Genetic Analysis of Antimicrobial Resistance Genes in Salmonella Isolated from Diseased Broilers in Egypt
Mona F. Shousha1*, Aml M. Ragab2 and Salwa M. Helmy1
1Department of Bacteriology, Mycology and Immunology, Faculty of Veterinary Medicine, Kafr El-Sheikh University, Kafr El-Sheikh 33516, Egypt
2Unit of Bacteriology, Animal Health Research Institute, Tanta Branch, Agriculture Research Center (ARC), Egypt
ABSTRACT
Salmonella spp. are known to be a major cause of foodborne infection; it primarily spreads from poultry to humans, significantly burdening public health, especially with the currently high rates of antimicrobial resistance and the emerging multidrug-resistant strains. As a result, this study determined the patterns of antibiotic resistance in Salmonella spp., which was isolated from sick broilers from different farms in Egypt. Then, we investigated the presence of extended-spectrum beta-lactamases and plasmid-mediated quinolone resistance genes in Salmonella isolates. First, 800 internal organs (heart, liver, intestine, and yolk sac) were collected from 200 infected broilers to genetically analyze their recovered Salmonella antimicrobial resistant genes. Ten isolates of Salmonella were recovered: two (20%) for each S. enterica serovar Grampian, S. enterica serovar Kentucky, and S. enterica serovar Blegdam and then one (10%) for each S. enterica serovar Hadar, S. enterica serovar Anatum, S. enterica serovar Kirkee, and S. enterica serovar Tranoroa in the serotypes of isolated biochemically identified Salmonella. As per the results of this study, Salmonella isolates demonstrated multidrug-resistant phenotypes, with the highest resistance being against ampicillin, cefoxitin, cefpodoxime, and oxacillin (100%) and then against cefotaxime (80%), ceftazidime (70%), ciprofloxacin, ceftriaxone, and nalidixic acid (60%), including amoxicillin–clavulanic acid (50%). Furthermore, antimicrobial resistance genes, such as ESBL (blaTEM, blaSHV, and blaCMY-2), and quinolone resistance genes (qnrA, qnrB, and qnrS) were examined in these isolates. Results showed that although all isolates tested were found negative for qnrA and qnrB and positive for the qnrS, they were positive for the ESBL genes blaTEM and blaSHV but negative for blaCMY-2. In conclusion, the multidrug-resistant bacteria, Salmonella, demonstrated a high incidence in the diseased broiler chickens, with a possibility of human infection and treatment failure. Therefore, it is highly recommended that developing countries drastically reduce the overuse of antibiotics in poultry.
Article Information
Received 02 August 2022
Revised 06 August 2022
Accepted 10 August 2022
Available online 22 May 2023
(early access)
Published 18 October 2024
Authors’ Contribution
MFS and AMR collected the samples, conducted the experiments and analyzed the results. SMH and AMR analyzed the data. All authors discussed the results and wrote the manuscript.
Key words
Salmonella enterica, Broiler, Antibiotic resistance, Quinolone resistance genes, multidrug-resistant bacteria
DOI: https://dx.doi.org/10.17582/journal.pjz/20220802110804
* Corresponding author: [email protected]
0030-9923/2024/0006-2763 $ 9.00/0
Copyright 2024 by the authors. Licensee Zoological Society of Pakistan.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Introduction
Consumption of tainted food poses the risk of various foodborne diseases with the possibility of outbreaks, making food safety a global public health issue. The yearly cases of food poisoning are around 600 million (approximately 1 in 10 people worldwide) with 420,000 cases ending with death losing 33 million disability adjusted life according to a recent report from the WHO (WHO, 2020). Poultry and its products are major prevalent sources of non-typhoidal Salmonella infections in human (Eguale, 2018). Salmonella is one of the most prevalent bacteria that cause gastrointestinal illnesses in livestock and poultry. Salmonella infections are highly linked to the consumption of tainted poultry products (Cogan and Humphrey, 2003). Controlling Salmonella in poultry, on the other hand, is difficult; for broiler chickens, this has historically relied on a balance of farm biosecurity and antibiotic usage (Davies, 2005). Since the early 1960s, Salmonella isolates with clinically relevant antibiotic resistance have been documented as majority of the resistance was restricted to a single antibiotic (Bulling et al., 1973; Cherubin, 1981; Van leeuwen et al., 1979). However, since the mid-1970s, Salmonella isolates with MDR characteristics have been on the rise all across the world. Antimicrobial-resistant Salmonella has been found in foods of animal sources, raising worries that treatment of human salmonellosis may be jeopardized because strains with antimicrobial resistance tend to be more frequently linked with severe illness than susceptible isolates (Helms et al., 2002; Varma et al., 2005). As antibiotic-resistant bacteria proliferate, curiosity in the genetics and resistance mechanisms that bacteria have developed to fend off antimicrobial drugs has increased (Ahmed and Shimamoto, 2012). Antibiotic misuse, abuse, and overuse have resulted in inefficiency and exacerbated the seriousness of this zoonotic disease (Cruchaga et al., 2001). The resistance to antimicrobial medications has risen over the past years creating a significant concern and challenge for public health professionals worldwide. However, the condition is much more severe in developing countries because strategies to prevent antimicrobial resistance are only of minor concern (Da Costa et al., 2013). Hence, such a high incidence of antimicrobial resistance in Salmonella spp. necessitates the determination of a resistance dissemination route, horizontally or vertically, in the evolution of MDR strains (Nemati and Ahmadi, 2020). However, as we gain a better understanding of the genome’s molecular fluidity, any attempt to combat bacteria results in more bacterial adaptation or evolution to occur in the new free ecological niche (Velge et al., 2005). Resistance molecular basis in Salmonella isolates from livestock and poultry worldwide have been identified in several investigations (Ahmed et al., 2009; Zhao et al., 2007). In different Salmonella serovars, studies have reported that the rapid improvement in resistance to extended-spectrum cephalosporin was related to the plasmid-mediated manufacturing of β-lactamase-producing bacteria (EFSA, 2008, 2009; Authority, 2018). TEM genes (blaTEM) and SHV genes (blaSHV) are the main genes involved for ESBL production (Habeeb et al., 2013). This ongoing evolution poses a serious threat to public health by causing bacterial infections treatment limitation (Sharma et al., 2013; WHO, 2013). Quinolone resistance genes mediated by plasmids have recently been discovered in several Enterobacteriaceae, and their incidence is increasing worldwide (Poirel et al., 2012. Although the PMQR genes expression only provides a limited amount of quinolone resistance, it can enable the additional chromosomal resistance mechanisms selection, resulting in the emergence of highly resistant quinolone-resistant bacteria (Strahilevitz et al., 2009Tamang et al., 2011. Of particular concern is the recent plasmid-mediated quinolone resistance development in various parts of the world, which is encoded by a large number of qnr genes. Furthermore, both clinical and food isolates of Salmonella have recently sharply increased ciprofloxacin resistance (Lin et al., 2015). The relevant gene, qnr, was shown to be unique from other quinolone resistance genes previously identified (Tran et al., 2002). Therefore, in this study, we investigated how widespread the resistance genes for broad-spectrum beta-lactamase and quinolone antibiotics are in Salmonella isolates from diseased broilers.
Materials and Methods
Sampling
A total of 800 internal organs (heart, liver, intestine, and yolk sac) were collected from 200 diseased broiler chickens from various farms in Egypt in a poultry lab. The broilers have clinical signs of salmonellosis as pasty vent, whitish diarrhea, roughed feather and poor general condition and their postmortem examination revealed bronze discoloration and enlargement of liver with necrotic foci and pericarditis with enlarged heart, peritonitis, perihepatitis, intestinal and caecal inflammation and unabsorbed yolk sac in young chicks. Sterile plastic bags were used to preserve the samples which were then transported in an icebox directly to the Animal Health Research Institute, Tanta branch.
Isolation and identification of Salmonella (ISO 6579-1: 2017)
The organs’ surface was scorched by hot spatula, then a sterilized loop was inserted through scorched part of the organ. All samples (liver, heart and yolk sac) were obtained aseptically and enriched in buffered peptone water for non-selective enrichment. Pre-enrichment is essential to allow the detection of low number of Salmonella or injured Salmonella. At room temperature, 10 ml of buffered peptone water were inoculated with 1 gm of the tested material using a 1/10 dilution (weight to volume). Then incubated at 37°C for 18 h. After that, all samples (Intestine, liver, heart and yolk sac) were inoculated into tubes containing Selenite F broth for inhibition of coliforms and certain other microbial species and thus, was beneficial in the restoration of Salmonella species. A tube containing 10 ml of selenite F broth and 1 cm of the pre-enrichment culture were combined, and they were incubated at 37 °C for 18 h. A 10 µl loop-full of selenite F broth was spread on the surface of xylose lysine desoxycholate (XLD) agar and incubated for 24 h at 37°C. By inoculating into triple sugar iron agar slopes, Salmonella-typical morphology in the form of doubtful colonies was verified biochemically. For upcoming research, the probable colonies were collected and preserved on semisolid agar.
Various biochemical tests such as oxidase reaction, urea hydrolysis test, triple sugar iron agar, indole reaction, methyl red test, reaction of Voges Proskauer, citrate utilization test, lysine decarboxylation test identification of Salmonella according to Quinn et al. (2002).
Serological typing of Salmonella
Using particular O and H agglutinating antisera, standard Salmonella isolates were further serotyped (USA, Difco, NJ, Franklin Lakes) in accordance with the Kauffmann White serotyping scheme (Grimont and Weill, 2007). Specifically, bacterial motility was detected following a previous study (Cruickshank et al., 1975). Then, Gram staining was used to microscopically identify suspected colonies under an oil immersion lens to observe the Gram-negative bacilli morphological traits (rod-shaped).
Antimicrobial susceptibility tests
Mueller-Hinton agar medium (Oxoid) is used according to the Clinical Laboratory Standard Institute (CLSI, 2011). According to the manufacturer’s instructions, the Mueller-Hinton agar was produced. Salmonella isolates were tested in vitro for quinolone resistance and extended-spectrum beta-lactamase. The following list of antibiotics in use: ampicillin (AMP), 30 µg; amoxicillin-clavulanic acid (AMC), 20/10 µg; cefotaxime (CTX), 30 µg; cefoxitin (FOX), 30 µg; cefpodoxime (CPD), 10 µg; ceftriaxone (CRO), 30 µg; ceftazidime (CAZ), 30 µg; ciprofloxacin (CIP), 5 µg; oxacillin (OXA), 30 µg and nalidixic acid (NAL), 30µg.
PCR screening for antimicrobial resistance genes in Salmonella
In our study, for DNA extraction from samples, we used the QIAamp DNA Mini kit (Qiagen, Germany, GmbH) with definite changes depending on the manufacturer’s instructions. Part of the sample suspension (200 µl) was treated with 10 µl of proteinase K and 200 µl of lysis buffer for 10 min at 56°C. 200 µl of 100 percent ethanol was then added to the lysate following incubation to be followed by sample washing and incubation based on the manufacturer’s instructions. Using a kit and 100 µl of elution buffer, the nucleic acid was eluted. This is an oligonucleotide primer. Metabion (Germany) contributed the primers, which are shown in (Table I). qnrA, qnrB, qnrS, blaTEM, blaSHV, and blaCMY-2 genes PCR amplification: To test the primers a 25 µl reaction that includes 12.5 µl of Emerald Amp Max PCR Master Mix (Takara, Japan), 5.5 µl of water, 1 µl of each forward and reverse primers at 20 pmol concentration, and 5 µl of DNA template. 2720 thermal cyclers were applied to proceed the reaction. 5V/cm gradients in 1x TBE buffer were used to separate the PCR products electrophoretically at room temperature on a 1.5% agarose gel (Applichem, Germany, GmbH). Each gel slot received 15 µl of the goods for analysis. For determining the fragment sizes, a gene ruler 100 bp ladder (Fermentas, Germany) was used. For gel photography, a gel documentation system (Alpha Innotech, Biometra) was used. Computer software was used to evaluate the data. Time conditions and temperature of the two primers during PCR are presented. S. enteritidis was used as positive control, while DEPC-treated pure water was used as negative control.
Results
For all genes the 35 thermal cycles comprised each of primary denaturation at 94oC for 5 min, secondary denaturation at 94oC for 30 s, annealing at different temperatures (57oC for qnr A, 53oC for qnr B, 48oC for qnr S, 54oC for bla TEM and bla SHV, and 55oC for bla CMY-2) for 45 s, Extension at 72 oC for 45 s and final extension at 72 oC for 10 min.
Table I. Oligonucleotide primer sequences for detecting resistant Salmonella genes.
|
Gene |
Nucleotide sequence 5`3` |
Amplified product |
Reference |
|
qnrA |
GATAAAGTTTTTCAGCAAGAGG |
543 bp |
Cambau et al., 2006 |
|
ATCCAGATCGGCAAAGGTTA |
|||
|
qnrB |
ATGACGCCATTACTGTATAA |
562 bp |
Azeez et al., 2018 |
|
GATCGCAATGTGTGAAGTTT |
|||
|
qnrS |
ATGGAAACCTACAATCATAC |
491 bp |
Le Thi Minh Vien et al., 2009 |
|
AAAAACACCTCGACTTAAGT |
|||
|
blaTEM |
ATCAGCAATAAACCAGC |
516 bp |
Colom et al., 2003 |
|
CCCCGAAGAACGTTTTC |
|||
|
blaSHV |
AGGATTGACTGCCTTTTTG |
392 bp |
|
|
ATTTGCTGATTTCGCTCG |
|||
|
CIT (blaCMY-2) |
TGG CCA GAA CTG ACA GGC AAA |
462 bp |
Pérez-Pérez and Hanson, 2002 |
|
TTT CTC CTG AAC GTG GCT GGC |
Prevalence of Salmonella
All suspected colonies (pink with black centers) were identified on the XLD media, including a typical colony on the Salmonella–Shigella agar (colorless with or without black center). Specifically, Gram-negative nonspore-forming rods were observed on Gram-stained colonies. Then, motility test revealed that the Salmonella isolates were extremely motile. Furthermore, biochemical analysis revealed that while all isolates were nonlactose fermenting with a negative oxidase reaction, most isolates produced hydrogen sulfide and were positive for methyl red and citrate and negative for Voges–Proskauer, indole, and urease hydrolysis tests. Nevertheless, the total percentage of Salmonella species identified by biochemical tests was 10%, resulting in 80/800 Salmonella isolates from the investigated organs (24/200 isolates from the liver, 32/200 isolates from the yolk sac, 8/200 isolates from the heart, and 16/200 isolates from the intestine) (Table II).
Table II. Prevalence of Salmonella isolated from diseased broiler chickens.
|
Examined organs in 200 broiler chickens |
Positive Salmonella |
|
|
No |
% |
|
|
Liver |
24 |
12 |
|
Intestine |
16 |
8 |
|
Heart |
8 |
4 |
|
Yolk sac |
32 |
16 |
|
Total (800) |
80 |
10 |
Note: The (%) rate of each number is obtained by dividing the number by the total number of samples.
Serotyping of isolated Salmonella
The isolates were two for each Salmonella enterica serovar Grampian, Salmonella enterica serovar Kentucky, and Salmonella enterica serovar Blegdam and then one for each Salmonella enterica serovar Hadar, Salmonella enterica serovar Anatum, Salmonella enterica serovar Kirkee, and Salmonella enterica serovar Tranoroa.
Antimicrobial susceptibilities of different Salmonella isolate serotypes
Ten isolated Salmonella serovars were tested for their resistance to ESBL and quinolone. Results showed that 100% of the isolates were resistant to ampicillin, cefpodoxime, cefoxitin, and oxacillin, while 80% were found to be resistant to cefotaxime; 70% to ceftazidime; 60% to ciprofloxacin, ceftriaxone, and nalidixic acid; and 50% to amoxicillin–clavulanic acid.
Incidence of PMQR and β-lactamase-encoding genes in Salmonella isolated from diseased broilers
Plasmids are known to mediate quinolone resistance genes. At 543 and 562 bp, while all isolates tested negative for qnrA and qnrB, respectively, they all tested positive for qnrS (at 491 bp). Meanwhile, although all isolates tested positive for ESBL, blaTEM (516 bp) and blaSHV (392 bp) genes, they were negative for blaCMY-2 (462 bp) (Supplementary Fig. 1).
Discussion
Salmonella is known to be a major zoonotic pathogen, with poultry serving as one of its primary hosts. Therefore, infections with Salmonella are a significant hazard to the poultry farming sector in developing countries (Li et al., 2018). In this study, we demonstrated that the yolk sac had the highest rate of Salmonella isolates isolates (16%), followed by the liver (12%). However, this rate differed from that previously reported (El-Mohsen et al., 2022), which observed that Salmonella was more prevalent in the liver by 13.33% than in the yolk sac by 9.3%. Also Menghistu et al. (2011) found the prevalence of Salmonella was 2.7% (7/260) from 220 poultry tissue samples and 40 egg samples and the highest number of Salmonella isolates came from liver and intestine. The findings of our study also differ from yet another study by Eguale (2018), which observed a Salmonella prevalence rate of 4.7%. Finally, 14% of the understudied samples were Salmonella positive in the study by El-Tawab et al. (2019). Alternatively, results of serotyping matched those by Rady et al. (2020). They reported S. kentucky as the most common serotype of the Salmonella isolates and with Zhang et al. (2018) who found S. Kentucky as one of the most dominant serotypes in chicken samples by (12.6%). Whereas Ammar et al. (2016) disagreed with these findings because their study isolated Salmonella enterica serovar Kentucky in 12.5% of Salmonella isolates, alongside other serotypes Salmonella enterica serovar Enteritidis (56.25%) and Salmonella enterica serovar Typhimurium (18.75%). Additionally, Salmonella isolates in our study showed different antimicrobial resistance results, similar to a previous study by El-Tawab et al. (2019). While they detected that 89% of Salmonella species were cefotaxime-resistant, Rady et al. (2020) detected that many isolates were resistant to both ampicillin (90%) and nalidixic acid (88%). Nevertheless, nalidixic acid and ampicillin had the highest antibiotic resistance against Salmonella isolates within the chicken production chain, whereas ciprofloxacin was linked to low resistance levels (Castro-Vargas et al., 2020). This could partially agree with Yildirim et al. (2011) who found that all isolates of Salmonella spp., exhibited resistance to ampicillin, oxacillin and cefotaxime were evident 97%, 85.2% and 2.9%, respectively. Also Waghamare et al. (2018) mentioned that Salmonella isolates were resistant to ampicillin, ciprofloxacine and cefotaxime by 21.43%, 19.05% and 14.19%, respectively. While Singh et al. (2013) reported that all Salmonella isolates were sensitive to ampicillin. Our study finding the resistance to amoxicillin-clavulanic acid by 50 % and this higher than Khan et al. (2021) who found it by 2.4%. Our results for antimicrobial resistance were different from Yang et al. (2013) who found the resistance to ampicillin by 45.6%, nalidixic acid by 75.8%, ciprofloxacine by 12.1%, ceftriaxone by 6.0% and cefoxitin 4.0%. Regarding these findings, the careful use of antibacterial medicines in clinical, veterinary, and agricultural contexts is strongly suggested to preserve antibiotic efficacy and prevent the development of cross-resistance. Quinolones are widely used in veterinary medicine to treat Salmonella infections over the world Mehdi et al. (2018). This work looked for ESBL and PMQR genes in Salmonella isolates from infected broiler chickens. According to global studies, there has been an alarming increase in beta-lactam antibiotic resistance. In this study, we have showed that although Salmonella strains were negative for qnrA and qnrB they were positive for the qnrS in all isolates of this investigation partially agreeing with the study by Dembélé et al. (2020), who could not identify qnrA and qnrS in any Salmonella strain. These findings highlight the low incidence of qnr among Salmonella isolates. However, Soliman et al. (2017) found the plasmid-mediated quinolone-resistance gene qnrA1. Furthermore, we observed that Salmonella isolates were more fluoroquinolone-resistant, as evidenced by PCR for qnrS, PMQR genes, revealing that 100% of the samples tested positive for qnrS. This outcome was greater than what had previously been reported by Abo-Remela et al. (2015) who were able to identify that 18% were positive for qnrS. Furthermore, another study by Zhao et al. (2017) discovered that while qnrA and qnrB had a high incidence, qnrS had a low incidence. But in 2020 (Zhao et al., 2020) reported qnrB with low incidence (6/67, 9.0%). However Yang et al. (2013) could identify qnrA, qnrB and qnrS genes by (46.6%), (12.7%), (19.5%) respectively. Besides, although Dembélé et al. (2020) could not identify blaTEM and blaSHV in ESBL, dominant beta-lactamase genes detected in our investigation were similar to the previously reported data by Eguale et al. (2017). While Ramatla et al. (2022) could find high levels of β-lactamase encoding genes blaTEM in their Salmonella isolates. Also Zhao et al. (2021) found the majority of isolates harbored the blaTEM gene (74.4%). Shahada et al. (2010) also could identify the wild-type blaTEM-1 gene that mediated resistance to ampicillin. Soliman et al. (2017) also found blaTEM-1 in Salmonella isolates and Zhao et al. (2020) found blaTEM in all Salmonella isolates (100%). Rady et al. (2020) found that all isolates were positive ESβLs genes but were negative for blaCMY gene. While Ahmed and Shimamoto (2012) could identify blaCMY-2 in one isolate of Salmonella enterica serovar Enteritidis only. Moreover, Adel et al. (2021) reported β-lactamase-encoding genes, including blaSHV-12, blaCMY-2 (AmpC type), and blaTEM-1 in the Salmonella isolates. Sabry et al. (2020) found 16 of Salmonella isolates were ESBL-producing with the majority carrying blaSHV and blaTEM genes and 4 ESBL-negative isolates carried blaCMY-2.
Conclusion
Salmonella serovars obtained from diseased broilers have a high resistance rate to quinolones and β-lactams. Accordingly, this study has detected quinolone-resistant and ESBL-producing Enterobacteriaceae in rather significant numbers. Furthermore, high frequencies of qnrS, blaTEM, and blaSHV were observed in all isolates. Thus, identifying quinolone-resistant and ESBL-producing Enterobacteriaceae is critical for effective therapy and infection management. Hence, proper use of these antibiotics will restrict the propagation of resistance genes while reserving their use for therapeutic purposes.
There is supplementary material associated with this article. Access the material online at: https://dx.doi.org/10.17582/journal.pjz/20220802110804
Statement of conflict of interest
The authors have declared no conflict of interest.
References
Abo-Remela, E.M., Gad, W.M., Helmy, S.M.H., and Hassan, W.M., 2015. Occurrence of quinolone resistance genes among Salmonella species isolated from chickens. Kafrelsheikh Vet. med. J., 13: 129-148. https://doi.org/10.21608/kvmj.2015.109851
Adel, W.A., Ahmed, A.M., Hegazy, Y., Torky, H.A., and Shimamoto, T., 2021. High prevalence of ESBL and plasmid-mediated quinolone resistance genes in Salmonella enterica isolated from retail meats and slaughterhouses in Egypt. Antibiotics, 10: 881. https://doi.org/10.3390/antibiotics10070881
Ahmed, A.M., and Shimamoto, T., 2012. Genetic analysis of multiple antimicrobial resistance in Salmonella isolated from diseased broilers in Egypt. Microbiol. Immunol., 56: 254-261. https://doi.org/10.1111/j.1348-0421.2012.00429.x
Ahmed, A.M., Ishida, Y., and Shimamoto, T., 2009. Molecular characterization of antimicrobial resistance in Salmonella isolated from animals in Japan. Appl. Microbial., 106: 402-409. https://doi.org/10.1111/j.1365-2672.2008.04009.x
Ammar, A.M., Abd El-Aziz, N.K., Hanafy, M.S., and Ibrahim, O.A., 2016. Serotypes profile of avian Salmonellae and estimation of antibiotic residues in chicken muscles using high-performance liquid chromatography. Adv. environ. Biol., 10: 173-180.
Authority, E.F.S., 2018. The European Union summary report on antimicrobial resistance in zoonotic and indicator bacteria from humans, animals and food in 2016. Eur. Fd. Saf. Author. J., 16: e05182. https://doi.org/10.2903/j.efsa.2018.5182
Azeez, D.A., Findik, D., Hatice, T., and Arslan, U., 2018. Plasmid-mediated fluoroquinolone resistance in clinical isolates of Escherichia coli in Konya, Turkey. Cukurova med. J., 43: 295-300. https://doi.org/10.17826/cumj.341637
Bulling, E., Stephan, R., and Sebek, V., 1973. The development of antibiotic resistance among Salmonella bacteria of animal origin in the Federal Republic of Germany and West Berlin. First communication: A comparison between the years of 1961 and 1970–1971. Zentralbl. Bakteriol., 225: 245–256.
Cambau, E., Lascols, C., Sougakoff, W., Bebear, C., Bonnet, R., Cavallo, J.D., Gutmann, L., Ploy, M.C., Jarlier, V., Soussy, C.J. and Robert, J., 2006. Occurrence of qnrA-positive clinical isolates in French teaching hospitals during 2002–2005. Clin. Microbiol. Infect., 12: 1013-1020. https://doi.org/10.1111/j.1469-0691.2006.01529.x
Castro-Vargas, R.E., Herrera-Sánchez, M.P., Rodríguez-Hernández, R., and Rondón-Barragán, I.S., 2020. Antibiotic resistance in Salmonella spp. isolated from poultry: A global overview. Vet. World, 13: 2070. https://doi.org/10.14202/vetworld.2020.2070-2084
Cherubin, C.E., 1981. Antibiotic resistance of Salmonella in Europe and the United States. Rev. Infect. Dis., 6: 1105–1125. https://doi.org/10.1093/clinids/3.6.1105
CLSI, 2011. Performance standards for antimicrobial susceptibility testing. Twenty-first informational supplement, vol. 31. CLSI M02-A10 and M07-A08.
Cogan, T.A., and Humphrey, T.J., 2003. The rise and fall of Salmonella Enteritidis in the UK. J. appl. Microbiol., 94: 114S-119S. https://doi.org/10.1046/j.1365-2672.94.s1.13.x
Colom, K., Pérez, J., Alonso, R., Fernández-Aranguiz, A., Lariño, E., and Cisterna, R., 2003. Simple and reliable multiplex PCR assay for detection of bla TEM, bla SHV and bla OXA–1 gene in Enterobacteriaceae. FEMS Microbiol. Lett., 223: 147-151. https://doi.org/10.1016/S0378-1097(03)00306-9
Cruchaga, S., Echeita, A., Aladueña, A., García-Peña, J., Frias, N. and Usera, M.A., 2001. Antimicrobial resistance in Salmonellae from humans, food and animals in Spain in 1998. J. Antimicrob. Chemother., 47: 315-321. https://doi.org/10.1093/jac/47.3.315
Cruickshank, R., Duguid, J.P., Marmian, B.P., and Swain, R.H.A., 1975. Medical microbiology the practice of medical microbiology. Volume II: Churchill Livingstone, 12th edn. Edinburgh, London and New-York.
Da Costa, P.M., Loureiro, L., and Matos, A.J., 2013. Transfer of multidrug-resistant bacteria between intermingled ecological niches: The interface between humans, animals and the environment. Int. J. environ. Res. Publ. Hlth., 10: 278-294. https://doi.org/10.3390/ijerph10010278
Davies, R.H., 2005. Pathogen populations on poultry farms. In: Food safety control in the poultry industry (ed. G. Mead). Woodhead Publishing Ltd. Cambridge, United Kingdom. pp. 101–135. https://doi.org/10.1533/9781845690236.101
Dembélé, R., Konaté, A., Traoré, O., Kaboré, W.A., Soulama, I., Kagambèga, A., Traoré, A.S., Guessennd, N.K., Aidara-Kane, A., Gassama-Sow, A. and Barro, N., 2020. Extended spectrum beta-lactamase and fluoroquinolone resistance genes among Escherichia coli and Salmonella isolates from children with diarrhea, Burkina Faso. BMC Pediatr., 20: 1-9. https://doi.org/10.1186/s12887-020-02342-z
Eguale, T., 2018. Non-typhoidal Salmonella serovars in poultry farms in central Ethiopia: Prevalence and antimicrobial resistance. BMC Vet. Res., 14: 1-8. https://doi.org/10.1186/s12917-018-1539-4
Eguale, T., Birungi, J., Asrat, D., Njahira, M.N., Njuguna, J., Gebreyes, W.A., Gunn, J.S., Djikeng, A. and Engidawork, E., 2017. Genetic markers associated with resistance to beta-lactam and quinolone antimicrobials in non-typhoidal Salmonella isolates from humans and animals in central Ethiopia. Antimicrob. Resist. Infect. Contr., 6: 1-10. https://doi.org/10.1186/s13756-017-0171-6
El-Mohsen, A., and El-Sherry, S., 2022. Serological and antibacterial characteristics of Salmonella isolates from chickens in Assiut., Egypt. Benha Vet. med. J., 41: 93-99. https://doi.org/10.21608/bvmj.2021.93816.1468
El-Tawab, A., Abdelbaset, E., Hegazy, A. E., and Abd-Elmonem, R., 2019. Bacteriological and molecular studies on Salmonella species isolated from poultry farms. Benha Vet. med. J., 36: 280-293. https://doi.org/10.21608/bvmj.2019.114673
European Food Safety Authority (EFSA). 2008. Report of the task force on zoonoses data collection on the analysis of the baseline survey on the prevalence of Salmonella in slaughter pigs, in the EU, 2006–2007-Part A: Salmonella prevalence estimates. EFSA J., 6: 135r. https://doi.org/10.2903/j.efsa.2008.135r
European Food Safety Authority, 2009. Analysis of the baseline survey on the prevalence of methicillin-resistant Staphylococcus aureus (MRSA) in holdings with breeding pigs, in the EU, 2008-Part A: MRSA prevalence estimates. EFSA J., 7: 1376. https://doi.org/10.2903/j.efsa.2009.1376
Grimont, P.A.D. and Weill, F.X.,2007. Antigenic formulae of the Salmonella serovars. 9th ed. Institut Pasteur, Paris, France.
Habeeb, M.A., Sarwar, Y., Ali, A., Salman, M. and Haque, A., 2013. Rapid emergence of ESBL producers in E. coli causing urinary and wound infections in Pakistan. Pak. J. med. Sci., 29: 540. https://doi.org/10.12669/pjms.292.3144
Helms, M., Vastrup, P., Gerner-Smidt, P. and Mølbak, K., 2002. Excess mortality associated with antimicrobial drug-resistant Salmonella typhimurium. Emerg. Infect. Dis., 8: 490. https://doi.org/10.3201/eid0805.010267
ISO 6579-1, 2017. Microbiology of the food chain. Horizontal method for the detection, enumeration and serotyping of Salmonella Part 1: Detection of Salmonella spp.
Khan, A.S., Georges, K., Rahaman, S., Abebe, W. and Adesiyun, A.A., 2021. Characterization of Salmonella isolates recovered from stages of the processing lines at four broiler processing plants in Trinidad and Tobago. Microorganisms, 9: 1048. https://doi.org/10.3390/microorganisms9051048
Le Thi Minh Vien, S.B., Le Thi Phuong Thao, L.T., Phuong Tu, C.T.T., Tran Thi Thu Nga, N.V., Minh Hoang, J.I.C., Lam Minh Yen, N.T.H., and Nguyen Van Vinh Chau, J.F., 2009. High prevalence of plasmid-mediated quinolone resistance determinants in commensal members of the Enterobacteriaceae in Ho Chi Minh City, Vietnam. J. med. Microbiol., 58: 1585. https://doi.org/10.1099/jmm.0.010033-0
Li, Q., Wang, X., Xia, J., Yuan, Y., Yin, C., Xu, L., Li, Y. and Jiao, X., 2018. Salmonella-containing vacuole development in avian cells and characteristic of cigR in Salmonella enterica serovar Pullorum replication within macrophages. Vet. Microbiol., 223: 65-71. https://doi.org/10.1016/j.vetmic.2018.07.013
Lin, D., Chen, K., Wai-Chi Chan, E., and Chen, S., 2015. Increasing prevalence of ciprofloxacin-resistant food-borne Salmonella strains harboring multiple PMQR elements but not target gene mutations. Sci. Rep., 5: 1-8. https://doi.org/10.1038/srep14754
Mehdi, Y., Létourneau-Montminy, M.P., Gaucher, M.L., Chorfi, Y., Suresh, G., Rouissi, T., Brar, S.K., Côté, C., Ramirez, A.A. and Godbout, S., 2018. Use of antibiotics in broiler production: Global impacts and alternatives. Anim. Nutr., 4: 170-178. https://doi.org/10.1016/j.aninu.2018.03.002
Menghistu, H.T., Rathore, R., Dhama, K. and Agarwal, R.K., 2011. Isolation, identification and polymerase chain reaction (PCR) detection of Salmonella species from field materials of poultry origin. Int. J. Microbiol. Res., 2: 135-142.
Nemati, F., and Ahmadi, E., 2020. Class1-3 integrons and antimicrobial resistance profile in Salmonella spp. isolated from broiler chicken in Western Iran. J. Hell. Vet. med. Soc., 71: 2471-2482. https://doi.org/10.12681/jhvms.25922
Pérez-Pérez, F.J., and Hanson, N.D., 2002. Detection of plasmid-mediated AmpC β-lactamase genes in clinical isolates by using multiplex PCR. J. clin. Microbiol. 40: 2153-2162. https://doi.org/10.1128/JCM.40.6.2153-2162.2002
Poirel, L., Cattoir, V., and Nordmann, P., 2012. Plasmid-mediated quinolone resistance; interactions between human, animal, and environmental ecologies. Front. Microbiol., 3: 24. https://doi.org/10.3389/fmicb.2012.00024
Quinn, P.J., Markey, B.K., Carter, M.E., Donnelly, W.J.C., Leonard, F.C., and Maguire, D., 2002. Vet. Microbiol. Microbial. Dis., 2nd Ed. Wiley Blackwell.
Rady, M., Ezz-El-Din, N.A., Mohamed, K.F., Nasef, S., Samir, A., and Elfeil, W.K., 2020. Correlation between ESβL Salmonella serovars isolated from broilers and their virulence genes. J. Hell. Vet. Med. Soc., 71: 2163-2170. https://doi.org/10.12681/jhvms.23645
Ramatla, T., Mileng, K., Ndou, R., Mphuti, N., Syakalima, M., Lekota, K.E. and Thekisoe, O.M., 2022. Molecular detection of integrons, colistin and β-lactamase resistant genes in Salmonella enterica serovars Enteritidis and Typhimurium isolated from chickens and rats inhabiting poultry farms. Microorganisms, 10: 313. https://doi.org/10.3390/microorganisms10020313
Sabry, M.A., Abdel-Moein, K.A., Abdel-Kader, F. and Hamza, E., 2020. Extended-spectrum β-lactamase-producing Salmonella serovars among healthy and diseased chickens and their public health implication. Glob. Antimicrob. Resist. 22: 742-748. https://doi.org/10.1016/j.jgar.2020.06.019
Shahada, F., Chuma, T., Dahshan, H., Akiba, M., Sueyoshi, M. and Okamoto, K., 2010. Detection and characterization of extended-spectrum β-lactamase (TEM-52)-producing Salmonella serotype Infantis from broilers in Japan. Foodb. Pathog. Dis., 7: 515-521. https://doi.org/10.1089/fpd.2009.0454
Sharma, M., Pathak, S., and Srivastava, P., 2013. Prevalence and antibiogram of extended spectrum β-Lactamase (ESBL) producing Gram negative bacilli and further molecular characterization of ESBL producing Escherichia coli and Klebsiella spp. J. clin. Diag. Res., 7: 2173. https://doi.org/10.7860/JCDR/2013/6460.3462
Singh, R., Yadav, A.S., Tripathi, V. and Singh, R.P., 2013. Antimicrobial resistance profile of Salmonella present in poultry and poultry environment in north India. Fd. Contr., 33: 545-548. https://doi.org/10.1016/j.foodcont.2013.03.041
Soliman, A.M., Ahmed, A.M., Shimamoto, T., El-Domany, R.A., Nariya, H., and Shimamoto, T., 2017. First report in Africa of two clinical isolates of Proteus mirabilis carrying Salmonella genomic island (SGI1) variants, SGI1-PmABB and SGI1-W. Infect. Genet. Evol., 51: 132-137. https://doi.org/10.1016/j.meegid.2017.03.029
Strahilevitz, J., Jacoby, G.A., Hooper, D.C. and Robicsek, A., 2009. Plasmid-mediated quinolone resistance: A multifaceted threat. Clin. Microbiol. Rev., 22: 664-689. https://doi.org/10.1128/CMR.00016-09
Tamang, M.D., Nam, H.M., Kim, A., Lee, H.S., Kim, T.S., Kim, M.J., Jang, G.C., Jung, S.C. and Lim, S.K., 2011. Prevalence and mechanisms of quinolone resistance among selected non-typhoid Salmonella isolated from food animals and humans in Korea. Foodb. Pathog. Dis., 8: 1199-1206. https://doi.org/10.1089/fpd.2011.0899
Tran, J.H. and Jacoby, G.A., 2002. Mechanism of plasmid-mediated quinolone resistance. Proc.natl. Acad. Sci., 99: 5638-5642. https://doi.org/10.1073/pnas.082092899
Van Leeuwen, W.J., Van Embden, J., Guinee, P., Kampelmacher, E.H., Manten, A., Van Schothorst, M. and Voogd, C.E., 1979. Decrease of drug resistance in Salmonella in the Netherlands. Antimicrob. Agents Chemother., 16: 237-239. https://doi.org/10.1128/AAC.16.2.237
Varma, J.K., Mølbak, K., Barrett, T.J., Beebe, J.L., Jones, T.F., Rabatsky-Ehr, T., Smith, K.E., Vugia, D.J., Chang, H.G.H. and Angulo, F.J., 2005. Antimicrobial-resistant non-typhoidal Salmonella is associated with excess bloodstream infections and hospitalizations. J. Infect. Dis., 191: 554-561. https://doi.org/10.1086/427263
Velge, P., Cloeckaert, A. and Barrow, P., 2005. Emergence of Salmonella epidemics: The problems related to Salmonella enterica serotyp Enteritidis and multiple antibiotic resistance in other major serotypes. Vet. Res., 36: 267-288. https://doi.org/10.1051/vetres:2005005
Waghamare, R.N., Paturkar, A.M., Vaidya, V.M., Zende, R.J., Dubal, Z.N., Dwivedi, A. and Gaikwad, R.V., 2018. Phenotypic and genotypic drug resistance profile of Salmonella serovars isolated from poultry farm and processing units located in and around Mumbai city, India. Vet. World, 11: 1682. https://doi.org/10.14202/vetworld.2018.1682-1688
WHO, 2013. Integrated surveillance of antimicrobial resistance: Guidance from a WHO Advisory Group; ISBN 978 92 4 150631 1, Switzerland.
WHO, 2020. (World Health Organization). Food safety fact sheet. Available online at: https://www.who.int/news-room/ (accessed on 4 June 2021).
Yang, B., Qiao, L., Zhang, X., Cui, Y., Xia, X., Cui, S., Wang, X., Meng, X., Ge, W., Shi, X. and Wang, D., 2013. Serotyping, antimicrobial susceptibility, pulse field gel electrophoresis analysis of Salmonella isolates from retail foods in Henan Province, China. Fd. Contr., 32: 228-235. https://doi.org/10.1016/j.foodcont.2012.11.022
Yildirim, Y., Gonulalan, Z., Pamuk, S. and Ertas, N., 2011. Incidence and antibiotic resistance of Salmonella spp. on raw chicken carcasses. Int. Fd. Res. J., 44: 725-728. https://doi.org/10.1016/j.foodres.2010.12.040
Zhang, L., Fu, Y., Xiong, Z., Ma, Y., Wei, Y., Qu, X., Zhang, H., Zhang, J. and Liao, M., 2018. Highly prevalent multidrug-resistant Salmonella from chicken and pork meat at retail markets in Guangdong, China. Front. Microbiol., 9: 2104. https://doi.org/10.3389/fmicb.2018.02104
Zhao, S., McDermott, P.F., White, D.G., Qaiyumi, S., Friedman, S.L., Abbott, J.W., Glenn, A., Ayers, S.L., Post, K.W., Fales, W.H. and Wilson, R.B., 2007. Characterization of multidrug resistant Salmonella recovered from diseased animals. Vet. Microbiol., 123: 122-132. https://doi.org/10.1016/j.vetmic.2007.03.001
Zhao, X., Hu, M., Zhang, Q., Zhao, C., Zhang, Y., Li, L., Qi, J., Luo, Y., Zhou, D. and Liu, Y., 2020. Characterization of integrons and antimicrobial resistance in Salmonella from broilers in Shandong, China. Poult. Sci., 99: 7046-7054. https://doi.org/10.1016/j.psj.2020.09.071
Zhao, X., Ju, Z., Wang, G., Yang, J., Wang, F., Tang, H., Zhao, X. and Sun, S., 2021. Prevalence and Antimicrobial resistance of Salmonella isolated from dead-in-shell chicken embryos in Shandong, China. Front. Vet. Sci., 8: 119. https://doi.org/10.3389/fvets.2021.581946
Zhao, X., Yang, J., Zhang, B., Sun, S., and Chang, W., 2017. Characterization of integrons and resistance genes in Salmonella isolates from farm animals in Shandong province, China. Front. Microbiol., 8: 1300. https://doi.org/10.3389/fmicb.2017.01300