Research Article

Molecular Detection of β-lactamase Genes and Antibiotics Resistance for Bacterial Isolates From Pigeon’s Eyes Infections

Ali Abd Kadhum

Department of Community Health, Al-Nasiriya Technical Institute, Southern Technical University, Th-Qar Province, Iraq.

Abstract | The inflammation of the inner surface of the eyelid and the outermost layer of the white portion of the eye is known as conjunctivitis, or pink eye. In one or both eyes, conjunctivitis can occur. A total of 89 pigeons include In this study, eye swabs were taken from pigeons suffering from eye inflammation, and then the swabs were cultured on MacConkey agar and Blood agar. The pigeons’ eyes swabs taken from were cultured by a streak method and incubator with a 37C. For 24 hours. 10 samples with no growth appear, and 79 isolates diagnosed the bacterium depending on the appearance qualities of the developing colonies, pigmentation In Gram stain, as well as biochemical examinations. Different bacterial species was confirmed using the Enterosystem 18 R system and using a device. Vitek-2 compact system. Results of an antibiotic resistance test showed that the isolates showed a “significant” change in resistance to antibiotics, as the isolates showed the bacterial species Staphulococcu aureus, Pseudomonas aeruginosa, Streptococcus pneumonia, Moraxilla catarrhalis, and Klebsiella pneumonia resistance (100%) to the antibiotic Amoxycillin. While isolates of the bacterial species Staphulococcu aureu, Escherichia coli, Pseudomonas aeruginosa, Klebsiella pneumonia, and Proteus vulgaris showed resistance (100%) to the antibiotic azithromycin. Klebsiella pneumonia and E.coli isolates showed resistance to the antibiotic Moxifloxacin (90%), while Staphylococcus aureus isolates showed resistance to the antibiotic ciprofloxacin (90%). The BlaTEM gene for seven isolates E.coli causing conjunctivitis infection were successfully amplified. While BlaCTX-M gene for all proteus vulgaris isolates. As well as BlaSIM gene for isolates P. aeroginosa and found one isolate only carry BlaSIM gene. showed five isolates staph. aureus encode PVL gene

 

Keywords: Escherichia coli, Staphylococcus aureus, Pigeons, Eyes infections


Received | June 18, 2024 Accepted | July 04, 2024; Published | August 15, 2024

*Correspondence | Ali Abd Kadhum, Department of Community Health, Al-Nasiriya Technical Institute, Southern Technical University, Th-Qar province, Iraq; Email: [email protected]

Citation: Kadhum AA (2025). Molecular detection of β-lactamase genes and antibiotics resistance for bacterial isolates from pigeon’s eyes infections S. Asian J. Life Sci. 13: 13-19.

DOI | http://dx.doi.org/10.17582/journal.sajls/2025/13.13.19

ISSN | 2311–0589

Copyright 2025 by the authors. Licensee Zoological Society of Pakistan.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).



Introduction

Acute eye infections include lidinfection (Conjunctivitis) and dacryocystitis Ramesh et al. (2010) Bacterial adhesion and invasion of membranes and epithelial cells occur through their possession of factors that help them to adhere to and penetrate the host Okesola and Salako (2010). The most bacterial causes the show of studies have that of eye inflammation with Staphylococcus aureus bacteria, Streptococcus pneumoniae, gonorrhoeae, Corynebacterium diphtheriae, Moraxella lacunata, Haemophilus influenz Jaloob and Jaloob (2006) Another study showed that the causes of sickness, eyelid and conjunctivitis are by S.aureus S. Pneumonie Sambrook and Russell (2001). Staphylococcus bacteria is one of the most important and common causes of eye diseases, especially the intraocular and consists of S-walls. Aureusen is a group of factors that play a role in virulence and contribute to stimulating immunity, including Lipoteichoicacidas and Peptidoglycan. The eye possesses several immunological-biochemical-physical defenses against the angioplasty: Eyelashes eyelids that operate a dirt filter and pollution molecules to prevent their entry into the ocular external and that the procedure of close and opening the involuntary eye arises when foreign objects stick to the cilia, detached tears of the eye act as a means of protection for washing the eye and its parts of bacteria and residual residues, Eyelids and conjoins are made up of a tissue with many epithelial cells. The skin flakes satisfactorily. This prevents invasion by the mediation of the carpet and leads to the separation and isolation of the carpet attached to the outer surface layers Silverman (2023). Conjunctivitis leads to itching and a feeling of a foreign body in the eye, as well as tears and discharge. Conjunctivitis is either bacterial, viral, or caused by an allergy. Bacterial always occurs in one eye, unlike viral inflammation, which often begins in one eye and spreads to the last eye. Fellow et al. (2000) Conjunctivitis is also identified as red eye pink eye. Bacterial conjunctivitis is distinguished from other conjunctivitis by the incidence of the yellow mucous secretions, which often pour on the cheek, rude and complemented by inflammation of minor bloating with a smooth superficial in its center Singh et al. (2023). With iridescent redness There are two types of conjunctivitis: acute and chronic, which are caused by bacteria. The acute type is characterized by the appearance of veins, purulent secretions, and the adhesion of the mind and blindness to each other. The chronic type is less virulent and can affect the eyelids for a longer period .There is an inflammatory response in the tear organization or it might be a minor infection. The infectious bacteria endemic the conjunctiva mucous membrane region and thus become protected from the lysozyme and antibodies in the tear Mohammed et al. (2020). Treatments for bacterial infections use Sulfonomide, Erythromycin, Tetracyclin or Calfotaxime and Vancomycin compounds to treat positive bacteria, adverse to a generous dye. These compounds are often used for topical treatment, which is in the form of drops or ointment.Gentamicin and Ciprofloxacin are the most effective anti-counterfeit Pseudomonas earoginosa and Enterobacteriaceae and Staphylococcus aureus Noroflaxinand, Ampicillinin is also used to treat corneal inflammation and ulceration but less effectively towards Streptococcus and P. aeruginosa bacteria M Al-Rawi (2005). Interest in antibiotics has increased since their first use to the present because of their great importance in the treatment of various simple and complex bacterial injuries by either killing bacteriocidal bacteria and inhibiting their growth. Bacteriostatics antibiotic work is concentrated on bacteria in two main aspects: impairment of structural integration or impairment of functional metabolism AL-Sa’ady et al. (2019). In Europe, private pharmacies have emerged to prescribe medicinal herbs as a treatment to avoid side symptoms of chemical drugs Mekonnen et al. (2022)

The research aims to study the most communal bacteria in causing infusion in the bath’s eyes, recognize the most in effect antibiotics in the management of injury and isolates bacteria and compare them with antibiotics and carry its β-lactam genes.

Materials and methods

Sampling Collection

Collected 89 samples in different containers of pigeons’ eyes with conjunctivitis and Blepharitis from different private veterinary clinics in Basra governorate, as shown in the Figure 1.

Isolation and identification

Swabs of pigeon eye seal were collected by a single-use sterile tanker swab (Disposable serial eye swabs). Samples were placed at Steuart’s Transport Media when transported to the laboratory and used MacConkey agar and Blood agar. Swabs taken from the pigeons’ eyes were cultured by a streak method and incubator with a 37C. For 24 hours, the isolates diagnosed the bacterium depending on the appearance qualities of the developing colonies, pigmentation In Gram stain , direct microscopy and partial circles as well as biochemical examinations included catalysts, oxidase fermentation of manitol and blood degradation depending on Atiq et al. (2022) diagnosis of different bacterial species was confirmed using the Enterosystem 18 R system and using a device. Vitek-2 compact system

Vitek 2 compact system

Use this device to confirm the knowledge of isolates, as it is used to diagnose most typesBacteria through the device’s own diagnostic kit, the number of diagnoses contains 47 holes inseminated with a 24-hour-old bacterial depth. It incubates for 24 hours and records the monumental changes resulting from the growth of the bacteria.

Sensitivity to antibiotics

Adopting the Kerby-Bauer et al., 1966 method, improved with Lyngdoh, et al. (2020). And using the next antibiotics equipped by Oxiod, Moxifloxacin, Amoxycillin, ciprofloxacin, Cephalexin, Erythromycin, Ampicillin, Doxycycline azithromycin, Polymyxin, Trimethoprim. The medium of Muller-Hinton has been inoculated with suspension of cells using a scanner sterile cotton, the dishes left 5 minutes to dry after which antibiotic tablets were stabilized using a sterile tongs and incubated 37m for 48.24 hours Al-Ashwaq et al. (2022).

Molecular analysis

Molecular analysis for BlaTEM, BlaCTX-M, BlaSIM, and VLP gene production was performed according to the instructions of the Genomic DNA Mini-Kit Geneaid, and then DNA was extracted. The BlaTEM gene of E. coli, the BlaCTX-M gene of Proteus vulgaris, the BlaSIM gene of Pseudomonas aeroginosa, and the VLP gene of Staphylococcus aureus. The final volume of the PCR reaction was 20 μl, which included 12.5 μl of the mixture, and 5 μl of the template for the isolate, and 0.5 μl of primers. In order to

 

Table 1: The genes and specific primer sequences

Target gene Nucleotides sequences ( 5-3 ) Base pair Reference

Bla TEM

F: CATTTCCGTGTCGCCCTTATTC 800

Patel et al., (2022)

R: CGTTCATCCATAGTTGCCTGAC

Bla CTX-M

F: CGCTTTGCGATGTGCAC 550

Khalid Ibrahim (2023)

R: ACCGCGATATCGTTGGT
BlaSIM F: ACATTATCCGCTGGAACAGG 570 Alkhudhairy et al.,(2020)
R: TACAAGGGATTCGGCATCG
PVL F:ATCATTAGGTAAAATGTCTGCACATGATCCA 433 Al-Shwani et al.,(2021)
R:GCATCAACTGTATTGGATAGCCAAAAGC

 

Table 2: Shows the percentage of isolation of bacteria isolated from Conjunctivitis and Blepharitis.

Type Bacteria No. Type of isolation Conjunctivitis Blepharitis

Staphulococcus aureus

23 ((29.11%

16 (69.5)

7(( 30.4%

Streptococcus epidermidis

20((25.31%

8 (40%)

12(( 60%

Escherichia coli

12(15.18%)

7 (( 58.3%

5(( 41.6%

Pseudomonas aeruginosa

9(7.90%)

5(( 55.5%

4(44.4%)

Streptococcus pneumonia

5((6.32%

4( %80)

1(( 20%

Klebsiella pneumoniae

4((5.06%

1(( 25%

3(( 75%

Moraxilla catarrhalis

4((5.06%

4(( 100%

0

Proteus vulgaris

2((2.53%

2(( 100%

0
Total number 79

47(59.49%)

32((40.50%

X2 : 4.93 P<.05

 

 

 

 

measure the reaction conditions, we used a thermal cycler (A&B Singapore). Specific primer sequences were used in PCR experiments as in (Table 1). The reaction volume for BlaTEM was 20 μl. Khalid Ibrahim (2023). While BlaSIM and VPL genes as in Alkhudhairy et al. (2020).

Results

The study found 89 samples cultured were ten samples with no growth, as shown in the Figure 1, including 79 gram-negative bacterial isolates and gram-positive bacterial isolates, as shown in the Figure 1

The results of bacterial culture on different culture media showed a difference in the growing isolates, which was confirmed by various diagnostic tests, including Gram stain, oxidase, catalase, and a test using the Enterosystem 18 R. As shown in the Figure 2.

Depending on the insulation source used Vitek-2 compact, system. The results showed a difference in the percentages of microbial species within one group. In the example of conjunctiva infection, the maximum percentage of isolation was for the bacteria Staphylococcus aureus, which was (34.04%), while in the case of Blepharitis infection, the highest percentage was for the bacteria S.epidermidis, which was (37.5%). The result is not significant at P<.05 , as shown in Table (1).

The prevalence of antibiotics in treating many pathogens and their widespread and indiscriminate use has directed toward the emergence of many bacterial strains resistant to them and the reduction of sensitive strains.

Results of an antibiotic resistance test showed that the isolates showed a “significant” change in resistance to antibiotics, as the isolates showed the bacterial species Staphulococcus aureu, Pseudomonas aeruginosa, Streptococcus pneumonia, Moraxilla catarrhalis, and Klebsiella pneumoniae resistance (100%) to the antibiotic Amoxycillin. While isolates of the bacterial species Staphulococcus aureu, Escherichia coli, Pseudomonas aeruginosa, Klebsiella pneumonia, and Proteus vulgaris showed resistance (100%) to the antibiotic azithromycin. Klebsiellae pneumonia and E.coli isolates showed resistance to the antibiotic Moxifloxacin (90%), while Staphylococcus aureus isolates showed resistance to the antibiotic ciprofloxacin (90%) Figure 3.

Molecular analysis

Out of 79 isolates, bacterial isolates were selected for PCR amplification, and BlaTEM gene for seven isolates E. coli causing conjunctivitis infection were successfully amplified as shown in Figure 4. While Bla ctx gene for all proteus vulgaris isolates as Figure 5. As well as BlaSIM gene for 9 isolates of P. aeroginosa and found one only carry BlaSIM gene Figure 6. in this study showed five isolates staph. aureus encode PVL gene as Figure 7.

Discussion

Many microorganisms can reach the cornea and cause inflammation, usually after a defect in the integrity of the outer epithelial layer of the cornea and as a result of its exposure to external stress, the entry of foreign bodies, or some eye diseases, making it a suitable environment for the growth of microorganisms, thus increasing the possibility of them being infected. Therefore, the types of these infections are numerous. The results showed that the percentage of conjunctiva contamination was (59.49%). The The appearance of this high percentage means that the disease is contagious and easily transmitted.

Infection occurs through direct contact of the contaminated hand with the eye, polluted air also causes infection, or from the spread of the pathogen with some respiratory secretions and thus the disease occurs. Also, sometimes some types of bacteria from the nasopharynx may colonize the conjunctiva as a outcome of blockage of the tear duct Hussain et al. (2022). Table (1) shows the percentages of microorganisms isolated from conjunctivitis.It is noted that the highest percentage of infection was for Staphulococcuaureus bacteria, the lowest percentage was for Proteus vulgaris bacteria, and the highest percentage of microorganisms isolated from keratitis was S.epidermidis bacteria. Each of Odjimogho and Idu (2003) indicated the isolation of bacteria from cases of conjunctivitis and keratitis at a rate of (22%) and (43.4%), while in our study the percentage of their isolation was low, and the reason for this may be due to the fact that streptococcal infections may heal on their own by forming antibodies. Early in the infection, in addition to the fact that streptococci bacteria are sensitive to many antibiotics Furuta et al. (2022).

The increase in the number and diversity of microorganisms, as new genera appear, namely Klebsiella, E. coli, and Pseudomonas, from the group of Gram-negative bacteria. Pseudomonas bacteria constitute the most dangerous species present that causes corneal ulcers. This is due to the frequent use of antibiotics, which is likely to improve bacterial resistance to antibiotics and lead to chronic infections, in addition to the communication of microorganisms that are already resistant to antibiotics from one animal to another.Also, Poulos et al. (2002) S. aureus bacteria were considered the most common cause of conjunctivitis, with a percentage of (34%) Cooper et al. (2000). Staphylococcus aureus isolates showed resistance to the antibiotic ciprofloxacin. this results agreement with the recent study performed by Abdulridha et al. (2023) Effect of various drugs against the bacteria S. aureus. Seven of the E. coli isolates studied cause and cause conjunctivitis. It had multiple resistance to antibiotics. Escherichia coli has been identified as an ESBL producer encoding a beta-lactamase for the BlaTEM gene. this result that similar with study reported by Tsaku et al. (2019) but differ than with study by Pishtiwan and Khadija (2019). The prevalence the produce ESBL- Proteus spp. Is increasing worldwide, as well as in the United States, Asia, and Europe. as well as all proteus vulgaris isolates in this study was producer gene BlaCTX-M this result that not similar with study by Malaki et al. (2022). Pseudomonas aeroginosa showed this study found one isolate caries BlaSIM gene and result near from reported by Fekri Kohan et al. (2020) in Iran and differ from result (76.1 %) reported by Bunyan et al. (2018). This study showed PVL gene for staph. Aureus of present in five isolates and this result agreement with study by Kulangara et al. (2017) and near from study reported by Abdulridha et al. (2023).

conclusion

In conclusion, this study focused on the fact that the eye infections affecting pigeons were often bacterial infections, and when these bacteria were isolated, it was found that there were multiple genera and species of bacteria that could infect the eyes of pigeons. It confirmed that the pathogens were resistant to antibiotics, meaning that they possess virulence factors, and the number of pathogens was magnified. Of ESBL genes and appeared to have beta enzymes.

conflict of interest

There is no conflict of interest.

Novelty Statement

The results of this study showed that eye inflammation in pigeons is often caused by a bacterial infection. It also showed that most of the isolated bacteria are 100% resistant to a number of antibiotics. The study also confirmed the presence of ESBL producer encoding a beta-lactamase.

References

Abdulridha SA, Abdulrahma TR, Alshamery AARW (2023). Detection of Staphylococcal Pantone-Valentine Leukocidin (PVL) Gene in COVID-19 Patients. HIV Nursing., 23(1): 58-62.

Alkhudhairy MK, Al-Shammari MMM (2020). Prevalence of metallo-β-lactamase–producing Pseudomonas aeruginosa isolated from diabetic foot infections in Iraq. New Microb. New Infect., 35: 100661. https://doi.org/10.1016/j.nmni.2020.100661

Al Ahamt (2022). Prevalence and Antibiotic Susceptibility Pattern of Aerobic Bacteria Isolated from Iraqi Bed Sores Patients Admitted to Intensive Care Units. Iraqi J. Biotechnol., 21(2).

AL-Sa’ady AT, Al-Mawla YH (2019). Comparison of effects antibiotics and natural honey and extracts of plants on Escherichia coli growth isolated from different pathogenic cases. J. Uni. Babylon Pure Appl. Sci., 27(3): 420-34.

Al-Shwani AA, Mahdi NB (2021). Detection Of Panton-Valentine Leukocidin Gene In Methicillin-Resistant S. Aureus Isolated From Different Sources In Kirkuk-Iraq. Nveo-Natural Volatil. Essential Oils J. NVEO., 15363-15372.

Al, A. H. A. M. T. (2022). Prevalence and Antibiotic Susceptibility Pattern of Aerobic Bacteria Isolated from Iraqi Bed Sores Patients Admitted to Intensive Care Units. Iraqi J. Biotechnol., 21(2).

Atiq S, Tehreem E, Murtaza A, Baig FK, Atiq U, Rafique R (2022). Incidence of Methicillin Resistant Staphylococcus Aureus (MRSA) among Patients Necessitating Reconstructive Surgery. Pakistan J. Med. Health Sci., 16(04): 1207-1207. https://doi.org/10.53350/pjmhs221641207

Brudzynski K (2021). Honey as an ecological reservoir of antibacterial compounds produced by antagonistic microbial interactions in plant nectars, honey and honey bee. Antibiotics., 10(5): 551. https://doi.org/10.3390/antibiotics10050551

Bunyan IA, Hadi OM, Al-Mansoori HA (2018). Molecular detection of Metallo-beta lactamase producing Pseudomonas aeruginosa isolated from different sites of infection. J. Pharmaceut. Sci. Res., 10(5): 1072-1078. https://doi.org/10.25258/ijpqa.10.2.21

Cooper RA, Molan P (1999) The use of honey as an antiseptic in Managing Pseudomonads hnfect. J.Wound. Care. 8(4): 161-4. https://doi.org/10.12968/jowc.1999.8.4.25867

Cooper RA, Wigley P, Burton N (2000). Susceptibility of multiresistant strains of Burkholderia Cepacia of honey. Lett. Appl. Microbiol. 31(1)20-24. https://doi.org/10.1046/j.1472-765x.2000.00756.x

Fekri Kohan S, Asadpour L, Houshmand E (2020). The Study of Frequency of SIM and AmpC Genes in Clinical Isolates of Pseudomonas aeruginosa in Gilan, Iran. Infect. Epidemiol. Microbiol., 6(2): 117-125. https://doi.org/10.29252/iem.6.2.117

Fellow C, Chung CW, Cohen EJ (2000). Eye disorders- bacterial conjunctivitis. B.M.J., 3: 305-310. https://doi.org/10.1136/ewjm.173.3.202

Furuta A, Brokaw A, Manuel G, Dacanay M, Marcell L, Seepersaud R, Adams Waldorf K (2022). Bacterial and host determinants of group b streptococcal infection of the neonate and infant. Front. Microbiol., 13: 820365. https://doi.org/10.3389/fmicb.2022.820365

Hussain HH, Ibraheem NT, Al-Rubaey NKF, Radhi MM, Hindi NKK, AL-Jubori RHK (2022). A review of airborne contaminated microorganisms associated with human diseases. Med. J. Babylon., 19(2): 115-122. https://doi.org/10.4103/MJBL.MJBL_20_22

Hussain SRA, Naser AT, Talib NT, Ibrahim MM, Jameel GH, Mohammed ZI, Khodear BT conjunctivitis in pigeons (columba livia domestica) between the environment influences and microrganism sensitivity to common drugs and a sensitivity to senegalia greggii plant extract.

Idu FK, Odjimogho SE (2003). Susceptibility of conjunctival bacterial pathogens to fluoroquinolones: A comparative study of ciprofloxacin, norfloxacin and ofloxacin. J. Health Allied Scs., 3:1

Jaloob EAJ, Jaloob AAJ (2006). Isolation and identification of aerobic pathogenic bacteria that causes of Conjunctivitis in hospital of Al-Furat Al-Awsat in Kufa. J. Acad. Sci.5(2):61-65.

Khalid Ibrahim S (2023). Phenotypic and Genotypic Analysis of Antibiotic Resistance in Proteus vulgaris Isolated from ICU Patients in Baghdad Hospitals. Iranian J. Med. Microbiol., 17(5): 585-595. https://doi.org/10.30699/ijmm.17.5.585

Kulangara V, Nair N, Sivasailam A, Sasidharan S, Kollannur JD, Syam R (2017). Genotypic and phenotypic β-lactam resistance and presence of PVL gene in Staphylococci from dry bovine udder. PLoS One., 12(11): e0187277. https://doi.org/10.1371/journal.pone.0187277

Lyngdoh CJ, Wahlang JB, Langstieh AJ, Hadem KLH, Bora I, Lahon J, Sabhapandit D (2020). Antimicrobial Activity of Aristolochiatagala Cham. Centellaasiatica Linn. HouttuyniacordataThunb. on Multi-Drug Resistant Clinical Isolates. Int. J. Pharm. Sci. Rev. Res., 64(2): 76-81 https://doi.org/10.47583/ijpsrr.2020.v64i02.013.

Malaki A, Ferdosi-Shahandashti E, Maali A, Sabbagh P, Khademian A (2022). Molecular Characterizations and Antimicrobial Susceptibility of Extended-Spectrum ß-lactamase (ESBL) Producing Proteus spp. Clinical Isolates in Babol, Northern Iran. J. Med. Microbiol. Infect. Dis., 10(3): 114-121. https://doi.org/10.52547/JoMMID.10.3.114

M Al-Rawi A, A Al-Taee H, A Al-Hamdonee S (2005). Study of Some Bacteria Causing Conjunctivitis. Rafidain J. Sci., 16(14): 146-155. https://doi.org/10.33899/rjs.2005.43521

Mekonnen AB, Mohammed AS, Tefera AK (2022). Ethnobotanical study of traditional medicinal plants used to treat human and animal diseases in Sedie Muja District, South Gondar, Ethiopia. Evidence‐Based Complement. Alternat. Med., 2022(1): 7328613. https://doi.org/10.1155/2022/7328613

Mohammed AA, Ali MM, Zenebe MH (2020). Bacterial etiology of ocular and periocular infections, antimicrobial susceptibility profile and associated factors among patients attending eye unit of Shashemene comprehensive specialized hospital, Shashemene, Ethiopia. BMC Ophthalmol., 20: 1-8. https://doi.org/10.1186/s12886-020-01398-w

Okesola AO, Salako AO (2010). Microbiological profile of bacteria Conjunctivitis in Ibadan, Nigeria. J. Ann. Iba Post Medi. 8(1):20-24. https://doi.org/10.4314/aipm.v8i1.63953

Patel MA, Pandey A, Patel AC, Patel SS, Chauhan HC, Shrimali MD, Chandel BS (2022). Whole genome sequencing and characteristics of extended-spectrum beta-lactamase producing Escherichia coli isolated from poultry farms in Banaskantha, India. Front. Microbiol., 13: 996214. https://doi.org/10.3389/fmicb.2022.996214

Pishtiwan AH, Khadija KM (2019). Prevalence of blaTEM, blaSHV, and blaCTX-M genes among ESBL-producing Klebsiella pneumoniae and Escherichia coli isolated from thalassemia patients in Erbil, Iraq. Mediterranean J. Hematol. Infect. Dis., 11(1). https://doi.org/10.4084/mjhid.2019.041

Poulos RG, Smedley EJ, Ferson MJ, Bolisetty S, Tapsall JW, (2002). Refining the puplic health response to primary meningococcal conjunctivitis. C.D.I., 26(4): 592-595.

Ramesh S, Ramakrishnan R, Bharathi JM, Amuthan M, Viswana T (2010). Prevalence of bacterial pathogens causing ocular infection in south india. J. Ind. Patho. Microbiol. 23(2):281-286. https://doi.org/10.4103/0377-4929.64336

Sambrook J, Russell DW (2001). Molecular cloning: Alaboratory manual,3th ed. Cold spring Harbor Laboratory press, Cold spring Harbor, NY, USA.

Silverman RH (2023). Principles of ophthalmic ultrasound. Expert Rev. Ophthalmol., 18(6): 379-389. https://doi.org/10.1080/17469899.2023.2277781

Singh, N., Mazumder, R., Monika, M., Sakshi, S., Khan, F., & Kumar, B. (2023). Development in therapeutic strategies for allergic conjunctivitis. Trends in Immunotherapy, 7(1), 2025. https://doi.org/10.24294/ti.v7.i1.2025

Tsaku PA, Ngwai YB, Pennap GRI, Ishaleku D, Ibrahim T, Nkene IH, Abimiku RH (2019). Extended-spectrum beta-lactamase–production in Escherichia coli isolated from door handles in Nasarawa State University, Keffi, Nigeria. Heliyon., 5(8). https://doi.org/10.1016/j.heliyon.2019.e02177