Special Issue:
Veterinary Medicine between Sustainable Development and Public Health to Confront Global Changes
Antibiotic Susceptibility Pattern against Virulence Genes of Helicobacter. pylori Isolated from Felines and Sheep
Enany M.E.1, Fadel Hanaa M.2, Abo-Shama U.H.3, Ahmed Mona M.1, Kholief M.E.A.4*
1Department of Bacteriology, Immunity, and Mycology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia, Egypt; 2Department of Animal Hygiene and Zoonoses department, Faculty of Veterinary Medicine, Suez Canal University, Ismailia, Egypt; 3Department of Microbiology, Faculty of Veterinary Medicine, Sohag University, Sohag, Egypt; 4Department of Zoonoses, Faculty of Veterinary Medicine, EL Kharga, New valley University, Egypt.
Abstract | Helicobacter, H. pylori, is seasoned common bacterial humans pathogen, possess virulence genes such as vacuolating cytotoxin gene A (vacA), cytotoxin-associated gene A (cagA) and, (hrgA) which have not widely recognized function. The aim of the current study to determine the efficacy of antibiotic therapies of human diseased animal model as felines and sheep infected with virulent H. pylori in seasons. A total of twelve H. pylori isolates cultivated from samples of stomachs and stool of felines, gastric and milk of sheep. These were previously confirmed by amplification of 16srRNA H. pylori to be detected by multiplex polymerase reaction against vacA, cagA, and hrgA and bio-typed based on urease and nitrate reduction testes, finding non-nitrate reductive isolates from apparently healthy felines 20% and, nitrate reductive isolates from clinical felines and normal sheep 40% and 20%, respectively as total virulence genes H. pylori (cag\vac\hrgA) frequency in autumn. Among the highest frequency both of cag\hrgA 66.6%, positive nitrate biotypes were highly resistant 85.7 % in autumn through antimicrobial susceptibility test, conversely to non-nitrate isolates are sensitive 35.7% & 57.1% in autumn and winter, respectively especially for felines against levofloxacin, tetracycline and amoxicillin in presence of vacA 100%, otherwise deficient vacA isolates of sheep; nitrate and non-nitrate biotypes from milk and congested gut in summer and spring, respectively representing cagA & hrgA 50% have sensitivity 0% till 28.6%. In conclusion, the highest resistance to cagA of H. pylori in autumn season and the highest sensitivity for hrgA in winter season was recorded.
Keywords: Helicobacter. pylori, Virulence genes, Antibiotic susceptibility, Felines and sheep
Received | July 09, 2024; Accepted | August 13, 2024; Published | August 31, 2024
*Correspondence | Mona Muhammed Mahmoud Ahmed. PhD Student, Department of Bacteriology, Immunity, and Mycology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia, Egypt; Email: [email protected]
Citation | Enany ME, Fadel HM, Abo-Shama UH, Ahmed MM, Kholief MEA (2024). Antibiotic susceptibility pattern against virulence genes of Helicobacter. pylori isolated from felines and sheep. Adv. Anim. Vet. Sci. 12(s1): 100-111.
DOI | https://dx.doi.org/10.17582/journal.aavs/2024/12.s1.100.111
ISSN (Online) | 2307-8316; ISSN (Print) | 2309-3331
Copyright: 2024 by the authors. Licensee ResearchersLinks Ltd, England, UK.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Introduction
H. pylori is a pathogenic bacterium, often associated with gastrointestinal diseases rather than benign coexistence, may be associated human and human diseased animal model disease as felines and sheep carrying different virulence genes related variable antimicrobial resistance (Ferrero and Fox, 2001) in variable seasonal incidence (Newell, 2001). Function of virulence genes contribute to the development of H. pylori related-diseases (Proença-Modena et al., 2009) that differ according to environmental factors of climate change (rainy or dry, high or low temperature, infected or hygienic) can influence bacterial prevalence that reflect on multiple antibiotic resistance drug action in vitro as well as vivo (Sailors, 2022) and, morphogenesis that was observed by a scanned electron microscope into rods or coccus (Krzyżek and Gościniak, 2018). While the direct impact of climate change on the expression of specific virulence genes is not well-documented, that could not interpretate seasonality of antimicrobial resistance (Sonnenberg, 2022). For example, the cause of the highest levels of H. pylori contamination at 32 °C for summer in Iran (7.36%) (Ranjbar et al., 2016), followed by (2.1% and 2%) from drinking water samples at 17 °C for spring and 16 °C for autumn, respectively is the high temperature, disagrees with the cause of coinfection of Egyptian children that increases more in winter than summer which have the highest prevalence of H. pylori (4.54%) (Ibrahim et al., 2019), depending upon biofilm formation. Thus, cultivation is more standard test H. pylori than PCR survey (Ndip et al., 2003) that commonly detected by multiplex PCR, in full consideration with biochemical properties of H. pylori effect on antimicrobial susceptibility within seasonal variations.
Therefore, the aim of the present work was selecting the best antibiotic for each virulence gene of H. pylori in each season of the year.
Materials and Methods
Ethical Approval
The animal under experiment were approved from the Research Ethics Committee, Faculty of veterinary medicine, Suez Canal University (Registration number: 2016100) to collect stool swabs from rectum of felines with sterile sticks into sterile tubes with buffer (Sabbagh et al., 2019), and collect gastric samples from immediately dead or euthanized felines by intracardiac injection of syringe 3 ml saline (Loeffler, 2018) with knowledge of veterinarian clinicians, and collect gastric and milk samples of sheep immediately after slaughtering, and milking in slaughter houses and farms of Hurghada and Sohag, respectively.
Sampling: During summer (2017) to spring (2021), (6 stomach and 46 stool) were collected after serodiagnosis of 52 felines in Animal care hospital (ACE) of Luxor and BLUE MOON clinician branch of Animal Friendship Social Organization of Hurghada, in addition to 83 sheep samples including (66 gastric and 17 milk) to scrub totally seventy-two gastric samples from apparently healthy slaughtered sheep and felines into saline until arrival for laboratory (Han et al., 1995) or thioglycolate broth (Stevenson et al., 2000) and, preserve the second flow of seventeen milk samples into sterile cups in an icebox with refrigerants to transport to the laboratory for centrifugation (Bertino et al., 2013).
Sero-examination by stool antigen HPSA for felines and serum latex agglutination IgG H. pylori for sheep: As instructed for Kits and labelled by date, number and sign of illness.
Isolation: Under sterile aseptic condition of Bensen flame according to (Bury-mone et al., 2006), enriched samples were inoculated for 36 – 48 hours onto thioglycolate broth (Himedia) India) supplemented with urea under microaerophilic conditions using CampyGen gas kit (10% co2, 85% N2) (Oxoid) (CN 0035A), cultured for 5 days at 37c on brain heart infusion BHI agar supplemented with antibiotics (vancomycin (EMC. UK.), and amphotericin B (Astellas Pharma. US).
Biochemical Differentiation
One hundred and thirty-five isolates out of totally collected samples were differentiated biochemically (Harper et al., 2003) by oxidase, catalase, urease and nitrate reduction, characterized by gram staining into gram negative rods or coccus.
Electron Microscope (E\M) for Scanning Representative Feline Isolates (Golding et al., 2016).
DNA extraction of H. pylori: According to instruction (QIA amp Kit) from which 1uL was used as the template for DNA amplification after one or two colonies were suspended in an Eppendorf tube from overnight culture on brain heart infusion agar plates, with 20 ml of sterile phosphate buffered saline and, vortexed vigorously for 2 minutes, then boiled in a water bath for 15 minutes, cooled in ice, and centrifuged a 13000 g for 1 minute to transfer the supernatant to another tube.
PCR detection of virulence genes H. pylori by using Gene Jet Genomic (Chattopadhyay et al., 2004) for DNA purification, including 25μL of master mix contained 10ng of the extracted DNA and 10pm of each primer in standard PCR buffer in PCR conditions of virulence genes vacA, cagA, and hrgA primers by thermal cycler (Eppendorf, Hamburg, Germany) as shown in table (A), consisted of an initial denaturation of target DNA at 95°C for 5 min, followed by 35 cycles of denaturation at 94°C for 30 s, primer annealing at 52°C for 1 min, and extension at 72°C for 1 min (Tiwari et al., 2007). The final cycle included extension for 7 min at 72°C to ensure full extension of the product to be electrophoresed 1.5% (Sambrook et al., 1989) and evaluated on a UV transilluminator.
Table (A): Primers used for identification of virulence genes of H. pylori
|
Primer |
Sequence |
Size |
References |
|
hrgA |
F: TCTCGTGAAAGAGAATTTCC |
594 |
(Ando et al., 2002) |
|
R: TAAGTGTGGGTATATCAATC |
|||
|
cagA |
F: GCGATTGTTATTGTGCTTGTAG |
499 |
(Elrais et al., 2022) |
|
R: GAAGTGGTTAAAAAACAATGCCCC |
|||
|
vacA |
F: ATGGAAATACAACAAACACAC |
2559 |
|
|
R: CTGCTTGAATGCGCCAAAC |
Antimicrobial susceptibility test (AST): According to the guidelines stipulated by “NCCLS”, fourteen discs of antibiotics (Cefazoline (CZ), Gentamicin (G), Tetracycline (T), Clarithromycin (CL), Metronidazole (M), Levofloxacin (Lev), Imipenem (I), Cephalothin (CN), Amoxicillin (AMX), Ciprofloxacin (CP), Amikacin (AK), Penicillin G (P), Nalidixic acid (N), and Rifampicin (RF)) (Basingstoke, Oxoid Hampshire, UK) were tested according to the single diffusion method (Chen et al., 2017) for the determination of the multiple antibiotic resistance (MAR) index by the formula MAR = No. of resistance \Total No. of tested antibiotics (Singh et al., 2010).
Statistical Analysis
Multivariate statistical Package software (MVSP version 3.2), to calculate the genetic similarity and construct the phylogenetic tree for cluster analysis by UPGMA (Unweighted Pair Group Method with Arithmetic Average) into Nitrate Group A (T & AMX), subgroup 1A (Lev, Cl, R, M, AK, CN, G, CZ), subgroup 2A (I, P, CP & N) as shown in Diagram 2 (B) and, Non-nitrate Group C (nitrate group A + Lev); (T, AMX & Lev) combined sub group C1 (Cl & RF) divided into class 1 & 2 of sub group C1: (M & AK) and (CN), respectively and, subgroup C2 (G, CZ & I) including class 1; (N, P & CP) as shown in Diagram 2 (A) in the following manner of susceptibility as shown in Diagram (1), according to Kovach (2007).
Results and Discussion
Table 1, In winter season, the lowest H. pylori isolation 1.23% was recovered from the highest positive survey serological 43.3%. Conversely to autumn, the highest isolation of H. pylori 25% was recovered from the highest negative serological survey 55.2%. Total Moderate high percent of isolation 14.2% & 10.5% were recorded from the lowest seronegative survey and lowest seropositive survey 9.7% & 10.1% in summer and spring respectively, compared to 0% isolation from less low negative serological survey of 8 sheep 27.5% in spring. Highest isolation from sheep reported 50% in negative seroprevalence in autumn, followed by 12.5% from positive serological survey in spring then descend into 6.2% from seronegative survey followed by 3.3% from seropositive survey in summer. Highest isolation from felines 50% occurred from seropositive survey in winter followed by 16.6% & 3.1 % from seronegative & seropositive, respectively in autumn that descended to zero isolation in spring and summer. Serodiagnosis is highly and moderate significance in seasons 0.001 & 0.0012 from sheep and felines, respectively as relation of combination diagnostic methods; PCR and serology is moderate significant 0.007 in total seasons but less significant by
Table 1: Seasonal serotypes of H. pylori isolate confirmed by PCR in felines and sheep.
|
Test |
+ve |
-ve |
Total |
Serotypes |
||||||
|
(+) |
(-) |
(+) |
(-) |
(+) |
(-) |
(+) |
||||
|
Serology |
(189) S:148 + F:41 |
(29) S:12 + F:17 |
(218) S:160 + F:58 |
Autumn |
Summer |
Spring |
Winter |
|||
|
S:11 F:32 |
S:4 F:12 |
S: 30 F: Nil |
S: 16 F: 5 |
S: 16 F: 3 |
S :8 F: Nil |
S:75 F:6 |
||||
|
P-value serology % of sheep |
< 0.001 (***) |
8.3 |
14.3 |
22.7 |
57.1 |
12.1 |
28.6 |
56.8 |
||
|
P-value serology % of felines |
0.0012 (**) |
78 |
70.6 |
0.0 |
29.4 |
7.3 |
0.0 |
14.6 |
||
|
Total (%) |
86.6 |
13.3 |
S:73.3 F:26.6 |
23.5 |
55.2 |
13.8 |
9.7 |
10.1 |
27.5 |
43.3 |
|
PCR |
7 S:3 + F:4 |
5 S: 3 + F: 2 |
12 S:6 + F:6 |
S:0 F:1 |
S: 2 F: 2 |
S: 1 |
F:0 S: 1 |
F:0 S: 2 |
S:0 |
S: 0 F:3 |
|
P-value PCR % of sheep |
0.035 (*) |
0.0 |
66.7 |
33.3 |
33.3 |
66.7 |
0.0 |
0.0 |
||
|
P-value PCR % of felines |
0.028 (*) |
25 |
100 |
0.0 |
0.0 |
0.0 |
0.0 |
75 |
||
|
Total (%) |
3.7% S: 2.0 F:9.7 |
17.2% S: 25 F: 11.7 |
5.5% S: 3.7 F: 10.3 |
2.3% F:3.1% |
25% F: 16.6 S:50 |
S: 3.3 |
14.2% S: 6.2 |
10.5% S:12.5 |
0 |
1.23% F:50 |
|
Total ratio No. (%) |
189:7 (96.4:3.6) |
29:5 85.3:14.7 |
P-value: 0.007 (**) |
|||||||
***: Highly significance. **: Moderate significance. *: Less significance. S: Sheep. F: Felines.
Table 2: MAR of resistant virulence genes recovered from sero-examined H. pylori infected animals.
|
Total virulence genes of biotypes H. pylori isolates in seasons |
Season |
||||||
|
Autumn (5\12) 41.6% |
Winter (3\12) 25% |
Spring (2\12) 16.6% |
Summer (2\12) 16.6% |
||||
|
virulent |
Avirulent |
||||||
|
Nitrate |
Non nitrate |
Non nitrate avirulent |
Non Nitrate virulent |
Non nitrate |
Nitrate |
Non nitrate |
|
|
MAR of H. pylori isolate recovered of clinical cases |
Clinical cases |
||||||
|
Constipated Panleukopenia felines 0.857 Normal sheep (1.0) |
Normal sheep 0.643 & prolapsed uterus feline 0.214 |
dead\ Diarrhea felines 0.428\ 0.857 |
Normal feline 0.428 |
Normal Congestion sheep 0.714\0.5 |
Milk 0.286 |
Congestion sheep 0.071 |
|
|
cagA |
3 |
2 |
1 |
1 |
1 |
1 |
0 |
|
vacA |
3 |
2 |
2 |
1 |
0 |
0 |
0 |
|
hrgA |
3 |
2 |
1 |
1 |
2 |
1 |
1 |
|
No. PCR of serology +ve |
0 |
1\43 |
3 |
2\19 |
1\30 |
0 |
|
|
Total ratio % |
0 |
2.3:97.7 |
None results of negative serology |
9.5:90.5 |
3.2:96.8 |
0 |
|
|
No. PCR of serology -ve |
3 |
1 |
Nil |
0\8 |
0 |
1\16 |
|
|
Total ratio % |
4\16 (20:80%) |
No ratio |
0:100 |
0 |
5.9:94.1 |
||
|
Sign (P-value) |
0.014 |
NS (0.365) |
NS (0.659) |
||||
PCR 0.035 & 0.028 from sheep and felines, respectively especially in autumn seasons as shown in Table 2, with less significance 0.014 and no significance of combination diagnostic methods in other seasons 0.365 & 0.659 that was differentiated by culture and bio typing.
Table 2 and 3, No significance of seasons 0.632 & 0.723 on frequency of virulence genes, as shown in Table 2, but bio typing H. pylori has highly significance 0.001 on antibiotic susceptibility for virulence genes in seasons, as shown in Table 3. Cag\vac\hrgA nitrate reductive H. pylori isolates, in percent 20% have no susceptibility against normal sheep with MAR (1.0) among autumn isolates 41.6% as shown in Table 2, compared to cag\vac\hrgA H. pylori in percent 40% from clinical felines constipated and pan-leukopenia in autumn have the highest susceptibility against nitrate group A (tetracyclines and amoxicillin), as the same to susceptibility nitrate biotype deficient vacA H. pylori from milk of sheep in summer with MAR (0.857 & 0.286), respectively in addition to, subgroup 1A plus imipenem in highest and moderate susceptibility 100 & 50% in summer against nitrate and non nitrate reductive isolates from milk and gut sheep, respectively than lesser susceptibility deficient hrgA H. pylori among percent 25% isolates in winter against non-nitrate reductive antibiotic group C1 (rifampicin and clarithromycin) plus their subclasses (metronidazole and amikacin) and cephalothin for suddenly dead felines, have MAR 0.428, respectively in nearly equal to the lowest susceptibility highly virulent isolate of normal sheep in frequency 20% have MAR 0.643 in autumn, as shown in Table 3. Lowest susceptibility of cag\vac\hrgA nitrate reductive H. pylori in autumn against nitrate antibiotic group (T & AMX, Lev, Cl, R, M, AK, CN, G, CZ, I, P & CP) have MAR 0.857 than susceptibility of vacA non-nitrate reductive biotype of diarheal, suddenly dead and normal feline isolates with MAR (0.857 & 0.428) against ciprofloxacin especially as class 1 of sub group C2, followed by group C and subgroup C1 and classes 1 & 2 in winter. The susceptibility of moderate incidence cagA 50% in spring increase against non-nitrate antibiotic group group C and clarithromycin as one of subgroup C1 with MAR 0.714, both of isolates from summer and spring in percent 16.6%, were susceptible against group C, followed by calarithromycin then rifampicin as subgroup C1 then class (1) of subgroup C.The highest susceptible H. pylori present in summer carry hrgA non nitrate reductive bioype isolate have MAR 0.071 than susceptibility hrgA that present in spring have MAR 0.5 from congested gut of apparently healthy sheep.
Table 4, Highest susceptibility of whole virulence genes against non- nitrate antibiotic group (C); tetracycline, amoxicillin and levofloxacin is 100% in winter & spring as well as clarithromycin as one of subgroup C1 represent 66.6% in spring in addition to class 1 of subgroup C1; metronidazole and amikacin and, subgroup C1 plus suscepti
Table 3: Number sensitive antimicrobial disc against percent seasonal occurrence virulent biotype H. pylori isolate from felines and sheep.
|
Nitrate |
Non nitrate |
||||||
|
Autumn |
Summer |
Autumn |
Spring |
Summer |
Winter |
||
|
cagA |
(2) 40% |
(1) 20% |
1 (100%) |
(2)40% |
50% |
0 |
(2) 66.6% |
|
vacA |
(2) 40% |
(1) 20% |
0 |
(2)40% |
0% |
0 |
(3) 100% |
|
hrgA |
(2) 40% |
(1) 20% |
(1) 50% |
(2)40% |
(2)100% |
(1) 50% |
(2) 66.6% |
|
P-value |
1.00 |
1.00 |
0.606 |
1.00 |
0.173 |
0.659 |
0.525 |
|
Sig. |
0.632 (NS) |
0.723 (NS) |
|||||
|
F:2 |
S:1 |
S:1 |
F:1 & S:1 |
S:2 |
S:1 |
F:3 |
|
|
N |
0 |
0 |
0 |
0 |
0 |
0 |
0 |
|
CP |
0 |
0 |
0 |
0 |
0 |
1 |
0 |
|
P |
0 |
0 |
0 |
0 |
0 |
1 |
0 |
|
I |
0 |
0 |
0 |
1 |
0 |
1 |
0 |
|
CZ |
0 |
0 |
1 |
1 |
0 |
1 |
0 |
|
G |
0 |
0 |
1 |
1 |
0 |
1 |
0 |
|
CN |
0 |
0 |
1 |
1 |
0 |
1 |
2 |
|
AK |
0 |
0 |
1 |
1 |
1 |
1 |
2 |
|
M |
0 |
0 |
1 |
1 |
1 |
1 |
2 |
|
R |
0 |
0 |
1 |
2 |
1 |
1 |
2 |
|
Cl |
0 |
0 |
1 |
2 |
1 |
1 |
2 |
|
lev |
0 |
0 |
1 |
2 |
2 |
1 |
3 |
|
T |
2 |
0 |
1 |
2 |
2 |
1 |
3 |
|
AMX |
2 |
0 |
1 |
2 |
2 |
1 |
3 |
|
Sensitive |
2 |
0 |
5 |
4 |
0 |
8 |
|
|
Resistant |
0 |
10 |
6 |
3 |
13 |
0 |
|
|
Highly Resistant |
12 |
4 |
3 |
7 |
1 |
6 |
|
|
MAR |
0.857 |
1.0 |
0.286 |
0.643, 0.428 & 0.214 |
0.714 & 0.5 |
0.071 |
0.428 & 0.857 |
Table 4: Percent seasonal antimicrobial susceptibility biotypes H. pylori isolate associated virulence genes.
|
AB discs |
Nitrate |
Non nitrate |
||||||||||||
|
Autumn |
Summer |
Autumn |
Spring |
Summer |
Winter |
|||||||||
|
C:3 |
V:3 |
H:3 |
H:1 |
C :1 |
C:2 |
V:2 |
H:2 |
C:1 |
H: 2 |
H:1 |
C:2 |
H:2 |
V:3 |
|
|
T |
60 |
60 |
60 |
50 |
100 |
40 |
40 |
40 |
100 |
100 |
50 |
100 |
100 |
100 |
|
AMX |
60 |
60 |
60 |
50 |
100 |
40 |
40 |
40 |
100 |
100 |
50 |
100 |
100 |
100 |
|
Lev |
0 |
0 |
0 |
50 |
100 |
40 |
40 |
40 |
100 |
100 |
50 |
100 |
100 |
100 |
|
CL |
0 |
0 |
0 |
50 |
100 |
40 |
40 |
40 |
100 |
100 |
50 |
50 |
50 |
66.6 |
|
R |
0 |
0 |
0 |
50 |
100 |
40 |
40 |
40 |
0 |
50 |
50 |
50 |
50 |
66.6 |
|
M |
0 |
0 |
0 |
50 |
100 |
20 |
20 |
20 |
0 |
50 |
50 |
50 |
50 |
66.6 |
|
AK |
0 |
0 |
0 |
50 |
100 |
20 |
20 |
20 |
0 |
50 |
50 |
50 |
50 |
66.6 |
|
CN |
0 |
0 |
0 |
50 |
100 |
20 |
20 |
20 |
0 |
0 |
50 |
50 |
50 |
66.6 |
|
G |
0 |
0 |
0 |
50 |
100 |
20 |
20 |
20 |
0 |
0 |
50 |
0 |
0 |
0 |
|
CZ |
0 |
0 |
0 |
50 |
100 |
20 |
20 |
20 |
0 |
0 |
50 |
0 |
0 |
0 |
|
I |
0 |
0 |
0 |
50 |
100 |
20 |
20 |
20 |
0 |
0 |
50 |
0 |
0 |
0 |
|
CP |
0 |
0 |
0 |
0 |
0 |
0 |
0 |
0 |
0 |
0 |
50 |
0 |
0 |
0 |
|
P |
0 |
0 |
0 |
0 |
0 |
0 |
0 |
0 |
0 |
0 |
50 |
0 |
0 |
0 |
|
Sensitive |
14.3 |
0 |
35.7 |
28.6 |
0 |
57.1 |
||||||||
|
Resistant |
0 |
71.4 |
42.9 |
21.4 |
92.9 |
0 |
||||||||
|
Highly Resistant |
85.7% |
28.6 |
21.4 |
50 |
7.1 |
42.9 |
||||||||
|
P-value |
< 0.001 (***) |
< 0.001 (***) |
||||||||||||
|
MAR |
1.0 & 0.857 |
0.286 |
0.214 & 0.643 |
0.714 & 0.5 |
0.071 |
0.428 & 0.857 |
||||||||
bility class 2 in winter while moderate susceptibility hrgA represent in spring 50% against one of subgroup C1 as rifampicin and class 1 but hrgA in summer have also moderate susceptibility 50% against subgroup 2A, especially against nitrate reductive H. pylori. The lowest susceptibility of the highest virulence gene of non-nitrate reductive isolates was 40% in autumn against group C; tetracycline, amoxicillin, and levofloxacin and subgroup C1; clarithromycin, and rifampicin. Nitrate and non-nitrate virulent H. pylori has highly significance < 0.001 on susceptibility antibiotics in seasons.
Table 5, Winter is season of susceptibility levofloxacin, clarithromycin and rifampicin in 75-66.7% from virulent H. pylori of felines than susceptibility deficient vacA and moderate cagA from sheep (40-50%) in summer, in addition to amikacin & metronidazole 66.7%, cefazolin & gentamycin and cephalothin plus imipenem 100% but highly virulent isolates in autumn have total sensitivity; 50%, 41.7%, 25% and 16.7%, respectively. Deficient vacA isolates from sheep in summer have the low moderate susceptibility against tetracycline and amoxicillin 40% than felines 50%, especially levofloxacin and clarithromycin 25- 33.3%, respectively from highly virulent isolates in autumn which increase to 50% in summer against rifampicin for deficient vacA and moderate cagA sheep isolates in total susceptibility metronidazole and amikacin 50%, reporting the highest susceptibility especially, ciprofloxacin and penicillin for deficient vacA isolates of sheep is totally 8.3% increase than vacA isolates of felines in summer but in the same susceptibility cephazolin & gentamycin and imipenem in total 16.7 and 25%, respectively in all seasons.
Helicobacter is a seasoned pathogen (Ahmed et al., 2009) like Helicobacter pylori (bcc3) among oxygen-consuming bacteria express only one oxygen reductase (André et al., 2021) in extracellular bacteria colonization on host tissues or within biofilms by aero protection strategy (André et al., 2021), listed as ‘priority pathogens’ by the WHO (Suzuki et al., 2022). Under increased temperature, pathogenic bacteria producing nitrogen oxide related by cagA as powerful virulence properties for hydrogen metabolism of H. pylori from nitrate reduction for antimicrobial resistance (Wang et al., 2016). Less significance of diagnosis H. pylori by PCR from highly and moderate significance of seroprevalence 0.001 & 0.0012 was 0.035 & 0.028, respectively as shown in Table 1, that be commonly investigated in autumn season from clinical cases felines and normal sheep have MAR 0.857 and 1.0 in percent of isolates 41.6% as shown in Table 2, that detected by highly significance diagnostic methods combination from PCR and serodiagnosis in 0.014 as shown in Table 3, which agree with highly significance 0.0001 of low susceptibility 60% and the highest antibiotic resistance of nitrate H. pylori biotypes among incidence cag\vac\hrgA 40% & 20% in non-significance 0.0632 against nitrate group A antibiotics as shown in Table 4
Table 5: Total Antimicrobial susceptibility of seasonal H. pylori isolates from felines and sheep
|
|
Susceptible Felines in |
Susceptible Sheep |
Total sensitivity |
Total resistance |
||||||||||
|
A |
W |
A |
S |
SP |
||||||||||
|
N |
% |
N |
% |
N |
% |
N |
% |
N |
% |
N |
% |
N |
% |
|
|
N |
0 |
0.0 |
0 |
0.0 |
0 |
0 |
0 |
0 |
0 |
0 |
0 |
0 |
12 |
100 |
|
CP, P |
0 |
0.0 |
0 |
0.0 |
0 |
0 |
1 |
100 |
0 |
0 |
1 |
8.3 |
11 |
91.7 |
|
I |
1 |
100 |
0 |
0.0 |
0 |
0 |
1 |
100 |
0 |
0 |
2 |
16.7 |
10 |
83.3 |
|
CZ, G |
1 |
100 |
0 |
0.0 |
0 |
0 |
2 |
100 |
0 |
0 |
3 |
25 |
9 |
75.0 |
|
CN |
1 |
50.0 |
1 |
50.0 |
0 |
0 |
2 |
100 |
0 |
0 |
4 |
41.7 |
7 |
58.3 |
|
AK, M |
2 |
66.7 |
1 |
33.3 |
0 |
0 |
2 |
66.7 |
1 |
33.3 |
6 |
50 |
6 |
50.0 |
|
R |
1 |
33.3 |
2 |
66.7 |
1 |
25 |
2 |
50 |
1 |
25 |
7 |
58 |
5 |
41.7 |
|
CL |
1 |
33.3 |
2 |
66.7 |
2 |
40 |
2 |
40 |
1 |
20 |
8 |
66.6 |
4 |
33.3 |
|
Lev |
1 |
25.0 |
3 |
75.0 |
2 |
40 |
2 |
40 |
1 |
20 |
9 |
75 |
3 |
25.0 |
|
T & AMX |
3 |
50.0 |
3 |
50.0 |
2 |
40 |
2 |
40 |
1 |
20 |
11 |
91.7 |
1 |
8.3 |
|
P-value |
0.757 |
0.948 |
0.0038 |
|||||||||||
|
Sig |
NS |
NS |
** |
|||||||||||
A: Autumn. S: Summer. SP: Spring. W: Winter.
that bind nitrate metabolites perhaps resulted from immune physiological mechanisms. Thus depending on nitrate reduction of isolates upon cagA status of H. pylori, the highly significance and less significance of each serology and PCR prevalence 0.0001 & 0.35 as shown in Table 1, provided the highest susceptibility nitrate and non-nitrate antibiotic group 100% in non-significance 0.0632 & 0.0723, respectively for different incidence of cagA 66.6%, 50% and (100% and zero) in winter, spring and summer, respectively, especially from sheep isolates which were tested in non-significance 0.659 & 0.365 of diagnostic methods combination; PCR and serodiagnosis in incidence 16.6% in spring and summer as shown in Tables 2 and 3, may be differentiated by energy expenditure from acquisition hydrogen as molecular source present from other bacteria (Benoit et al., 2020) as from higher contamination in summer making susceptibility nitrate and non-nitrate antibiotic group as penicillin group in less MAR 0.286 for nitrate biotype cagA from milk of apparently healthy sheep where MAR descend more for deficient cagA\vacA non-nitrate biotype H. pylori from congested gastric sheep to be susceptible 50% in presence of 50% hrgA have MAR 0.071, as shown in Table 3. While higher resistance non-nitrate H. pylori perhaps present because lockage moisture in spring releasing high energy reductants (MacKichan., 2004) for avoiding oxygen diffusing within host organs by oxygen reductases from the bacterial genome, which is probably insufficient to assess their function and role during infectious processes (André et al., 2021), resulted MAR (0.714 and 0.5) for hrgA 50% and 100%, respectively and cagA 50%, theoretical moderate and full susceptibility as shown in Table 4. The seasonality of H. pylori depending energy of H. pylori metabolites that does not possess genes for a nitrate reductase (Marais et al., 1999) correlate with immunity host causing carcinogenesis in an animal model (Lu et al., 2018), interpretating a decreasing susceptibility between spring and autumn in 0%, 20% 40% and 50%, compared moderate susceptibility in spring for non- nitrate reductive deficient cagA H. pylori from apparently healthy sheep against metronidazole, amikacin, and rifampicin 50% with exception full susceptibility clarithromycin, levofloxacin, tetracycline, and amoxicillin 100% as shown in Table 4, and resistance gut infected clinical felines as panleukopenia and constipated felines with 60% susceptibility of nitrate biotype against tetracycline and amoxicillin in presence vacA prevalence 40% in autumn in addition to full resistance 100% of isolate from normal sheep in MAR 1.0 in prevalence vacA 20% that the same prevalence for non-nitrate biotype from normal sheep and uterine prolapsed feline in MAR 0.643 & 0.214, respectively in nearly moderate low susceptibility 20-40% as shown in Table 3. Auto urea transporter gene vacA incidence releasing energy utilizing nitrogen where urease gene metabolism functions based upon high protein diet in that season (Obitsu et al., 2011) when autumn is a wet season under high ambient temperature may provide favorable conditions for H. pylori proliferation in animals’ gastrointestinal tracts which is reflected by susceptibility of higher contamination observed in September and October in Dhamar (Almashhadany et al., 2023).
The lower vacA incidence 1.23% in total felines 50% from positive serological survey 43.3% in winter as shown in Table 1, related the highest susceptibility 100% of non-nitrate antibiotic group C; tetracycline, amoxicillin and levofloxacin for the highest incidence of hrgA 100% than the moderate susceptibility of metronidazole, amikacin, ciprofloxacin,
rifampicin and clarithromycin in 50 & 66.6% for incidence cag\hrgA 66.6%, as shown in Table 3 when seasonal patterns as endemic health factors reflect on colonizing the inflamed gut of diarrheal felines in winter through frequency vacA 100% with no association cagA or nitrate reduction in high resistance MAR 0.857 caused limiting antibiotic absorption by reduced metabolic activity and increasing its chance of survival led to decreasing the amounts of cytoplasm and proteins, which gives a higher resistance (Rosli et al., 2024), especially gentamycin and group penicillin, similar to the Venezuela study where H. pylori infection frequency was significantly higher during the rainy season (96%) than during the dry season (Domínguez-Bello et al., 2002), or whenever were caused by low bacterial load and low expression of Epidermal Growth Factor (EGF) & Heat Shock Protein (HSP) induced by ribosomes from normal or dead felines related lockage immunity physiological process (Yuan et al., 2015), respectively in moderate lower resistance 0.428 as shown in Table 3. At colonization level of urea transporters vacA in gut tissue species as felines (Joosten et al., 2016) or membrane-associated nickel-containing hydrogenases (Wang et al., 2016) as hydrogen-utilizing normal and congested gut sheep, energy generation for binding and then “splitting” of hydrogen gas upon electric charges of organ specificity (Domnin et al., 2022) continued energy metabolism by oxygen reductase (Sah et al., 2023) like H. pylori coccoid of constipated felines present in autumn in higher MAR 0.857 as representative isolates by electron microscope E\M otherwise rods of normal felines with MAR 0.428 in winter as shown Figure (1 and 2) and Table (2) similar to H. pylori coccoid that increased pyruvate oxidoreductase POR expression in the fall of 2003 (Zeng et al., 2008). Compared between total cag\hrgA 10.5% from 10.1% seropositive animals of 12.5% sheep in spring, and low occurrence H. pylori positive and negative PCR in sheep 3.3% and 14.2% from seroprevalence 13.8% and 9.7%, respectively forming total PCR positive and negative test 3.3% & 6.2% in absence of vacA in summer, as shown in Table (1), moderate and full susceptibility H. pylori was recorded in 50-100% as shown in Table (3), similar to more resistance of hrgA\cagA H. pylori nitrate reductive biotypes from milk in summer is being 0.286 otherwise the lowest resistance of deficient cagA non-nitrate reductive biotypes from congested sheep 0.071 as shown in Table (2 and 3), may be because elevated metabolites which could be part of antibiotic resistance mechanisms more expressed by high metabolic activity (Lin et al., 2023) that are essential to sustain energy-demanding AMR processes; such as cell-wall changes and efflux pump overexpression (Kok et al., 2022). However, susceptibility followed by 91.7%-16.7 percentage in autumn against all antibiotics except penicillin and cephalothin as shown in Table (5) while moderate low resistance 42.9% and 21.4% susceptibility from 23.5% seropositive felines and sheep prevalence monitored in autumn as shown in Table (4), against non-nitrate reductive H. pylori vacA from normal sheep and total felines as uterine prolapsed feline 3.1% as shown in Table (1) according to the ability to conserve energy in form of adenosine triphosphate (ATP) through generation of a transmembrane proton motive force (Prakasham and Kumar., 2019) as a compact and high-energy substrate for respiratory (Wang et al., 2016), followed by oxidation of ammonia resulted in denitrifying and antibiotic susceptibility or may be due to releasing a hydrogen molecule as a source of energy (Olson and Maier, 2002) leading to nitrate reduction resulted in binding ribosomes and antibiotic resistance. Concluding autumn season have vacA H. pylori incidence 41.6% as shown in Table (2) is season for antibiotic resistance in the present study.
Susceptibility of metronidazole, amikacin, a group of penicillin, gentamycin, and imipenem against each virulence gene of non-nitrate biotype H. pylori from apparently healthy felines and normal sheep of autumn in percent 20%, as shown in Tables 2 and 3, has MAR (0.214 and 0.643), especially against non-nitrate antibiotic group C and subgroup C1, as shown in Table (4) even though other one normal sheep is resistant 100%, that interpretated perhaps through the extremely cold temperature that increases the gastric acid secretion (Liu et al., 2006) when the ratio of urea-N production to digestible N was increased after decreasing gut urea-N entry in presence vacA (Obitsu et al., 2011) to represents the higher incidence of hrgA 66.6% with the highest susceptibility in range 91.7%-41.7% in highly significance 0.0001 against prevalence felines in winter 25% as shown in Table (2 and 5) than hrgA incidence 40% in autumn was represented through the extremely hot temperature as Nitric Oxide Synthase in the gastric mucosa by serine protease High temperature requirement HTrA protein (Zarzecka et al., 2019) in total nitrate vacA gene incidences 60% in autumn of felines and sheep prevalence by PCR 25% recovered from seronegative 55.2% in total genetic felines infected with H. pylori incidence 2.3%, providing full high resistance in moderate significance 0.0012 but in total less significance 0.0028 as shown in Table (1), concluding hrgA is the highest susceptible virulence gene to antibiotics in presence vacA, especially in winter as reported in the present study.
All seasons have the highest resistance that decrease gradually with exception summer when highly susceptibility against sheep ranging between 100%-16.6 percentage with exception imipenem and group of penicillin, susceptibility in followed by spring and autumn 100%-50%. Then resistance is ascending in spring against metronidazole, amikacin, ciprofloxacin, rifampicin, clarithromycin and levofloxacin 16.6% as shown in Table (5), that specifically do not reveal any resistance against tetracycline and amoxicillin in autumn and winter as shown in Diagram (1) in total moderate significance 0.0038 of sensitivity and resistance but with non-significance for felines and sheep 0.757 & 0.948, respectively as shown in Table (1). So, the present survey of our seasonality results driving no need of antibiotic eradication program on H. pylori in summer in contrast to autumn and spring, which is being against biochemical function in presence of virulence genes than its genetic resistance in highly significance of combination PCR and serology 0.0007 as shown in Table (2), in proportional to first study investigating gene expression changes (Upadhyay et al., 2023). Sparacino-Watkins et al., (2014) confirmed the importance of total seasonality toward the global respiration nitrogen cycle that metabolize nitrogen as mode action of resistance microbes for energy transduction, detoxification, or assimilation.
Conclusions and Recommendations
Seasonal follow up of antibiotic therapy programming against nitrate reaction is considered diagnostic survey of each virulence gene of H. pylori till quantifying energy expenditure from oxygen reduction level (precursor of metabolites) within infected cells as the next challenge.
Acknowledgments
Many thanks to the Ph.D. supervisors and all Members of the Bacteriology Department and zoonosis Department, faculty of veterinary medicine, Suez Canal university. Special thanks to Food Analysis Center, Banha University for the best cooperation during research work.
Author’s contributions
Dr. Mohamed El Sayed Enany, first supervisor supports my conceptualization with valuable comments to work interestingly and cooperatively for conceptualization. Dr. Hanaa Mohamed Fadel, second supervisor provided materials for finishing laboratory methods. Dr. Usama Hassan Abo-Shama, third supervisor performed reviewed the abstract, results and references, Dr. Mona Muhammad Mahmoud as corresponding author, study design, collected data, interpreted results in statistical analysis and wrote paper. Dr. Mohamed Ezzat Abdel gaied Kholief revised the draft manuscript, suggested title, designed tables, add figures and approved the final version of the manuscript in addition to the financial contribution.
Novelty Statement
Grouping antibiotic susceptibility for each virulence gene of (nitrate reductive) bio-types H. pylori is newly reported against highly resistance cagA in autumn and highly susceptibility hrgA in winter that be interpretative in different view through the present study.
Funding
The author(s) received no financial support for the research, authorship, and/or publication of this article.
IRB Approval
The study was approved from the Research Ethics Committee, Faculty of veterinary medicine, Suez Canal University (Registration number: 2016100). As recorded under Ethical Approval.
Conflict of Interest
There is no conflict of interest declared by the authors.
References
Ahmed, N., Tenguria, S. and Nandanwar, N. Helicobacter pylori-a seasoned pathogen by any other name. Gut pathogens, 2009; 1, pp.1-6. https://doi.org/10.1186/1757-4749-1-24
Almashhadany, D.A., Mayas, S.M., Omar, J.A. and Muslat, T.A. Frequency and seasonality of viable Helicobacter pylori in drinking water in Dhamar Governorate, Yemen. Italian Journal of Food Safety, 2023; 12(3). https://doi.org/10.4081/ijfs.2023.10855
André, A.C., Debande, L. and Marteyn, B.S. The selective advantage of facultative anaerobes relies on their unique ability to cope with changing oxygen levels during infection. Cellular Microbiology, 2021; 23(8), p.e13338. https://doi.org/10.1111/cmi.13338
Benoit, S.L., Maier, R.J., Sawers, R.G. and Greening, C. Molecular hydrogen metabolism: a widespread trait of pathogenic bacteria and protists. Microbiology and Molecular Biology Reviews, 2020; 84(1), pp.10-1128. https://doi.org/10.1128/MMBR.00092-19
Bertino E, Giribaldi M, Baro C, Giancotti V, Pazzi M, Peila C. Effect of prolonged refrigeration on the lipid profile, lipase activity, and oxidative status of human milk. Journal of pediatric gastroenterology and nutrition, 2013, 6(4): 390-6. https://doi.org/10.1097/MPG.0b013e31827af155
Bury-Moné, S., Kaakoush, N. O., Asencio, C., Mégraud, F., Thibonnier, M., De Reuse, H., & Mendz, G. L. (2006). Is Helicobacter pylori a true microaerophile? Helicobacter, 11(4), 296-303.
Chattopadhyay, S., Patra, R., Ramamurthy, T., Chowdhury, A., Santra, A., Dhali, G.K., Bhattacharya, S.K., Berg, D.E., Nair, G.B. and Mukhopadhyay, A.K. Multiplex PCR assay for rapid detection and genotyping of Helicobacter pylori directly from biopsy specimens. Journal of clinical microbiology, 2004; 42(6), pp.2821-2824. https://doi.org/10.1128/JCM.42.6.2821-2824.2004
Chen, D., Cunningham, S.A., Cole, N.C., Kohner, P.C., Mandrekar, J.N., Patel, R. Phenotypic and molecular antimicrobial susceptibility of Helicobacter pylori. Antimicrobial agents and chemotherapy.2017; 61(4): 10.1128/aac. 02530-16. https://doi.org/10.1128/AAC.02530-16
Domínguez-Bello, M.G., Beker, B., Guelrud, M., Vivas, J., Peraza, S., Pérez, M.E. and Pericchi, L.R. socioeconomic and seasonal variations of Helicobacter pylori infection in patients in Venezuela. The American journal of tropical medicine and hygiene, 2002; 66(1), pp.49-51. https://doi.org/10.4269/ajtmh.2002.66.49
Domnin, P.A., Parfenov, V.A., Kononikhin, A.S., Petrov, S.V., Shevlyagina, N.V., Arkhipova, A.Y., Koudan, E.V., Nezhurina, E.K., Brzhozovskiy, A.G., Bugrova, A.E. and Moysenovich, A.M. Combined Impact of Magnetic Force and Spaceflight Conditions on Escherichia coli Physiology. International Journal of Molecular Sciences, 2022; 23(3), p.1837. https://doi.org/10.3390/ijms23031837
Ferrero, R.L. and Fox, J.G. In Vivo Modeling of Helicobacter-Associated Gastrointestinal Diseases. Helicobacter pylori: physiology and genetics, 2001; pp.565-582. https://doi.org/10.1128/9781555818005.ch45
Golding, C.G., Lamboo, L.L., Beniac, D.R., & Booth, T.F. The scanning electron microscope in microbiology and diagnosis of infectious disease. Scientific reports, 2016; 6(1), 1-8. https://doi.org/10.1038/srep26516
Gong, M., Han, Y., Wang, X., Tao, H., Meng, F., Hou, B., Sun, B.B. and Wang, G. Effect of temperature on metronidazole resistance in Helicobacter pylori. Frontiers in Microbiology, 2021; 12, p.681911. https://doi.org/10.3389/fmicb.2021.681911
Han, S.W., Flamm, R., Hachem, C.Y., Kim, H.Y., Clarridge, J.E., Evans, D.G., Beyer, J., Drnec, J. and Graham, D.Y. Transport and storage of Helicobacter pylori from gastric mucosal biopsies and clinical isolates. European Journal of Clinical Microbiology and Infectious Diseases, 1995; 14, pp.349-352. https://doi.org/10.1007/BF02116531
Harper, C.G., Xu, S., Rogers, A.B., Feng, Y., Shen, Z., Taylor, N.S., Dewhirst, F.E., Paster, B.J., Miller, M., Hurley, J. and Fox, J.G. Isolation and characterization of novel Helicobacter spp. from the gastric mucosa of harp seals Phoca groenlandica. Diseases of aquatic organisms, 2003; 57(1-2), pp.1-9. https://doi.org/10.3354/dao057001
Hoshina, S., Kahn, S.M., Jian, W., Green, P.H., Neu, H.C., Chin, N., Morotomi, M., LoGerfo, P. and Weinstein, I.B. Direct detection and amplification of Helicobacter pylori ribosomal 16S gene segments from gastric endoscopic biopsies. Diagnostic microbiology and infectious disease, 1990; 13(6), pp.473-479. https://doi.org/10.1016/0732-8893(90)90079-B
Ibrahim, A., Ali, Y.B., Abdel-Aziz, A. and El-Badry, A.A. Helicobacter pylori and enteric parasites co-infection among diarrheic and non-diarrheic Egyptian children: seasonality, estimated risks, and predictive factors. Journal of Parasitic Diseases, 2019; 43, pp.198-208. https://doi.org/10.1007/s12639-018-1075-y
Joosten, M., Lindén, S., Rossi, M., Tay, A.C.Y., Skoog, E., Padra, M., Peters, F., Perkins, T., Vandamme, P., Van Nieuwerburgh, F. and D’Herde, K. Divergence between the highly virulent zoonotic pathogen Helicobacter heilmannii and its closest relative, the low-virulence “Helicobacter ailurogastricus” sp. nov. Infection and Immunity, 2016; 84(1), pp.293-306. https://doi.org/10.1128/IAI.01300-15
Kok, M., Maton, L., van der Peet, M., Hankemeier, T. and van Hasselt, J.C. Unraveling antimicrobial resistance using metabolomics. Drug Discovery Today, 2022; 27(6), pp.1774-1783. https://doi.org/10.1016/j.drudis.2022.03.015
Kovach, W.L. MVSP - A Multivariate Statistical Package for Windows, ver. 3.2. Kovach Computing Services, (2007); Pentraeth, Wales, U.K.
Krzyżek, P., & Gościniak, G. (2018). Morphology of Helicobacter pylori as a result of peptidoglycan and cytoskeleton rearrangements. Gastroenterology Review/Przegląd Gastroenterologiczny, 13(3), 182-195.
Lin, Y., Shao, Y., Yan, J. and Ye, G. Antibiotic resistance in Helicobacter pylori: From potential biomolecular mechanisms to clinical practice. Journal of Clinical Laboratory Analysis, 2023; 37(7), p.e24885. https://doi.org/10.1002/jcla.24885
Liu, D.Y., Gao, A.N., Tang, G.D., Yang, W.Y., Qin, J., Wu, X.G., Zhu, D.C., Wang, G.N., Liu, J.J. and Liang, Z.H., Relationship between onset of peptic ulcer and meteorological factors. World Journal of Gastroenterology: WJG, 2006; 12(9), p.1463. https://doi.org/10.3748/wjg.v12.i9.1463
Loeffler, I.K. 2018; Euthanasia in veterinary field projects. Field Manual for Small Animal Medicine: 289-306. https://doi.org/10.1002/9781119380528.ch12
Lu, C., Yu, Y., Li, L., Yu, C. and Xu, P. Systematic review of the relationship of Helicobacter pylori infection with geographical latitude, average annual temperature and average daily sunshine. BMC gastroenterology, 2018; 18, pp.1-9. https://doi.org/10.1186/s12876-018-0779-x
MacKichan, J.K., 2004; Gene regulation and colonization in Helicobacter pylori and Campylobacter jejuni. Stanford University.
Marais, A., Mendz, G.L., Hazell, S.L. and Mégraud, F. Metabolism and genetics of Helicobacter pylori: the genome era. Microbiology and molecular biology reviews, 1999;63(3), pp.642-674. https://doi.org/10.1128/MMBR.63.3.642-674.1999
Ndip, R. N., MacKay, W. G., Farthing, M. J., Weaver, L. T. Culturing Helicobacter pylori from clinical specimens: review of microbiologic methods. Journal of pediatric gastroenterology and nutrition, 2003; 36(5), 616-622. https://doi.org/10.1097/00005176-200305000-00005
Newell, D.G. Animal models of Campylobacter jejuni colonization and disease and the lessons to be learned from similar Helicobacter pylori models. Journal of Applied Microbiology, 2001; 90(S6), pp.57S-67S. https://doi.org/10.1046/j.1365-2672.2001.01354.x
Obitsu, T., Kamiya, M., Kamiya, Y., Tanaka, M., Sugino, T., Taniguchi, K. Effects of high ambient temperature on urea-nitrogen recycling in lactating dairy cows. Animal Science Journal, 2011; 82 (4), 531-536. https://doi.org/10.1111/j.1740-0929.2011.00880.x
Olson, J.W. and Maier, R.J. Molecular hydrogen as an energy source for Helicobacter pylori. Science, 2002;298(5599), pp.1788-1790. https://doi.org/10.1126/science.1077123
Prakasham, R.S. and Kumar, B.S. Bacterial metabolism–coupled energetics. In Microbial Electrochemical Technology 2019; (pp. 227-260). Elsevier. https://doi.org/10.1016/B978-0-444-64052-9.00009-1
Proença-Modena, J.L., Acrani, G.O. and Brocchi, M., 2009; Helicobacter pylori: phenotypes, genotypes and virulence genes. https://doi.org/10.2217/17460913.4.2.223
Ranjbar, R., Khamesipour, F., Jonaidi-Jafari, N. and Rahimi, E. Helicobacter pylori isolated from Iranian drinking water: vacA, cagA, iceA, oipA and babA2 genotype status and antimicrobial resistance properties. FEBS Open Bio, 2016; 6(5), pp.433-441. https://doi.org/10.1002/2211-5463.12054
Rosli, N.A., Al-Maleki, A.R., Loke, M.F., Tay, S.T., Rofiee, M.S., Teh, L.K., Salleh, M.Z. and Vadivelu, J. Exposure of Helicobacter pylori to clarithromycin in vitro resulting in the development of resistance and triggers metabolic reprogramming associated with virulence and pathogenicity. Plos one, 2024; 19(3), p.e0298434. https://doi.org/10.1371/journal.pone.0298434
Sabbagh, P., Mohammadnia-Afrouzi, M., Javanian, M., Babazadeh, A., Koppolu, V., Vasigala, V.R., Nouri, H.R. and Ebrahimpour, S. Diagnostic methods for Helicobacter pylori infection: ideals, options, and limitations. European Journal of Clinical Microbiology & Infectious Diseases, 2019; 38, pp.55-66. https://doi.org/10.1007/s10096-018-3414-4
Sah, D.K., Arjunan, A., Lee, B. and Jung, Y.D. Reactive Oxygen Species and H. pylori Infection: A Comprehensive Review of Their Roles in Gastric Cancer Development. Antioxidants, 2023; 12(9), p.1712. https://doi.org/10.3390/antiox12091712
Sailors, M.E., 2022. Tracking the Source of Helicobacter pylori in Watersheds of San Juan, Puerto Rico.
Sambrook J, Fritsch EF, Maniatis T. 1989, Molecular cloning: a laboratory manual: Cold spring harbor laboratory press. ISBN; 978-1-936113-42-2.
Singh S, Yadav AS, Singh SM, Bharti P. Prevalence of Salmonella in chicken eggs collected from poultry farms and marketing channels and their antimicrobial resistance. 2010. Food Research International; 43(8): 2027-30. https://doi.org/10.1016/j.foodres.2010.06.001
Sonnenberg, A., 2022. Epidemiology of Helicobacter pylori. Alimentary Pharmacology & Therapeutics, 55, pp. S1-S13. https://doi.org/10.1111/apt.16592
Sparacino-Watkins, C., Stolz, J.F. and Basu, P. Nitrate and periplasmic nitrate reductases. Chemical Society Reviews, 2014;43 (2), pp.676-706. https://doi.org/10.1039/C3CS60249D
Standards Laboratory Clinical for Committee National susceptibility antimicrobial for standards performance “NCCLS” (2001): testing. Supplement M 100-S111. Villanova, PA, USA.
Stevenson, T., Castillo, A., Lucia, L., Acuff, G. (2000). Growth of Helicobacter pylori in various liquid and plating media. Letters in Applied Microbiology, 30(3), 192-196.
Suzuki, S., Kusano, C., Horii, T., Ichijima, R. Ikehara, H. The ideal Helicobacter pylori treatment for the present and the future. Digestion, 2022; 103(1), pp.62-68. https://doi.org/10.1159/000519413
Tiwari, S.K., Khan, A.A., Manoj, G., Ahmed, S., Abid, Z., Habeeb, A. and Habibullah, C.M. A simple multiplex PCR assay for diagnosing virulent Helicobacter pylori infection in human gastric biopsy specimens from subjects with gastric carcinoma and other gastro-duodenal diseases. Journal of applied microbiology, 2007; 103(6), pp.2353-2360. https://doi.org/10.1111/j.1365-2672.2007.03478.x
Upadhyay Banskota, S., Skupa, S.A., El-Gamal, D., D’Angelo, C.R. Defining the role of the gut microbiome in the pathogenesis and treatment of lymphoid malignancies. International journal of molecular sciences, 2023; 24(3), p.2309. https://doi.org/10.3390/ijms24032309
Wang, G., Romero-Gallo, J., Benoit, S.L., Piazuelo, M.B., Dominguez, R.L., Morgan, D.R., Peek Jr, R.M., Maier, R.J. Hydrogen metabolism in Helicobacter pylori plays a role in gastric carcinogenesis through facilitating CagA translocation. MBio, 2016; 7(4), pp.10-1128. https://doi.org/10.1128/mBio.01022-16
Wu, X., Zhang, H., Chen, J., Shang, S., Wei, Q., Yan, J., Tu, X. Comparison of the fecal microbiota of dholes high-throughput Illumina sequencing of the V3–V4 region of the 16S rRNA gene. Applied microbiology and biotechnology, 2016; 100, pp.3577-3586. https://doi.org/10.1007/s00253-015-7257-y
Yuan, X.G., Xie, C., Chen, J., Xie, Y., Zhang, K.H., Lu, N.H. Seasonal changes in gastric mucosal factors associated with peptic ulcer bleeding. Experimental and Therapeutic Medicine, \ 2015; 9(1), pp.125-130. https://doi.org/10.3892/etm.2014.2080
Zarzecka, U., Modrak-Wójcik, A., Figaj, D., Apanowicz, M., Lesner, A., Bzowska, A., Lipinska, B., Zawilak-Pawlik, A., Backert, S., Skorko-Glonek, J. Properties of the HtrA protease from bacterium Helicobacter pylori whose activity is indispensable for growth under stress conditions. Frontiers in Microbiology, 2019; 10, p.961. https://doi.org/10.3389/fmicb.2019.00961
Zeng, H., Guo, G., Mao, X.H., De Tong, W., Zou, Q.M. Proteomic insights into Helicobacter pylori coccoid forms under oxidative stress. Current microbiology, 2008; 57, pp.281-286. https://doi.org/10.1007/s00284-008-9190-0