Copper Stress-Induced Transcriptional Regulatory Protein CusR also Regulates Silver Efflux in Klebsiella pneumoniae KW

Maimoona Imran2, Farah Rauf Shakoori2*, Soumble Zulfiqar1,

Abeedha Tu-Allah Khan1 and Abdul Rauf Shakoori1*

1School of Biological Sciences, University of the Punjab, Quaid-i-Azam Campus, Lahore 54590, Pakistan

2Institute of Zoology, University of the Punjab, Quaid-i-Azam Campus, Lahore 54590, Pakistan

ABSTRACT

Silver and silver containing compounds have had been in medicinal use since centuries. The antimicrobial properties of silver depend on its accumulation in bacterial cells. Klebsiella pneumoniae remains a major health concern around the globe due to its associated infections, such as, pneumonia, meningitis and bloodstream, surgical site and wound infections. The present study reports a locally isolated K. pneumoniae strain exhibiting high resistance (MIC=90mM) against Ag+ and its accumulation potential. Transcription of Cus (Cu sensing) determinants is found to be upregulated in the presence of Ag+. The transcriptional regulator CusR bound effectively with bidirectional cus promoter. STRING database analysis revealed that CusR possesses strong interactions and linkages with other Cus determinants and via ZraS with lead and zinc resistant genes. This regulator also possesses weak associations with Cue and Cut regulons and starvation sensing system.


Article Information

Received 02 January 2024

Revised 23 February 2024

Accepted 01 March 2024

Available online 05 June 2024

(early access)

Published 25 October 2024

Authors’ Contribution

ARS: Conceptualization, data analysis, methodology, funding acquisition, project administration, supervision, writing, review and editing, provided resources. FRS: Conceptualization, funding acquisition, project administration, supervision, writing, review and editing. SZ: Supervision, validation of data, methodology, writing review and editing. MI: Methodology, formal analysis, writing original draft. ATAK: Bioinformatic analysis, use of software.

Key words

Heavy metal uptake, cus regulon, Metal efflux, CusCFBA system

DOI: https://dx.doi.org/10.17582/journal.pjz/20240102190224

* Corresponding author: [email protected], [email protected], [email protected], [email protected]

0030-9923/2024/0006-2787 $ 9.00/00

Copyright 2024 by the authors. Licensee Zoological Society of Pakistan.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

Abbreviations

IPTG, Isopropyl thiogalactoside; MIC, minimum inhibitory concentration; MFP, membrane fusion proteins; OMF, outer membrane factor; RND, resistance-nodulation-division; ROS, reactive oxygen species. STRING, search tool for the retrieval of interacting genes.



Introduction

Global mechanization and industrialization has led to continuous accumulation of toxic metals in the environment (Mosa et al., 2016). These metals not only pose threat to the environment but also to the living organisms, though metals are required for the functionality of several life processes such as being cofactors for enzyme functionality. These trace elements pose serious threat to the living organism if present beyond the tolerable limits (Franke et al., 2003; Kim et al., 2011). Silver ions are reported to be potent biocide. Several silver-binding membrane proteins are known to attract silver ions and by deriving energy from ATP hydrolysis, result in the uptake of silver ions inside the cells and initiate synthesis of silver nanoparticles (AgNPs) (McQuillan et al., 2012; Dakal et al., 2016). McQuillan et al. (2012) have suggested that the primary mechanism of action of silver nanoparticles is cell membrane dissolution. In addition, the dissolution of silver nanoparticles releases antimicrobial silver ions, which can interact with thiol-containing proteins in the cell wall and influence their functions. It is generally believed that easily ionized silver particles can affect the cell by the Trojan horse mechanism. Phagocytosis of AgNPs stimulates inflammatory signaling through the generation of reactive oxygen species (ROS) in macrophage cells, after which activated macrophage cells induce TNF-α secretion (Mikhailova, 2020). Silver nanoparticles (AgNPs) have been imposed as an excellent antimicrobial and antiviral agents being able to combat bacteria and viruses in vitro and in vivo causing infections (Salleh et al., 2020; Khina and Krutyakov, 2021). In combination with antibiotics, these ions have been used to kill multidrug resistant bacteria (Barras et al., 2018). They are also used in several medical devices such as wound dressings, implants, bone cement, shunts, catheters and endotracheal tubes (Sütterlin et al., 2017). Silver ions target the macromolecules of the cell such as DNA and protein, inhibiting cell transduction and growth. These ions also alter the respiration of E. coli as it has been considered a benign metal (Asiani et al., 2016). It is not known for the production of ROS, but it plays an important role in enhancing ROS production. Though, silver is less toxic to human cells (Mijnendonckx et al., 2013) its toxicity has been observed in the form of burns and argyria in some cases. It may also cause chest irritation and bronchitis (Prabhu and Poulose, 2012; Pelgrift and Friedman, 2013; Ayangbenro and Babalola, 2017).

The cells have developed different mechanisms to bypass the toxic effects of metals. The metal resistance genetic elements can be chromosomal or plasmid borne (Sotiriou and Pratsinis, 2011). Both play an important role in the accumulation and efflux of the metal out of the cell. A few prominent systems include members of RND (resistance-nodulation-division) superfamily transporters which catalyze active efflux of many heavy metals such as Cu, Ag, Cd resistant systems. These transporters become associated with two other classes of proteins – (1) the outer membrane channel proteins also known as outer membrane factors (OMF) such as AcrB of E. coli and MexB of Pseudomonas aeruginosa and (2) the periplasmic adapter proteins also known as membrane fusion proteins (MFP) such as AcrA of E. coli and MexA of P. aeruginosa.

The cytoplasmic borne cus regulon was selected for this study containing two operons one comprising four genes encoding structural proteins and second comprising of two genes, regulatory in nature. cus determinants consist of two operons, cusRS and cusCFBA transcribed in opposite direction. cusRS operon encodes a sensor histidine kinase CusS and a response regulator CusR. CusA, CusB and CusC interact to form an active channel spanning the periplasm and connecting the cytoplasm to the outer membrane. Each of these three component proteins is essential for metal efflux (Nikaido and Takatsuka, 2009). The construction of this tripartite complex suggests that the metals are exported directly into the external medium, rather than in the periplasm. Along with Cus regulon, Cue regulon also plays an important role in the metal efflux. Cue regulon comprises CopA which is involved in translocation of copper ions from cytoplasm to periplasm, CueO which oxidizes Cu+ to Cu++ in periplasm and CueR which is the transcription activator of the cue regulon (Outten et al., 2001).

Silver resistant bacteria were first isolated from the burn ward unit of the hospital in 1960s (Silver, 2003). Later these resistant strains were recovered from the environment especially in the remains of mines and waste water. Silver resistance has been best characterized in a plasmid pMG101 (Randall et al., 2015) which belongs to Salmonella typhimurium; it shows resistance to silver, mercury and tellurite (Mijnendonckx et al., 2013). Other systems that possess silver resistance include SilCBA, and CusCFBA systems, which are being controlled by SilP, SilF and CusR and CusS, respectively (Munson et al., 2000; Oshima et al., 2002; Silver, 2003; Mijnendonckx et al. 2013). PcoABCDRSE system is encoded by genes residing in a giant plasmid and its component PcoE has been reported to attach 48 silver ions thus making it unavailable for bacteria (Brown et al., 1995).

The present study deals with the structural and functional characterization of silver stress induced transcriptional regulatory protein encoded by cusR in a locally isolated KW strain of Klebsiella pneumoniae (Zulfiqar and Shakoori, 2012). Transcription of Cus (Cu sensing) determinants has been found to be upregulated in the presence of Ag+. The transcriptional regulator CusR binds effectively with bidirectional cus promoter. STRING database analysis revealed that CusR possesses strong interactions and linkages with other Cus determinants and via ZraS with lead and zinc resistant genes. This regulator also possesses weak associations with Cue and Cut regulons and starvation sensing system.

Materials and Methods

Klebsiella pneumoniae KW strain was first isolated by Zulfiqar and Shakoori (2012) from industrial effluents collected from Kot Lakhpat Industrial Area, Lahore. Stock of this strain was obtained from School of Biological Sciences, University of the Punjab, Lahore.

For administration of Ag+ stress, AgNO3 salt was used throughout the study.

Determination of MIC of silver against K. pneumoniae KW

K. pneumoniae KW was allowed to grow in the LB agar medium supplemented with various concentrations of Ag+ (up to 120mM). The minimum concentration at which no growth was observed after 48 h incubation was considered as MIC of Ag+ against the bacterial strain.

Growth curve of K. pneumoniae KW

The bacterial growth was determined in the presence of various concentrations of Ag+ for which LB medium in sixteen Erlenmeyer flasks (200 ml capacity) was inoculated with 2 ml overnight cultures of KW and allowed to grow till OD600 0.5±0.05. These log phase cultures were exposed to different concentrations of Ag+ (20, 40, 60 and 80mM) along with control (No Ag+). All these cultures were further grown at 37°C and 100 rpm. Cell density in these cultures could not be determined due to the formation of AgCl precipitates in LB broth that hindered the measurement of OD. However, cell density of each culture was determined by dropping 10µl of this culture on LB agar plates in triplicates at 0, 2, 4, 6 and 24 h of silver stress followed by incubation at 37°C. Any growth up to 48 h was checked. The experiment was repeated and 100 µl from each culture with 2h Ag+ stress was spread on LB agar medium (spread plate method).

Effect of Ag+ on growth of K. pneumoniae KW was also observed in the same way by using less concentrations of the metal (0.3, 0.5, 1, 2, 3, 4 and 5 mM) upto 8 h of the stress.

Amplification and cloning of cusR gene

Genomic DNA of K. pneumoniae KW was isolated as described by Rodriguez and Tait (1983). A 738bp DNA fragment containing cusR was amplified using specific forward and reverse primers with restriction sites for NdeI and Hind III, respectively (Table I). A 50µl amplification reaction mixture was prepared as per manufacturer’s guidelines (Fermentas Cat # EP0402). Amplification was carried out in Applied Biosystem 2720 thermal cycler.

For cloning, the amplified PCR product was gene cleaned and ligated in cloning vector pTZ57R by using Fermentas InsT/A clone PCR product cloning kit (Cat # K1214). E. coli DH5α competent cells were transformed with recombinant DNA. Cloning was confirmed by restriction analysis. The cloned cusR was subcloned in pET21a through NdeI and HindIII sites. BL21 codon plus competent cells were transformed with recombinant plasmid pET21a-cusR followed by confirmation through restriction digestion.

Expression analysis of CusR

For expression analysis, 100 ml LB broth supplemented with ampicillin (100µg/ml) was inoculated with 1ml overnight culture of BL21C+ cells containing pET21a-cusR and allowed to grow at 37oC till OD600 0.6. IPTG was added (0.15mM final conc.) and culture was placed at 17oC with shaking (120rpm). In control, no IPTG was added. The culture was centrifuged and the cell pellet was resuspended in 10ml of 20mM Tris-Cl (pH 8.0). It was sonicated (10 sec pulse with 15 sec rest) for 15 min at 60hz till the sample became transparent. Samples were checked by running on 12% SDS-PAGE. Maximum expression was observed in insoluble fraction (Fig. 4A). In order to proceed further with soluble form of protein, transformed cells were initially grown at 37°C and when OD reached 0.5-0.8, the temperature was raised to 45°C for 30 min. and then cooled at 20ºC. The culture was later induced with 0.1mM IPTG, and allowed to grow overnight at 17°C. This resulted in partial solublization of CusR as shown in Figure 4B in which a thick 25 kDA band of CusR is visible in total cell lysate (T) as well as in both supernatant (S) and pellet (P) fractions.

 

Table I. Primers used in this study.

Primers

Primer sequences (5’--- 3’)

Target

Amplicon size

Used for

cusR-F

cusR-R

CCTCATATGAAGATTTTGATTGTC

GCGAAGCTTATAAAGAAGGTCAG

cusR

738 bp

Amplification for cloning

GyrA-F

GyrA-R

TACGCGGTATACGACACCAT

CGATGGAACCAAAGTTACCC

gyrA

91 bp

Realtime PCR for relative quantification of mRNAs in response to Ag+

CFBART-F

CFBART -R

CGCAGTGCATATCCTGTTG

AACGAAGGCGTAAGACTGCT

cusCFBA

124 bp

RSRT-F

RSRT-R

CCTCAACGGCTATCACCTG

ACGATATCCCAACCGTTCAC

cusRS

90 bp

Cpq-F

Cpq-R

GTCAAACGCGTGAAAGAGAG

GTCACATGGGCTTCAGTGAG

copA

80 bp

Coq-F

Coq-R

CCCTGAATGCCACTACCTG

TCCGCCAGCTGGTTAGTAAT

cueO

106 bp

Crq-F

Crq-R

GGGTTTAACCTGGAAGAGTGC

GTTCTCGATATCCGCCACTT

cueR

111 bp

pRS-F

pRS-R

GGTACCTAGCTGTATTGAGC

TCTAGATCTTCACGGCAGGC

CusRS promoter

298 bp

Promoter activity in response to Ag+

 

The underlined nucleotides in cusR-F and cusR-R show restriction sites for Nde1 and Hind III, respectively.

Isolation and purification of protein

The lysed cells as described above were subjected to fractional ammonium sulphate precipitation with 20%, 30%, 40%, 50%, 60%, 70% and 80% of ammonium sulphate. Each time, required amount of ammonium sulphate was slowly added and the sample was allowed to stand on ice for 2h for maximum precipitation. Fractions were centrifuged at 6000 x g. Supernatants and pellets were stored at each step of precipitation. After analysis on SDS-PAGE, two fractions obtained after 20 and 30% precipitation were pooled and dialyzed against 50mM Tris-Cl buffer (pH 8.0) with continuous shaking at 4oC. Buffer was changed at 4h intervals.

Proteins obtained after ammonium sulphate precipitation were fractionated by anion exchange chromatography using HiTrap QFF-5ml column on FPLC system AKTA purifier (GE healthcare). Protein (15mg) was loaded on the column. Fractions were collected, pooled and later run on 12% SDS PAGE. Partially purified CusR protein was quantified using Bradford reagent.

Gel shift assay

CusR protein (15µg) was incubated with cusRS promoter amplified by using pRS-F and pRS-R primers (Zahid et al., 2012, Table I) at 37°C for half an hour. The mixture was run on 4% polyacrylamide gel (prepared in 1X TAE buffer). Promoter, promoter + protein, BSA and protein marker were run at 80 V. Gel was stained with EtBr solution and any shift in mobility of cusRS promoter was observed.

Functional analysis of cus regulon against silver

Ag+ with final concentration of 1, 2, 3, 4 and 5mM was added in 20 ml of log phase culture (2h old) of K. pneumoniae KW in five flasks. In control, no Ag+ was added. After 15 min of Ag+ stress, RNA isolation, cDNA synthesis and qRT-PCR of Cus genetic determinants (cusCFBA and cusRS) along with Cue genetic determinants (copA, cueO and cueR) was carried out as described by Zulfiqar and Shakoori (2012).. The internal control was gyraseA. Results were recorded as described by Pfaffl (2001). The primers used for qRT-PCR are shown in Table I.

In silico analysis of CusR and pcusR

The 3D structure of CusR was predicted via homology modelling through Protein Homology/Analogy Recognition Engine V 2.0 (Phyre2) (Kelley et al., 2015). STRING software (https://string-db.org) was used to study CusR interaction possibilities with other cellular proteins.

DNA sequence of a region encompassing cusR promoter (pcusR) was subjected to various online tools such as BPROM (Solovyev and Salamov, 2011) and virtual footprint (Münch et al., 2005) to predict regulatory sites including -10 and -35 regions, cusR binding box and transcription start site.

Statistical analysis

Microsoft Excel was used to calculate the mean values of the data, while the Chi-square test was used to calculate the level of significance using JMP Statistical Package Software (Version 5.0.1.a, SAS Institute Inc., Cary, NC). Confidence level at 95% was determined and P<0.05 was used as significance level in all statistical analyses.

Results

MIC

K. pneumoniae KW was able to grow in the presence of Ag+ up to 90 mM. Therefore, MIC of Ag+ for this strain was determined as 120 mM.

Effect of Ag+ on the growth of K. pneumoniae KW

Effect of Ag+ on the growth of K. pneumoniae KW is shown in Figure 1. Addition of the metal in low concentrations (≤ 5mM) resulted in immediate death of a significant portion of the population and reduced the cell density in each culture. At 2h stress, there appeared a few or no colony, however, it looked the cells that somehow survived started growing and significant growth was there at 4 and further hours (Fig. 1C).

 

Addition of higher concentrations of the metal (>20mM) resulted in immediate death of almost whole population. At 2 and 4 hours stress, either a few or no colony was observed (Fig. 1A). However, spreading of 100µl at two hours stress resulted in the appearance of a few colonies (Fig. 1B) that were not observed when only 5 µl was spotted. At 6h of stress a significant increase in number of colonies was observed and after 24 h stress heavy growth was there though it was still significantly less than the control.

Ag+ uptake ability

After 24 h of silver stress, a brown rim appeared around periphery of each colony. The color and area of this rim gradually increased with the increase in Ag+ concentration showing the uptake of Ag+ by Klebsiella cells (Fig. 1D).

CusR expression and purification

CusR expression was taken in BL21 cells under IPTG induction. Figure 2A shows the three fractions; total cell protein (T), soluble (supernatant, S) and insoluble (pellet, P) proteins of the recombinant cells grown at 37 °C. Induced band of CusR roughly around 25 kDa in the pellet fraction showed that the protein was expressed in insoluble form. Figure 2B shows partial soluble form of CusR when cells were given heat shock followed by growth at 20 °C

Figure 2C shows the dialyzed sample and the fractions obtained from anion exchange chromatography. CusR containing fractions obtained through FPLC were later on pooled to get partially purified CusR.

 

cusRS promoter and its binding with CusR

Figure 3 shows the binding of cusRS promoter (298bp) with partially purified CusR. cusRS promoter alone appeared at 298bp position. However, cusRS promoter + protein CusR mixture appeared slightly above indicating slow movement of cusRS promoter due to its binding with CusR protein and hence increased mass. cusRS promoter + BSA (negative control) appeared at the level of cusRS promoter alone (298bp) indicating no interaction.

 

Promoter cusRS sequence analysis

CusR regulates bidirectional cusRS promoter. The regulatory elements present in this promoter include a CusR binding box, -35 box, -10 box and transcriptional start site from ‘A’ nucleotide (Fig. 3). For multiple alignment, CLUSTALW was used to check sequence homology with already reported cusRS promoter sequences from K. pneumoniae and some other species of family Enterobacteriaceae.

Effect of Ag+ on expression of copper responsive cus genetic determinants

mRNA levels of both cusRS and cusCFBA increased in response to all concentrations of Ag+ added in the medium. However, this increase was not consistent with increase in Ag+ in the medium. In the presence of 1mM Ag+, cusRS and cusCFBA mRNA levels increased 8 and 70 times, respectively as compared to the control (Fig. 4A). However, lesser fold increase of both polycistronic mRNAs was observed in the presence of 2mM Ag+. A very profound increase was observed with further increase in the metal concentration (3mM). At this level, maximum expression was found (25 and 210 fold increase of cusRS and cusCFBA, respectively than those in the absence of Ag+). When Ag+ concentration was further increased, both the RNA levels were correspondingly upregulated, though this increase was much less as compared to those in the presence of 3mM Ag+.

 

Effect of Ag+ on expression of cue genetic determinants

Change in expression level of Cus regulon (CusCFBA and CusRS) at transcriptional level was also compared to another regulon viz; Cue regulon (CopA, cueO and CueR). copA showed maximum upregulation (1168 times) in the presence of 1mM Ag+ in the medium. This decreased slightly (up to 932 times than control) with increase in Ag+ up to 3mM. However, with further increase in the metal concentration (4 -5mM), upregulation greatly decreased (remained upto 180 times compared to control). cueO and cueR exhibited upregulation up to 59.7 and 10.3 times, respectively in response to Ag+ and followed the same trend in expression in response to varying concentrations of Ag+ as exhibited by other genes under study (Fig. 4B).

Structural analysis of CusR

Amino acid sequence was used to find some physical properties using the web tool protparam (https://web.expasy.org/protparam). Total amino acids were 227, isoelectric point was 5.49 and molecular weight predicted was 25 kDa.

CusR associations and interactions with other proteins

Protein-protein interactions at sub-cellular level were calculated through STRING database (Fig. 5). This analysis yielded a multiple node interaction networks map. The interaction network analysis contained a total number of nodes to be 11 and 37 edges with 6.73 average node degree. The clustering coefficient was 0.915, and the PPI enrichment value was 9.47e-11. It was found that CusR interacts with factors involved in copper homeostasis such as Cus, Cue and Cut. This analysis also showed strong relation of CusR with ZraS that affects regulation of zinc and lead homeostasis. A weak association between CusR and RspR, a regulator of starvation sensing system, was also found.

 

Discussion

Metal resistance

K. pneumoniae, known to cause ventilator associated pneumonia, has been a major component of soil microflora. It has been known to be resistant to metals such as Ag+, Hg++ and Cd++ much more than other species - Pseudomonas fluorescens, Pseudomonas aeruginosa, Proteus mirabilis and Staphylococcus sp. (Filali et al., 2000; Wei et al., 2009; Vardhan et al., 2019). Silver has been used in medical field due to its less toxic effects on humans however its uncontrolled use has caused resistance in microorganisms posing a threat. Bacterial isolates from burn ward units possess high level of resistance against Ag+ (Norton and Finley, 2021). Panacek et al. (2018) reported E. coli grown in liquid medium containing silver nanoparticles. Our results have shown that this bacterium is able to resist high levels of silver that is 90mM. MIC of silver against two Klebsiella spp. and an Enterobacter sp. has been previously reported to be about 512mg/l, 256mg/l and 5mM, respectively (Finley et al., 2015; Randall et al., 2015; Sütterlin et al., 2017). Bacterium under study has also shown resistance against 5mM Cu++ (Zulfiqar and Shakoori, 2012), 1mM Au+. It also has shown resistance against zinc, mercury, lead and cadmium (Imran et al., 2021).

Growth of K. pneumoniae and metal uptake

Addition of silver in the growing cultures resulted in immediate death of the cell population and a very few cells could survive. In the presence of low concentrations of the metal, cells appeared to adapt and a significant number of colonies were visible after four hours that increased further at later time points. However, in the presence of these concentrations, the growth rate appeared to be dose dependent. In the presence of higher concentrations (≥20mM), cells took longer time to adapt and reinitiate growth of the metal but the growth rate was independent of the metal concentration.

Appearance of brown rim around colonies with silver stress showed metal uptake ability of K. pneumoniae KW cells. Increase in the intensity of the brown ring was also observed with increase in the metal concentration in the medium and depicting the dose dependent uptake. There are several studies which show accumulation of heavy metals in various microorganisms. Shakibaie et al. (2008) have reported accumulation of 0.35% Cu++ and 0.3% Zn++ per mg dried biomass. Mohamed and Abo-Amer (2012) reported that Gemella and Micrococcus could reduce 55% and 36% Pb and Cd, respectively from the environment. Although the resistance mechanism in these bacteria was plasmid borne, the reduction of metals was very high in contrast to the present study where the Ag+ uptake by the bacterium was 3.74%, 6.60% and 4.92% for 20, 30 and 60 mM Ag+, respectively in the medium.

The biphasic growth curve of K. pneumoniae in Figure 6 shows multiplication of bacterial cells in the presence of Ag+. The model suggests, prior to metal addition, a normal growth pattern is shown. Addition of the meal proves to be lethal and results in the immediate death of the cell population with survival of a very few cells. The time required for the restoration of growth is found to be concentration dependent. During this, the bacterial cells turn on their metal efflux system, bringing metal concentration to the subtoxic level that restores the bacterial growth.

 

Effect of Ag+ on expression of cus genetic determinants

Expression of cus determinants increased significantly in the presence of different concentrations of Ag+ that indicated their possible role in sensing and resistance against Ag+. He et al. (2021) measured cusR, S, C, F, B and A transcripts levels individually and reported almost equal upregulation in response to Cu++ however, fold increase in cusCFBA transcripts, observed in this study, in response to Ag+ is significantly high as compared to cusRS transcripts. As the concentration increased till 3mM, the more fold increase in the expression was observed. This difference in fold increase is according to the requirement of end products to make cell survive in higher concentration of metal. However, further increase in concentration of the metal ions resulted in lesser fold increase in both transcripts level. Most probably cells had shifted to some other SOS like mechanism.

Along with the Cus regulon, Cue regulon also plays an important role in the metal efflux. Therefore, the expression of genes constituting Cue regulon was also assessed at the transcriptional level and compared with that of Cus regulon. Cus regulon comprises CopA, a P-type ATPase that is known for the translocation of excess Cu+ from cytoplasm to periplasm (Rensing and Grass, 2003); CueO, a multi copper oxidase that oxidises Cu+ to less toxic form Cu++ in the periplasm and CueR, the transcription activator of cue regulon (Outten et al., 2001). These genes were also upregulated in response to Ag+ though fold increase of copA was very much high (upto 1168 fold) that remained high in the presence of 1-3mM Ag+. However, further increase in metal concentration in the medium resulted in lesser upregulation that remained ~ 200 times more as compared to the control. cueO and cueR transcripts were increased upto ~60 and ~10 times in the presence of 1-3 mM Ag+ and like copA these two genes also exhibited lesser upregulation in the presence of further increased concentrations of Ag+ in the medium. Zulfiqar et al. (2019) also find similar expression pattern of cueO in response to copper.

cusRS promoter and its binding with CusR

The exact mechanism behind the protein binding affinity of CusR with cusRS promoter is not known. Urano et al. (2017) used labeled purified protein CusR and observed its binding affinity with the cusRS promoter and another hiuH promoter containing a sequence highly similar to CusR box. Results showed that CusR had four-fold increase affinity to bind with cusRS promoter in comparison to hiuH promoter. We have also observed CusR binding with its respective promoter.

CusR interactions

CusR interactions with other proteins were analyzed using STRING data base. Strongest interaction is found between CusR and CusS. This data base also shows the biological and molecular roles of these proteins; involvement of CusR in copper and silver ion homeostasis, copper ion transmembrane transporter activity and efflux pump complex formation.

Mechanistic analysis of Cus regulon

cus regulon consists of regulatory (cusRS) and structural genes (cusCFBA). It is suggested, once CusS (sensor histidine kinase) senses metal ions, it gets phosphorylated, and transphosphorylates a transcriptional regulator CusR, which binds with the bidirectional promoter (Munson et al., 2000). The effect of a small increase in these two proteins multiplies when the promoter is activated. Figure 7 shows production of CusC, CusB and CusA proteins which are the structural components of transmembranous channel for efflux of Ag+. The tripartite complex consisting of an outer membrane protein (CusC), inner membrane protein (CusA) and a membrane fusion protein (CusB) forms an efflux channel (Kim et al., 2011). Whereas, a metal chaperon (CusF) is present in periplasm where it binds the metal ions and shift these to the efflux pump, for their export out of the cell (Loftin et al., 2005). Therefore, more number of these proteins is required for more metal to be exported.

 

Conclusions and Recommendations

Enterobacteriacae has been explored a lot in terms of metal resistance mechanisms. Each of both metals, silver and copper, acts as an inducer of two component system pathway. This study presents different behavior of K. pneumoniae KW in response to Ag+ in contrast to Cu++ (Zahid et al., 2012; Zulfiqar and Shakoori, 2012) and Au+ (data not published yet).

The occurrence of silver resistance mechanisms in gram negative pathogenic bacteria can prove to be important tool of manipulation for surveillance on the spread and emergence of silver resistant strains and the utility of silver compounds for medicinal purposes.

DECLARATIONS

Data availability statement

All data generated or analyzed during this study are included in this published article.

Funding

Research funds for this study were provided by the University of the Punjab and the Higher Commission of Pakistan, Islamabad. The researchers did not receive any specific grant from funding agencies in the public, commercial or not-for-profit sectors.

Ethical approval and consent to participate

This study was approved by the Ethical Committee of the School of Biological Sciences. No consent was required for this study.

Declaration of competing interests

The authors have not declared any financial and personal and personal relationship with the people or organization that could inappropriately influence this research work.

Statement of conflict of interest

The authors have declared no conflict of interest.

References

Asiani, K.R., Williams, H., Bird, L., Jenner, M., Searle, M.S., Hobman, J.L., Scott, D.J. and Soultanas, P., 2016. SilE is an intrinsically periplasmic molecular sponge involved in bacterial silver resistance. Mol. Microbiol., 101: 731–742. https://doi.org/10.1111/mmi.13399

Ayangbenro, A.S. and Babalola, O.O., 2017. A new strategy for heavy metal polluted environments: A review of microbial biosorbents. Int. J. environ. Res. Publ. Hlth., 14: 94. https://doi.org/10.3390/ijerph14010094

Barras, F., Aussel, L. and Ezraty, B., 2018. Silver and antibiotic, new facts to an old story. Antibiotics (Basel), 7: 79. https://doi.org/10.3390/antibiotics7030079

Brown, N.L., Barrett, S.R., Camakaris, J., Lee, B.T.O. and Rouch, D.A., 1995. Molecular genetics and transport analysis of the copper-resistance determinant (pco) from Escherichia coli plasmid pRJ1004. Mol. Microbiol., 17: 1153–1166. https://doi.org/10.1111/j.1365-2958.1995.mmi_17061153.x

Dakal, T.C., Kumar, A., Majumdar, R.S. and Yadav, V.M., 2016. Mechanistic basis of antimicrobial actions of silver nanoparticles. Front. Microbiol., 7: 1831. https://doi.org/10.3389/fmicb.2016.01831

Filali, B.K., Taoufik, J., Zeroual, Y., Dzairi, F.Z., Talbi, M. and Blaghen, M., 2000. Waste water bacterial isolates resistant to heavy metals and antibiotics. Curr. Microbiol., 41: 151-156. https://doi.org/10.1007/s0028400

Finley, P.J., Norton, R., Austin, C., Mitchell, A., Zank, S. and Durham, P., 2015. Unprecedented silver resistance in clinically isolated Enterobacteriaceae: major implications for burn and wound management. Antimicrob. Agents Chemother., 59: 4734–4741. https://doi.org/10.1128/AAC.00026-15

Franke, S., Grass, G., Rensing, C. and Nies, D.H., 2003. Molecular analysis of the copper-transporting efflux system CusCFBA of Escherichia coli. J. Bact., 185: 3804–3812. https://doi.org/10.1128/JB.185.13.3804-3812.2003

He, R., Zuo, Y., Zhao, L., Ma, Y., Yan, Q., and Huang, L., 2021. Copper stress by nutritional immunity activates the CusS-CusR two-component system that contributes to Vibrio alginolyticus anti-host response but affects virulence-related properties. Aquaculture, 532: 736012. https://doi.org/10.1016/j.aquaculture.2020.736012

Imran, M., Zulfiqar, S., Saeed, H. and Shakoori, F.R., 2021. Multi metal resistant Klebsiella pneumoniae KW is an efficient copper accumulator and bioremediator of industrial waste water. Pakistan J. Zool., 53: 2175-2182. https://doi.org/10.17582/journal.pjz/20200730092655

Kelley, L.A., Mezulis, S., Yates, C.M., Wass, M.N., and Sternberg, M.J.E., 2015. The Phyre2 web portal for protein modeling, prediction and analysis. Nat. Protocols, 10: 845-858. http://www.sbg.bio.ic.ac.uk/phyre2 (Server) http://www.sbg.bio.ic.ac.uk/phyre2 (article). https://doi.org/10.1038/nprot.2015.053

Khina, A.G., Krutyakov, Y.A., 2021. Similarities and differences in the mechanism of antibacterial action of silver ions and nanoparticles. Appl. Biochem. Microbiol., 57: 683–693. https://doi.org/10.1134/S0003683821060053

Kim, E.H., Nies, D.H., McEvoy, M.M. and Rensing, C., 2011. Switch or funnel: How RND-type transport systems control periplasmic metal homeostasis. J. Bact., 193: 2381–2387. https://doi.org/10.1128/JB.01323-10

Loftin, I.R., Franke, S., Roberts, S.A., Weichsel, A., Héroux, A., Montfort, W.R., Rensing, C. and McEvoy, M.M., 2005. A novel copper-binding fold for the periplasmic copper resistance protein CusF. Biochemistry, 44: 10533–10540. https://doi.org/10.1021/bi050827b

McQuillan, J.S., Infante, G.H., Stokes, E. and Shaw, A.M., 2012. Silver nanoparticle enhanced silver ion stress response in Escherichia coli K12. Nanotoxicology, 6: 857–866. https://doi.org/10.3109/17435390.2011.626532

Mijnendonckx, K., Leys, N., Mahillon, J., Silver, S. and Van Houdt, R., 2013. Antimicrobial silver: Uses, toxicity and potential for resistance. BioMetals, 26: 609–621. https://doi.org/10.1007/s10534-013-9645-z

Mikhailova, E.O., 2020. Top of form silver nanoparticles: Mechanism of action and probable bio-application. J. Funct. Biomater., 11: 84. https://doi.org/10.3390/jfb11040084

Mohamed, R.M. and Abo-Amer, A.E., 2012. Isolation and characterization of heavy-metal resistant microbes from roadside soil and phylloplane. J. Basic Microbiol., 52: 53-65. https://doi.org/10.1002/jobm.201100133

Mosa, K.A., Saadoun, I., Kumar, K., Helmy, M. and Dhankher, O.P., 2016. Potential biotechnological strategies for the cleanup of heavy metals and metalloids. Front. Pl. Sci., 7: 303. https://doi.org/10.3389/fpls.2016.00303

Münch, R., Hiller, K., Grote, A., Scheer, M., Klein, J., Schobert, M. and Jahn, D., 2005. Virtual footprint and prodoric: An integrative framework for regulon prediction in prokaryotes. Bioinformatics, 21: 4187–4189. https://doi.org/10.1093/bioinformatics/bti635

Munson, G.P., Lam, D.L., Outten, F.W. and O’Halloran, T.V., 2000. Identification of a copper-responsive two-component system on the chromosome of Escherichia coli K-12. J. Bact., 182: 5864-5871. https://doi.org/10.1128/JB.182.20.5864-5871.2000

Nikaido, H. and Takatsuka, Y., 2009. Mechanisms of RND multidrug efflux pumps. Biochem. biophys. Acta, 1794: 769-781. https://doi.org/10.1016/j.bbapap.2008.10.004

Norton, R. and Finley, P.J., 2021. Clinically isolated bacteria resistance to silver-based wound dressings. J. Wound Care30: 238-247. https://doi.org/10.12968/jowc.2021.30.3.238

Oshima, T., Aiba, H., Masuda, Y., Kanaya, S., Sugiura, M., Wanner, B.L., Mori, H. and Mizuno, T., 2002. Transcriptome analysis of all two-component regulatory system mutants of Escherichia coli K-12. Mol. Microbiol., 46: 281-291. https://doi.org/10.1046/j.1365-2958.2002.03170.x

Outten, F.W., Huffman, D.L., Hale, J.A. and O’Halloran, T.V., 2001. The independent cue and cus systems confer copper tolerance during aerobic and anaerobic growth in Escherichia coli. J. biol. Chem., 276: 30670-30677. https://doi.org/10.1074/jbc.M104122200

Panáček, A., Kvítek, L., Smékalová, M., Večeřová, R., Kolář, M., Röderová, M., Dyčka, F., Šebela, M., Prucek, R., Tomanec, O. and Zbořil, R., 2018. Bacterial resistance to silver nanoparticles and how to overcome it. Nat. Nanotechnol., 13: 65-71. https://doi.org/10.1038/s41565-017-0013-y

Pelgrift, R.Y. and Friedman, A.J., 2013. Nanotechnology as a therapeutic tool to combat microbial resistance. Adv. Drug Deliv. Rev., 65: 1803–1815. https://doi.org/10.1016/j.addr.2013.07.011

Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res., 29: e45–e45. https://doi.org/10.1093/nar/29.9.e45

Prabhu, S. and Poulose, E.K., 2012. Silver nanoparticles: Mechanism of antimicrobial action, synthesis, medical applications, and toxicity effects. Int. Nano Lett., 2: 32. http://www.inl-journal.com/content/2/1/32. https://doi.org/10.1186/2228-5326-2-32

Randall, C.P., Gupta, A., Jackson, N., Busse, D. and O’Neill, A.J., 2015. Silver resistance in Gram-negative bacteria: A dissection of endogenous and exogenous mechanisms. J. Antimicrob. Chemother., 70: 1037-1046. https://doi.org/10.1093/jac/dku523

Rensing, C. and Grass, G., 2003. Escherichia coli mechanisms of copper homeostasis in a changing environment. FEMS Microbiol. Rev., 27: 197–213. https://doi.org/10.1016/S0168-6445(03)00049-4

Rodriguez, R.L. and Tait, R.C., 1983. Recombinant DNA techniques: An introduction. Addison-Wesley, London. xviii+236 pages. ISBN 0 201 10870 4.

Salleh, A., Naomi, R., Utami, N.D., Mohammad, A.W., Mahmoudi, E., Mustafa, N. and Fauzi, M.B., 2020. The potential of silver nanoparticles for antiviral and antibacterial applications: A mechanism of action. Nanomaterials10: 1566. https://doi.org/10.3390/nano10081566

Shakibaie, M., Adeli-Sardou, M., Mohammadi-Khorsand,T., ZeydabadiNejad, M., Amirafzali, E., Amirpour-Rostami, S., Ameri, A. and Forootanfar, H., 2017. Antimicrobial and antioxidant activity of the biologically synthesized tellurium nanorods; a preliminary in vitro study. Iran. J. Biotechnol., 15: 268-276. https://doi.org/10.15171/ijb.1580

Silver, S., 2003. Bacterial silver resistance: Molecular biology and uses and misuses of silver compounds. FEMS Microbiol. Rev., 27: 341–353. https://doi.org/10.1016/S0168-6445(03)00047-0

Solovyev, V. and Salamov, A., 2011. Automatic annotation of microbial genomes and metagenomic sequences. In: Metagenomics and its applications inagriculture, biomedicine and environmental studies (Ed. R.W. Li), Nova Science Publishers, pp. 61-78.

Sotiriou, G.A. and Pratsinis, S.E., 2011. Engineering nanosilver as an antibacterial, biosensor and bioimaging material. Curr. Opin. Chem. Eng., 1: 3–10. https://doi.org/10.1016/j.coche.2011.07.001

Sütterlin, S., Dahlö, M., Tellgren-Roth, C., Schaal, W. and Melhus, Å., 2017. High frequency of silver resistance genes in invasive isolates of Enterobacter and Klebsiella species. J. Hosp. Infect., 96: 256–261. https://doi.org/10.1016/j.jhin.2017.04.017

Urano, H.Yoshida, M.Ogawa, A.Yamamoto, K.Ishihama, A. and Ogasawara, H., 2017Cross-regulation between two common ancestral response regulators, HprR and CusR, in Escherichia coliMicrobiology163: 243252. https://doi.org/10.1099/mic.0.000410

Vardhan, K.H., Kumar, P.S. and Panda, R., 2019. A review on heavy metal pollution, toxicity and remedial measures: Current trends and future perspectives. J. Mole. Liquids, 290: 111197. https://doi.org/10.1016/j.molliq.2019.111197

Wei, G., Fan, L., Zhu,W., Fu, Y., Yu, J. and Tang, M., 2009. Isolation and characterization of the heavy metal resistant bacteria CCNWRS33-2 isolated from root nodule of Lespedeza cuneata in gold mine tailings in China. J. Hazard Mater., 162: 50–56. https://doi.org/10.1016/j.jhazmat.2008.05.040

Zahid, N., Zulfiqar, S. and Shakoori, A.R., 2012. Functional analysis of cus operon promoter of Klebsiella pneumoniae using E. coli lacZ assay. Gene, 495: 81–88. https://doi.org/10.1016/j.gene.2011.12.040

Zulfiqar, S. and Shakoori, A.R., 2012. Molecular characterization, metal uptake and copper induced transcriptional activation of efflux determinants in copper resistant isolates of Klebsiella pneumoniae. Gene, 510: 32–38. https://doi.org/10.1016/j.gene.2012.08.035

Zulfiqar, S., Shehzad, K., Tahir, S. and Shakoori, A.R., 2019. Dual role of multicopper oxidase of Klebsiella pneumoniae as a copper homeostatic element and a noval alkaline laccase with potential application in green chemistry. Pakistan J. Zool., 51: 107-115. https://doi.org/10.17582/journal.pjz/2019.51.1.107.115