±0.85b |
5.76±0.77b |
5.67±0.59b |
|
R. count |
3.60 |
4.59 |
3.50 |
3.53 |
3.78 |
3.93 |
3.71 |
3.80 |
|
|
R. % |
38.01 |
48.47 |
37 |
37.3 |
40 |
41.51 |
39.2 |
40.13 |
|
C: The control group only got a microorganism inoculation; G1: group submerged in a solution of 3% LJ; G2: group was submerged in a solution of 5% LJ; G3: group was submerged in a solution of 3% PPE; G4: group was submerged in a solution of 5% PPE. a-d Values within the same raw have different superscript letters that are significantly different at p<0.05. Values are expressed as mean± standard error (SE) of three determinations.
Table 8: Effect of lemon juice and pomegranate peel extract marination on organoleptic properties of fish fillet.
|
Treatment |
Sensory criteria |
|||||
|
Appearance (5) |
odour (5) |
Texture (5) |
Flavor (5) |
Overall (20) * |
Grade |
|
|
C |
4.0 |
3.0 |
4.0 |
4.0 |
17.0c |
Good |
|
G1 |
4.3 |
5.0 |
4 |
5.0 |
18.3b |
Very good |
|
G2 |
5.0 |
5.0 |
5.0 |
5.0 |
20.0a |
Excellent |
|
G3 |
5.0 |
5.0 |
5.0 |
5.0 |
20.0a |
Excellent |
|
G4 |
4.0 |
4.6 |
5.0 |
4.4 |
18.0c |
Good |
*>5 spoiled, 5-10 poor, 10-15 middle, 15-18 good, 18-19 very good and 20 excellent. C: The control group only got a microorganism inoculation; G1: group submerged in a solution of 3% LJ; G2: group was submerged in a solution of 5% LJ; G3: group was submerged in a solution of 3% PPE; G4: group was submerged in a solution of 5% PPE. a- d Values within the same column have different superscript letters that are significantly different at p<0.05.
nerability to public health hazards (Semenza and Paz, 2021). In the present research, the total Vibrio count varied significantly across the samples (p<0.05). Sardine and sea bass had the highest count (4.77±1.22 log10 CFU/g and 4.62±1.35 log10 CFU/g, respectively), followed by Mugil cephalus and Nile perch (3.50±1.74 log10 CFU/g and 3.24±1.05 log10 CFU/g). Nile tilapia had the lowest count (2.90±0.78 log10 CFU/g). These different outcomes may be imputed to species variances, in addition to low salinity in freshwater, as Vibrio is more predominant in brackish and marine water (Noga, 2010). In contrast, Stratev et al. (2021) reported a high count of 5.90±5.84 log10 CFU/g, while Lamon et al. (2019) demonstrated a decreased count (2.04 log10 CFU/g) of Vibrio spp.
Furthermore, 42% of the samples include Vibrio spp. In Nile perch, the isolation rate was the highest at 80%, with V. cholerae (38.2%) being the most prevalent isolated Vibrio spp. V. parahaemolyticus (31.7%) and V. vulnificus (19%) were the next most prevalent, and V. fluvialis (11.1%) was the least prevalent. Although V. cholerae and V. parahaemolyticus are a halophilic bacterium and linked to marine water (Almejhim et al., 2021). Parallel findings were observed by Saad et al. (2024), who observed that 37% of Vibrio spp. were isolated, with V. parahaemolyticus being identified at a higher incidence of 18%, followed by V. vulnificus at 11%. Furthermore, Castello et al. (2023) found that Vibrio spp. contaminated 27.4% of the fish they studied, with V. parahaemolyticus accounting for 26.1%, V. cholerae for 7.3%, and V. vulnificus for 3% of the infections. According to El-Sharaby et al. (2018), 39% of the fish that were evaluated had Vibrio spp. contamination, of which 10.25% had V. fluvialis and 16.67% had V. vulnificus. Additionally, Morshdy et al. (2022) reported a greater isolation rate, finding that 52% of Vibrio spp. were detected in fish, 42.3% of which were classified as V. parahaemolyticus, and 1.92% of which were identified as V. cholerae. Furthermore, Suresh et al. (2018) found that 82.85% of the Vibrio spp. found in freshwater fish were V. parahaemolyticus (6.9%), V. vulnificus (2.3%), and V. cholerae (3.45%). However, Ahmed et al. (2018) verified a low Vibrio detection rate of 16%, while V. parahaemolyticus and V. cholerae were found in 15.1% and 0.9% of the samples, respectively. According to Yan et al. (2019), V. cholerae (10.33%), V. parahaemolyticus (3.89%), and V. vulnificus (0.76%) were the most frequently isolated Vibrio species. The disparities in the prevalence proportions of identified bacteria may be attributable to a variety of environmental factors, including the total inspected samples, differences in host susceptibility, geographical dissemination, sodium concentration, and sampling duration (Saad et al., 2024).
Molecular Confirmation of Vibrio spp. and their Virulence Gene Detection
However, traditional phenotypic and biochemical identification approaches are inadequate for Vibrio strains obtained from fish. The identification of Vibrio spp. is impeded by the occurrence of both false positive and negative outcomes in all biochemically recognized approaches. As a result, PCR analyses are necessary for their recognition (Haifa-Haryani et al., 2022). Depending on the 16S rRNA gene, 42 of the 63 positive Vibrio spp. were identified as belonging to the Vibrio genus. The 16S rRNA is a widely used molecular indicator for recognizing and characterizing isolated pure cultures, as well as assessing bacterial density using metagenomic assays (Rajendhran et al., 2011). However, the 16S rRNA gene has limited discriminatory strength, resulting in misidentification of Vibrio spp. when related to other investigated genes (Sawabe et al., 2013). Furthermore, the 16S rRNA shared by Vibrio spp. is over 97% similar, which complicates the differentiation of closely related species (Zhang et al., 2014). Because of this constraint, alternative housekeeping genes were utilized as markers to assess bacterial species diversity.
In this investigation, the molecular technique was employed to identify the isolated Vibrio spp. by analyzing the OmpW gene of V. cholerae at 304 bp, the toxR gene of V. paraheaemolyticus at 503 bp, the vvhA of V. vulnificus at 366 bp, and the toxR of V. fluvialis at 217 bp. The molecular approach validated four species in our study: V. cholerae (40.5%), V. parahaemolyticus (28.6%), V. fluvialis (21.4%), and V. vulnificus (9.5%), with certain strains retaining one or more virulence factors (Figures 2 and 3). It was discovered that 12 out of 17 V. cholerae isolates possessed prVC (9/17) and ctxA (7/17) virulence genes (Figure 3A), 50% of V. parahemolyticus strains identified in this investigation have either nor tdh or trh genes, whereas the remaining strains harboured one or both genes (Figure 3B). Furthermore, 5 of 9 V. vulnificus isolates have one or both vcg or vvh genes (Figure 3C), while 2 of 4 V. fluvialis isolates possess one or both stn or vfh genes (Figure 3D). This is consistent with earlier research that has verified the virulence genes related to Vibrio spp. enteropathogenicity (Castello et al., 2023; Haifa-Haryani et al., 2022; Morshdy et al., 2022; Saad et al., 2024). Additionally, despite the absence of the tested virulence genes in certain strains, these strains can harbour other virulence markers and exhibit high antimicrobial resistance rates that may be unsuccessful in treating infections (Silva et al., 2018).
In addition, the Ctx gene is a crucial component of V. cholerae pathogenicity, generating the cholera toxin that causes diarrhoea in cholera patients (Fri et al., 2017). The pathogenic risk of V. parahaemolyticus is suggestively influenced by the thermostable direct hemolysin (tdh) and the thermostable direct hemolysin-related (trh) gene (Terzi et al., 2016). This is a result of the tdh biological actions, which comprise its enterotoxin and cytotoxic properties. The primary gene responsible for the hazardous effects of V. vulnificus is the virulence-correlated gene (vcg) which has been described as valuable in distinguishing potentially infectious and non-infectious strains (Mavhungu et al., 2023). On the other hand, Vfh has a wide range of cytocidal action and a virulence attribute harboured by V. fluvialis, causing inflammatory diarrhoea in vulnerable individual hosts and producing erythrocytes rupture (Mavhungu et al., 2023). Furthermore, the toxR gene, which encodes a significant membrane-localized regulatory protein and is frequently implicated in the microbial regulation of a range of exhibition yields, is carried by 28.6% of V. parahaemolyticus in the current investigation (Li et al., 2020). Almejhim et al. (2021) reported the same outcome, indicating that 21.7% of V. parahaemolyticus have the toxR gene. Nevertheless, Morshdy et al. (2022) and Yen et al. (2021) detected that all V. parahaemolyticus isolates have toxR genes. Elbarbary et al. (2024) also discovered toxR (70%) and tdh (50%) genes in V. parahaemolyticus using PCR research. Concurrently, Terzi et al. (2016) also reported a low incidence of tdh and trh (0% and 4.2%, respectively).
Bacterial pathogenicity is dependent on the presence of virulence factors serving as principal orchestrators. Furthermore, according to Hiyoshi et al. (2010), tdh and trh are the chief virulence genes of V. parahaemolyticus in terms of their pathogenicity. Fri et al. (2017) identified tdh and trh in 3% of the strains tested. However, other research (Al-Othrubi et al., 2014; Letchumanan et al., 2015) found greater percentages of trh (40%) and tdh (12.3%). All of the V. parahaemolyticus confirmed by Li et al. (2020) had the toxR gene; the tdh and trh were present in 9.90 and 19.80%, respectively. In addition, Fri et al. (2017) found that 13.3% and 6.2% of V. fluvialis harboured stn and vfh pathogenic genes. Hence, to avoid food-borne illnesses, it is essential to highlight the requirement for bacteriological risk valuations of food safety and improve active checking efforts, particularly the sanitary supervision of fish and their products.
Antimicrobial Sensitivity
Antimicrobial residues pose a major risk to the public’s health when they are found in aquaculture products. This health risk is caused by either the horizontal genetic factor transfer from aquatic surroundings to individuals or the direct dissemination of resistance genes acquired by bacteria (Sun et al., 2015). According to current research, V. cholerae is completely susceptible to florfenicol and cefoxitin but has significant proportions of whole or intermediary antibacterial resistance used in therapeutic rules, for instance, ampicillin (100%), tetracycline (82.3%) and sulfamethoxazole (70.6%). Regarding the evaluation of antimicrobial resistance, V. parahaemolyticus showed 100% ampicillin and tetracycline resistance and was exceedingly resistant to sulfamethoxazole and gentamicin. Conversely, the present findings verify the resistance of V. vulnificus and V. fluvialis to antibiotics, such as tetracycline and sulfamethoxazole, which are prescribed by the Centers for Disease Control and Prevention (CDC) for contagion therapy (Serratore et al., 2017). Additionally, they are highly susceptible to florfenicol, nalidixic acid, and cefoxitin. The results are consistent with those described by other investigators regarding the prevalence of antimicrobial resistance (Castello et al., 2023; Morshdy et al., 2022; Saad et al., 2024; Silva et al., 2018). However, the organism was highly resistant to doxycycline, sulfamethoxazole, and gentamicin, which was also observed in other studies (Ahmed et al., 2018; Sony et al., 2021). Aside from minor differences in proportions achieved, our outcomes established that Vibrio spp. isolates were resilient to a wide range of antibiotics, implying that they may have been widely misrepresented, decreasing their efficacy in the handling of Vibrio illness (Castello et al., 2023).
The majority of isolates in the present study declare a multiple MAR index within the range of 0.214 to 0.846, with an average of 0.530, which is >0.2. This indicates that the isolates have acquired a hereditary resistance that poses a public health hazard to customers (Elbarbary and Abdelmotilib, 2023). High MAR may be due to the increased chance for resistance genes situated on plasmids to be swapped among environmental isolates through horizontal gene transfer due to the prevalent, uncontrolled use of Antibacterials in the infection handling (Ottaviani et al., 2013). Analogously, earlier reports (Ahmed et al., 2018; Morshdy et al., 2022; Saad et al., 2024; Zaafrane et al., 2022) indicated that Vibrio isolates had a high MAR index. The variance in the MAR index could be attributed to variations in geographic dissemination, sample supply, and technique applied. Higher MAR in the current investigation demonstrated that the Vibrio isolates are from a high-risk supply; hence, an antimicrobial resistance investigation is required. Public and manufacturing waste water have been drawn as a potential source of resistant isolates in the aquatic ecosystem. A substantial quantity of the antibiotics that people take for medical causes are ousted in their faeces and urine in an active biological form and between 30 to 90% of the antibiotics that animals drink are also rejected in faeces and urine. Antibiotic-resistant bacteria and antibiotics were found to pollute the environment through animal excreta (El-Zamkan et al., 2023). An emerging issue with infectious bacteria present in the aquatic environment, including fish, is their growing resistance to key antibiotics. Consequently, it is imperative to examine the medicine resistance outlines to avoid the dissemination of antibiotic-resistant bacteria and to identify more effective alternatives (Saad et al., 2024).
In Vitro vibrio spp. Reduction by Lemon and Pomegranate Peel Extract in Fish Fillets
Food shelf life is extended by the use of organic compounds, which also restrict microbial contamination and decrease foodborne pathogens (Lingham et al., 2012). One of the contemporary food handling techniques that use non-thermal procedures to create nutrient-dense, microbe-safe food products is treatment with organic acids such as LJ and PPE because of their antibacterial properties, organic substances are widely employed as food additives and preservers to prolong the storage period of perishable foods (Mathur and Schaffner, 2013; Wang et al., 2015). V. cholerae and V. parahaemolyticus counts were successfully lowered in the current study after 72 h of marination in LJ and PPE with varying concentrations. Additionally, Table 7 showed an ascending increase in the decline of V. cholerae and V. parahaemolyticus during the exposure time. Additionally, compared to other treatments, the 5% lemon juice marinade had a greater favourable effect on the decrease of V. cholerae and V. parahaemolyticus counts during the storage period. The present study indicates that the LJ and PPE may have potent antimicrobial properties against V. cholerae and V. parahaemolyticus due to their highest concentrations of phenolics and flavonoids (p<0.05).
Moreover, Morshdy et al. (2022), Sushmita (2022), and Tsai et al. (2021) have all demonstrated the antimicrobial action of LJ as a natural reduction of Vibrio spp. However, PPE marination has been demonstrated by several researchers (Elbarbary and Abdelmotilib, 2023; Hayrapetyan et al., 2012; Rasuli et al., 2021) that there is a substantial difference (p<0.05) between the PPE concentration and storage length. The antibacterial mechanism of flavonoids, a key constituent in LJ and PPE, involves inhibiting nucleic acid synthesis, disturbing cytoplasmic membrane roles, influence energy metabolism, and impacting biofilm creation and membrane permeability. Flavonols and phenolic acids, in specific, prove important antibacterial act, preventing bacterial virulence factors such as toxins and enzymes, and improving the effectiveness of antibiotics (Sattar et al., 2024). Saponin compounds are antibacterial mixes that destruct bacterial cell membranes. Also, LJ has vitamin C which is convenient as an antioxidant. The main component LJ is organic acid in the form of citric acid which is contained most in LJ. The citric acid supplies a degree of acidity (pH) which is one of the issues that can prevent bacterial development (Ekawati et al., 2019). In addition, PPE is a naturally occurring substance that has strong antibacterial and antioxidant properties (Rasuli et al., 2021). Many researches have been undertaken on the use of natural antioxidants to improve the oxidative stability of fish products (Akuru et al., 2020). Marination with natural components in food is a typical approach for decreasing bacterial contamination and increasing shelf life (Rasuli et al., 2021).
Organoleptic Properties of LJ and PPE Marination
The sensory evaluation of fish fillets that were prepared with varying ratios of LJ and PPE during cold storage is illustrated in Table 8. The investigation indicated that LJ 5% and PPE 3% concentrations had the highest sensory criteria, with no significant difference between them, although they changed dramatically with other treatments. It has been proposed that LJ 5% concentrations provide the samples with a more acidic environment, which is not favourable to most bacteria. The findings are also corroborated by prior research (Elbarbary and Abdelmotilib, 2023; Morshdy et al., 2022; Nady et al., 2024). We hypothesize that the variation in average overall scores between tests may also be attributed to personal rating differences, as the panel members were not identical for each test. Furthermore, the scores of the assessors may have been significantly influenced by the significant differences in the samples they evaluated after each storage period. The study’s distinctiveness lies in its investigation of the antibacterial properties of lemon juice and PPE. However, the study had limitations. The scope was confined to in vitro conditions, which may not fully replicate in vivo environments. Future research should consider in vivo studies to validate these outcomes. Also, the specific mechanisms through which these extracts exert their antibacterial effects, mainly in combination treatments, warrant further examination.
CONCLUSIONS AND RECOMMENDATIONS
More hygienic measures should be implemented during all processing steps as a result of the current study’s findings, which show that a sizable portion of the samples under examination is contaminated with antibiotic-resistant Vibrio spp., specifically V. cholerae, V. parahaemolyticus, V. vulnificus, and V. fluvialis. These bacteria harbour one or more virulence genes, which increases the risk of foodborne illness and may facilitate its transmission. The results indicate that using the marination process with 5% lemon juice and 3% pomegranate peel extract has a positive effect on reducing V. cholerae and V. parahaemolyticus counts through the storage period, improving sensual characteristics, extending product shelf life, and being a safe method of preserving fish products. To assist in the elimination of contaminated pathogens, it is recommended that hygienic conditions be consistently enforced in the following areas: food handling, food contact surfaces, personal sanitary practices, and the consumption of fully cooked fish. Further research is required to detect other virulence and antibiotic resistance genes as well as to explore other natural antimicrobials to reach the optimum conditions of marination for the maximum prolongation of the product’s shelf life.
Acknowledgements
The authors extend their gratitude to all colleagues from the Faculty of Veterinary Medicine and the Faculty of Agriculture and Natural Resources at Aswan University for their contributions to this study.
NOVELTY STATEMENT
This study is the first to evaluate the occurrence, virulence gene detection, antibiotic resistance profile, and the antibacterial influence of lemon juice and pomegranate peel extract on V. cholerae and V. parahaemolyticus in fish samples from supermarkets at Aswan City, Egypt.
AUTHORS’ CONTRIBUTIONS
Sohaila El-Hawary, Nady Elbarbary and Reda Gomaa: conducted conceptualization, data curation, and methodology. Nermeen Malak conducted a formal analysis. Hesham Tawfeuk and Suzan Ismail: managed the investigation, validation, and visualisation. Nady Elbarbary and Nermeen Malak: wrote the original draft, revised, and edited the paper. The authors contributed equally and accepted the absolute manuscript.
Conflicts of Interest
The authors have declared no conflict of interest.
REFERENCES
Ahmed HA, El Bayomi RM, Hussein MA, Khedr MH, Remela EMA, El-Ashram A M (2018). Molecular characterization, antibiotic resistance pattern and biofilm formation of Vibrio parahaemolyticus and V. cholerae isolated from crustaceans and humans. Int. J. Food Microbiol. 274: 31-37. https://doi.org/10.1016/j.ijfoodmicro.2018.03.013
Akuru EA, Oyeagu CE, Mpendulo TC, Rautenbach F, Oguntibeju OO (2020). Effect of pomegranate (Punica granatum L) peel powder meal dietary supplementation on antioxidant status and quality of breast meat in broilers. Heliyon., 6: e05709. https://doi.org/10.1016/j.heliyon.2020.e05709
Almejhim M, Aljeldah M, Elhadi N (2021). Improved isolation and detection of toxigenic Vibrio parahaemolyticus from coastal water in Saudi Arabia using immunomagnetic enrichment. Peer. J., 29(9): e12402. https://doi.org/10.7717/peerj.12402
Al-Othrubi SM, Kqueen CY, Mirhosseini H, Hadi YA, Radu S (2014). Antibiotic resistance of Vibrio parahaemolyticus isolated from cockles and shrimp seafood marketed in Selangor, Malaysia. Clin Microbiol., 3:148–54. https://doi.org/10.4172/2327-5073.1000148
Alsaraf KM, Abd ST, Hussein N, Jabor AA (2016). In vitro Evaluation of the effect of Natural Products against Vibrio cholerae. Int. J. Adv. Res., 3: 271-275. http://s-o-i.org/1.15/ijarbs-2016-3-3-35
Binh VN, Dang N, Anh NT, Thai PK (2018). Antibiotics in the aquatic environment of Vietnam: Sources, concentrations, risk and control strategy. Chemosphere. 197: 438-450. https://doi.org/10.1016/j.chemosphere.2018.01.061
Castello A, Alio V, Sciortino S, Oliveri G, Cardamone C, Butera G, Costa A (2023) Occurrence and Molecular Characterization of Potentially Pathogenic Vibrio spp. in Seafood Collected in Sicily. Microorganisms., 11: 53. https://doi.org/10.3390/microorganisms11010053
CCAC (2005). Canadian Council on Animal Care guidelines on: the care and use of fish in research, teaching and testing. Available: ccac.ca/Documents/Standards/Guidelines/Fish.pdf
CLSI (2018). Performance standards for antimicrobial susceptibility testing: 28th informational supplement: Clinical and Laboratory Standards Institute, Wayne, PA2018. https://clsi.org/media/1930/m100ed28_sample.pdf
CLSI (2021). Clinical and Laboratory Standards Institute. L. S. Methods for antimicrobial disk susceptibility testing of bacteria isolated from aquatic animals. M100-ED29:. Performance standards for antimicrobial susceptibility testing. Clsi., 40: 50–51. https://www.nih.org.pk/wp-content/uploads/2021/02/CLSI-2020.pdf
Deng Y, Xu L, Chen H, Songlin L, Zhixun G, Changhong Ch, Hongling M, Juan F (2020). Prevalence, virulence genes, and antimicrobial resistance of Vibrio species isolated from diseased marine fish in South China. Sci Rep., 10: 14329. https://doi.org/10.1038/s41598-020-71288-0
Dutta D, Kaushik A, Kumar D, Bag S (2021). Foodborne Pathogenic Vibrios: Antimicrobial Resistance. Front Microbiol. 30; 12:638331. https://doi.org/10.3389/fmicb.2021.638331
Ekawati ER, Darmanto W (2019). Lemon (Citrus limon) Juice Has Antibacterial Potential against Diarrhea-Causing Pathogen. Earth Environ. Sci., 217: 012023. https://doi.org/10.1088/1755-1315/217/1/012023
Elbarbary NK, Abdelmotilib NM (2023). Effect of Natural Antimicrobials on the Reduction of Pseudomonas aeruginosa in Frozen Chicken Products. J. Adv. Vet. Res., 13(3): 501-507. Retrieved from https://www.advetresearch.com/index.php/AVR/article/view/1263
Elbarbary NK, Abdelmotilib NM, Gomaa RA, Elnoamany F, Fotouh A, Noseer EA, Samir RZ (2023). Impact of thawing techniques on the microstructure, microbiological analysis, and antioxidants activity of Lates niloticus and Mormyrus kannume fish fillets. Egypt. J. Aquat. Res., 49(4):530-6. https://doi.org/10.1016/j.ejar.2023.10.004
Elbarbary NK, Dandrawy MK, Hadad G, Abdelhaseib M, Osman AAA, Alenazy R, Elbagory I, Abdelmotilib, NM, Elnoamany F, Ibrahim, GA, Gomaa RA (2024). Bacterial Quality and Molecular Detection of Food Poisoning Virulence Genes Isolated from Nasser Lake Fish, Aswan, Egypt, Int. J. Food Sci., 6095430: 12. https://doi.org/10.1155/2024/6095430
El-Sharaby SM, Abd-Elgaber M, Tarabees R, Khalil RH, Ali MN, El-Ballal S (2018). Bacteriological and histopathological studies on Vibrio species isolated from naturally infected freshwater fish in Delta Region, Egypt. Adv. Anim. Vet. Sci., 6(1):17-26. http://dx.doi.org/10.17582/journal.aavs/2018/6.1.17.26
El-Zamkan MA, Ahmed AS, Abdelhafeez HH, Mohamed HMA (2023). Molecular characterization of Vibrio species isolated from dairy and water samples. Scientific reports, 13(1): 15368. https://doi.org/10.1038/s41598-023-42334-4
Fri J, Ndip RN, Njom HA, Clarke AM (2017). Occurrence of Virulence Genes Associated with Human Pathogenic Vibrios Isolated from Two Commercial Dusky Kob (Argyrosmus japonicus) Farms and Kareiga Estuary in the Eastern Cape Province, South Africa. Int. J. Environ. Res. Public Health., 14(10): 1111. https://doi.org/10.3390/ijerph14101111
Haifa-Haryani WO, Amatul-Samahah MA, AzzamSayuti M, Chin YK, Zamri-Saad M, Natrah I, Amal MNA, Satyantini WH, Ina-Salwany MY (2022). Prevalence, Antibiotics Resistance and Plasmid Profiling of Vibrio spp. Isolated from Cultured Shrimp in Peninsular Malaysia. Microorganisms., 10: 1851. https://doi.org/10.3390/microorganisms10091851
Hayrapetyan H, Hazeleger WC, Beumer RR (2012). Inhibition of Listeria monocytogenes by pomegranate (Punica granatum) peel extract in meat paté at different temperatures. Food Control., 23:66-72; https://doi.org/10.1016/j. foodcont.2011.06.012
Hiyoshi H, Kodama T, Iida T, Honda T (2010). Contribution of Vibrio parahaemolyticus virulence factors to cytotoxicity, enterotoxicity, and lethality in mice. Infect. Immun., 78: 1772–1780. https://doi.org/10.1128/iai.01051-09
ISO-TS-21872-1 (2007). International Organization for Standardization / Technical Specification. Microbiology of Food and Animal Feeding Stuffs-Horizontal Method for the Detection of Potentially Enteropathogenic Vibrio spp. Part 1: Detection of Vibrio parahaemolyticus and Vibrio cholerae. https://www.iso.org/standard/38278
ISO/TS-21872-2 (2007). Specifies a horizontal method for detection of the enteropathogenic Vibrio species, causing illness in or via the intestinal tract, other than Vibrio parahaemolyticus and Vibrio cholerae. Include Vibrio fluvialis, Vibrio mimicus and Vibrio vulnificus. https://www.iso.org/standard/38279
Khairy E, Abdelmotilib N (2023). Monitoring the Bacteriological Contamination and Histamine Formation in Canned Tuna. Egypt. J. Aquat. Biol. Fish., 27(4): 421-438. https://doi.org/10.21608/ejabf.2023.311136
Lamon S, Consolati SG, Fois F, Cambula MG, Pes M, Porcheddu G, Agus V, Esposito G, Mureddu A, Meloni D (2019). Occurrence, seasonal distribution, and molecular characterization of Vibrio vulnificus, Vibrio cholerae, and Vibrio parahaemolyticus in shellfish (Mytilus galloprovincialis and Ruditapes decussatus) collected in Sardinia (Italy). J Food Prot., 82:1851-6. https://doi.org/10.4315/0362-028x.jfp-19-021
Letchumanan V, Pusparajah P, Tan LTH, Yin WF, Lee LH, Chan KG (2015). Occurrence and antibiotic resistance of Vibrio parahaemo lyticus from shellfish in Selangor, Malaysia. Front. Microbial., 6: 1417. https://doi.org/10.3389/fmicb.2015.01417
Li Y, Xie T, Pang R, Wu Q, Zhang J, Lei T, Xue L, Wu H, Wang J, Ding Y, Chen M, Wu S, Zeng H, Zhang Y, Wei X (2020). Food-Borne Vibrio parahaemolyticus in China: Prevalence, Antibiotic Susceptibility, and Genetic Characterization. Front. Microbiol., 11:1670. https://doi.org/10.3389/fmicb.2020.01670
Lingham T, Besong S, Ozbay G, Lee JL (2012). Antimicrobial Activity of Vinegar on Bacterial Species Isolated from Retail and Local Channel Catfish (Ictalurus punctatus). J Food Process Technol., S11-001:2:25-8. https://doi.org/10.4172/2157-7110. S11-001
Tilusha M, Annas S, Mohammad A, Ina Y, Mohd Z (2023). Pathology and pathogenesis of Vibrio infection in fish: A review. Aqu. Rep., 28 (2023): 101459. https://doi.org/10.1016/j.aqrep.2022.101459
Mathur P, Schaffner DW (2013). Effect of lime juice on Vibrio parahaemolyticus and Salmonella enterica inactivation during the preparation of the raw fish dish ceviche. J. Food Prot., 1;76(6):1027-30. https://doi.org/10.4315/0362-028X.JFP-12-526
Mavhungu M, Digban TO, Nwodo UU (2023). Incidence and Virulence Factor Profiling of Vibrio Species: A Study on Hospital and Community Wastewater Effluents. Microorganisms.,11(10):2449.https://doi.org/10.3390/microorganisms11102449
Morshdy AEM, El-Ghandour AR, Hussein MA, El Bayomi RM (2022). Prevalence of Antibiotic-Resistant Vibrio Isolated from Some Marketed Fish in Egypt with a Decontamination Trial by Lemon Juice. J. Adv. Vet. Res., 12(4): 353-357. Retrieved from https://www.advetresearch.com/index.php/AVR/article/view/1013\
Nady KE, Abdelmotilib NM, Salem-Bekhit MM, Salem MM, Singh S, Dandrawy MK (2024). Antibacterial efficiency of apple vinegar marination on beef-borne Salmonella. Open Vet. J., 14(1): 274–283. https://doi.org/10.5455/OVJ.2024.v14.i1.24
Noga EJ (2010). Fish disease, Diagnosis and treatment.Mosby, St. Louis, MO, USA.
Ottaviani D, Leoni F, Talevi G, Masini, L, Santarelli S, Rocchegiani E, Susini F, Montagna C, Monno R, D’Annibal L, Manso E, Oliva M, Pazzani C. (2013). Extensive investigation of antimicrobial resistance in Vibrio parahaemolyticus from shellfish and clinical sources, Italy. Int. J. Antimicr. Agents, 42(2): 191–193. https://doi.org/10.1016/j.ijantimicag.2013.05.003
Rajendhran J, Gunasekaran P (2011). Microbial phylogeny and diversity: Small subunit ribosomal RNA sequence analysis and beyond. Microbiol. Res., 166, 99–110. https://doi.org/10.1016/j.micres.2010.02.003
Ramamurthy T, Chowdhury G, Pazhani GP, Shinoda S (2014). Vibrio fluvialis: An emerging human pathogen. Vibrio Ecol. Pathog. Evolut., 5: 91. https://doi.org/10.3389%2Ffmicb.2014.00091
Rasuli N, Bintoro VP, Purnomoadi A, Nurwantoro N (2021). The shelf life of buffalo meat marinated with pomegranate (Punica granatum) peel extract. J Adv Vet Anim Res., 8(4):612-618. https://doi.org/10.5455/javar.2021.h552
Saad MF, Elsayed MM, Khder M, Abdelaziz AS, El-Demerdash AS (2024). Biocontrol of multidrug-resistant pathogens isolated from fish farms using silver nanoparticles combined with hydrogen peroxide insight to its modulatory effect. Sci. Rep., 14(1): 7971. https://doi.org/10.1038/s41598-024-58349-4
Sattar A, Abbas AS, Naseem S, Mumtaz M, Shabbir A, Mirza SS (2024). Evaluation of Phytochemicals and Antibacterial Usefulness of Citrus Limon & Cicer Arietinum in Synergistic Effect with Antibiotics Against Clinically Important Bacteria. J. Health Reh. Res., 4(1): 244–249. https://doi.org/10.61919/jhrr.v4i1.174
Sawabe T, Kumar R, Fukui Y, Satomi M, Matsushima R., Thompson FL, Gomez-Gil B, Christen R, Maruyama F, Kurokawa K, (2013). Updating the Vibrio clades defined by multilocus sequence phylogeny: Proposal of eight new clades, and the description of Vibrio tritonius sp. nov. Front. Microbiol., 2013, 4, 414. https://doi.org/10.3389%2Ffmicb.2013.00414
Semenza JC, Paz S (2021). Climate change and infectious disease in Europe: Impact, projection and adaptation. Lancet Reg. Health Eur., 1:9. https://doi.org/10.1016/j.lanepe.2021.100230
Serratore P, Zavatta E, Fiocchi E, Serafini E, Serraino A, Giacometti F, Bignami G (2017). Preliminary Study on the Antimicrobial Susceptibility Pattern Related to the Genotype of Vibrio Vulnificus Strains Isolated in the North-Western Adriatic Sea Coastal Area. Ital. J. Food Saf., 6 (4): 6843. https://doi.org/10.4081/ijfs.2017.6843
Silva IP, Carneiro CDS, Saraiva MAF, Oliveira TASD, Sousa OVD, Evangelista-Barreto NS (2018). Antimicrobial Resistance and Potential Virulence of Vibrio Parahaemolyticus Isolated from Water and Bivalve Mollusks from Bahia, Brazil. Mar. Pollut. Bull.,131: 757–762. https://doi.org/10.1016/j.marpolbul.2018.05.007
Sony M, Sumithra TG, Anusree VN, Amala PV, Reshma KJ, Alex S, Sanil NK (2021). Antimicrobial resistance and virulence characteristics of Vibrio vulnificus, Vibrio parahaemolyticus and Vibrio harveyi from natural disease outbreaks of marine/estuarine fishes. Aquaculture., 539 (2): 736608. http://dx.doi.org/10.1016/j.aquaculture.2021.736608
Stratev D, Stoyanchev T, Bangieva D (2021). Occurrence of Vibrio parahaemolyticus and Staphylococcus aureus in seafood. Ital J Food Saf., 3;10(4):10027. http://dx.doi.org/10.4081/ijfs.2021.10027
Sun BF, Li T, Xiao JH, Jia LY, Liu L, Zhang P, Murphy RW, He S, Huang DW (2015). Horizontal functional gene transfers from bacteria to fishes. Sci. Rep. 5: 1-9. https://doi.org/10.1038%2Fsrep18676
Suresh Y, Subhashini N, Kiranmayi CB, Srinivas K, Ram VP, Chaitanya G, Rao TS (2018). Isolation, molecular characterization and antimicrobial resistance patterns of four different Vibrio species isolated from freshwater fishes. Int J Curr Microbiol Appl Sci., 7(7):3080-8. http://dx.doi.org/10.20546/ijcmas.2018.707.359
Sushmita D (2022). Vibrio cholerae Food Poisoning- Cholera toxin (CT). Microbe Notes. https://microbenotes.com/Vibrio-cholerae-food-poisoning
Tang JY, Farhana Sakinah MR, Nakaguchi Y, Nishibuchi M, Chai LC, New CY, Son R. (2017). Detection of Vibrio cholerae in street food (satar and otak-otak) by LoopMediated Isothermal Amplification (LAMP), multiplex Polymerase Chain Reaction (mPCR) and plating methods. Food Res., 2: 447-452. http://dx.doi.org/10.26656/fr.2017.2(5).099
Terzi Gulel G, Martinez-Urtaza J (2016). Molecular characterizations of Vibrio parahaemolyticus in seafood from the Black Sea, Turkey. Lett. Appl. Microbiol., 62: 494–500. https://doi.org/10.1111/lam.12579
Trinanes J, Martinez-Urtaza J (2021). Future scenarios of risk of Vibrio infections in a warming planet: a global mapping study. Lancet Planet Health., 5: e426-e435. https://doi.org/10.1016/s2542-5196(21)00169-8
Tsai CC, Lin LY, Lai TM, Chou LC (2021). To evaluate the effects of lactic acid bacteria fermented lemon juice from Limon and Eureka varieties of Taiwan on antipathogenic bacteria and anti-allergy. J. Food Nutr. Res., 9: 382-388. http://dx.doi.org/10.12691/jfnr-9-7-9
Wang Y, Chen X, Whalen JK, Cao Y, Quan Z, Lu C, Shi Y (2015). Kinetics of inorganic and organic phosphorus release influenced by low molecular weight organic acids in calcareous, neutral and acidic soils. J Plant Nutr Soil SC., 178(4):555-66. http://dx.doi.org/10.1002/jpln.201500047
Yan L, Pei X, Zhang X, Guan W, Chui H, Jia H, Ma G, Yang S, Li Y, Li N, Yang D (2019). Occurrence of four pathogenic Vibrios in Chinese freshwater fish farms in 2016. Food Control., 1:95:85-9. http://dx.doi.org/10.1016/j.foodcont.2018.07.043
Yen PT, Linh NQ, Tram ND (2021). The identification and determination of toxin genes of Vibrio strains causing hemorrhagic disease on red drum (Sciaenops ocellatus) using PCR. AMB Express., 4:11(1):4. http://dx.doi.org/10.1186/s13568-020-01161-w
Zaafrane S, Maatouk K, Alibi S, Ben Mansour H (2022). Occurrence and antibiotic resistance of Vibrio parahaemolyticus isolated from the Tunisian coastal seawater. J WATER HEALTH Journal., 1:20(2):369-84. https://doi.org/10.2166/wh.2022.243
Zhang C, Xu X, Pu S, Huang S, Sun J, Yang S, Zhang L (2014). Characterization of carbapenemases, extended spectrum β-lactamases, quinolone resistance and aminoglycoside resistance determinants in carbapenem-non-susceptible Escherichia coli from a teaching hospital in Chongqing, Southwest China. Infect. Genet. Evol., 27: 271–276. https://doi.org/10.1016/j.meegid.2014.07.031