Research Article
Foot-and-Mouth Disease Serotype SAT2 Outbreak in Iraqi Buffaloes: Molecular and Epidemiological Analysis
Thaer W. Enad*, Khalefa A. Mansour
Department of Internal and Preventive Veterinary Medicine, College of Veterinary Medicine, University of Al-Qadisiyah, Iraq.
Abstract | Foot-and-mouth disease (FMD) is a viral infection that results in considerable economic losses among livestock. This article presents a molecular and epidemiological investigation of FMD serotype SAT2 in Iraq buffalo. The study involved 102 buffaloes from two provinces, Wassit and Dhi-Qar. Clinical examination within the herd revealed classic FMD signs, including salivation, oral and nasal mucosal erosions/ulcerations lesions and laminas of affected animals. The proportions of older animals were more likely to show infection (p > 0.05), but there was no significant difference. The female was the predominant sex infected (p > 0.05). However, this observation did not reach statistical significance. By semi-nested RT-PCR was used on epithelial tissue samples, 84.31% of samples were positive SAT2 serotypes. Those sequences were deposited into GenBank with accession numbers (PP898191-PP898192). At the same time, the seropositive rate was 80.39% on the ELISA test, which was used on serum samples for antibody detection. Genetic analysis revealed a close genetic relationship between the Iraqi SAT2 isolates and the Egyptian strains, suggesting a possible transmission route. This study outlines an increased risk of disease from SAT2 form and significant biosecurity challenges to Iraqi livestock, indicating requirements for focused at-risk surveillance and control efforts.
Keywords | Buffaloes, Epidemiological semi nested RT-PCR, SAT2, Foot-and-Mouth disease, Molecular
Received | July 19, 2024; Accepted | August 11, 2024; Published | October 24, 2024
*Correspondence | Thaer W. Enad, Department of Internal and Preventive Veterinary Medicine, College of Veterinary Medicine, University of Al-Qadisiyah, Iraq; Email: [email protected]
Citation | Enad TW, Mansour KA (2024). Foot-and-Mouth disease serotype sat2 outbreak in iraqi buffaloes: molecular and epidemiological analysis. Adv. Anim. Vet. Sci. 12(12): 2410-2417.
DOI | https://dx.doi.org/10.17582/journal.aavs/2024/12.12.2410.2417
ISSN (Online) | 2307-8316; ISSN (Print) | 2309-3331
Copyright: 2024 by the authors. Licensee ResearchersLinks Ltd, England, UK.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
INTRODUCTION
Foot-and-mouth disease (FMD) persists as a global challenge due to its high transmissibility and substantial economic repercussions for the livestock industry. Although the disease is endemic in several regions of the world, the continued emergence of new serotypes poses challenges for control and prevention efforts. The serotypes O, A, and ASIA1 have historically caused FMD outbreaks in the past in Iraq (Al-Salihi, 2019). However, recent reports indicate the emergence of a new serotype, SAT2 (McLaws et al., 2023). The addition of such a serotype is dangerous to animal life and raises concerns about the effectiveness of existing vaccination programs. The SAT strain of FMDV had remained geographically restricted to certain regions within Africa for many decades, due in part to specific environmental conditions. Nevertheless, recent reports of SAT2 detection in Libya, Egypt, the Palestinian Autonomous Territories, and Bahrain signify a notable change. This expansion is becoming a growing threat to livestock industries-not only in North Africa but also in neighboring Middle Eastern countries (Li et al., 2023).
The SAT2 serotype, characterized by its rapid dissemination and potential for severe clinical manifestations, has triggered outbreaks in neighbouring countries, including Turkey, Jordan, Bahrain, and Oman (Commission and Disease, 2024). Given the transboundary nature of FMD, generating comprehensive epidemiological and molecular data on the newly emerging Iraqi SAT2 strain is crucial for informing control strategies. The FMD virus in Iraq has been studied by many researchers on cows (Abd Hatem et al., 2022; Mansour et al., 2018), sheep (Dawood and Alsaad, 2018; Muhammed Saleh et al., 2013) and camels (Al-Husseiny et al., 2020). However, there is a lack of sufficient research on FMD in buffaloes, and no studies specifically address the SAT-2 strain in Iraq.
We used clinical examination, epidemiological surveys, and molecular diagnostic assays (RT-PCR, semi-nested RT PCR ELISA) to characterize the disease presentation, infection rates, and genetic relationships of the virus. The findings of this study will contribute to a better understanding of the present FMD situation in Iraq, help with risk assessment, and inform targeted intervention efforts needed to minimize negative effects caused by emergence or reemergence threats such as the one described here.
This study aims to bridge this critical knowledge gap by conducting the first comprehensive analysis of FMD serotype SAT2 in Iraqi buffaloes. To this end, the study used semi-nested PCR technology, genetic analysis, genetic sequencing, and ELISA to confirm the causative agent of FMDV.
MATERIAL AND METHODS
Ethics Approval
This study has been accepted and all procedures were carried out under the guidelines of the Scientific Committee of the College of Veterinary Medicine at Al-Qadisiyah University.
Sample Collection
Serum samples: Samples for this investigation were collected from 102 water buffalo suspected of have an FMD. The buffalo exhibited specific clinical signs upon clinical examination. Ten milliliters of blood were drawn from the jugular vein of each animal using sterile syringes and needles. The venipuncture site was cleaned with 70% ethyl alcohol and allowed to dry before sample collection. Blood samples were collected into non-anticoagulant gel tubes. In a centrifuge speed at 3,000 rpm for 10 minutes, serum was separated. Following that, the serum was collected in 1.5 Eppendorf tubes and stored at-20 °C until a sandwich enzyme-linked immunoassay was performed. Sample methods were done according (Nielsen et al., 2021).
Tissue samples
Epithelial tissue samples (n = 102) were collected from buffaloes in two regions that exhibited clinical signs of FMD. The epithelium samples were colleted and placed in a plastic container containing Trizol® (Amirouche et al., 2021). All samples were then frozen at-20 °C for the time of the PCR test.
Extraction of Viral RNA
Following the manufacturer’s protocol, we employed the AccuZolTM Total RNA Extraction Kit. (Bioneers, Korea) to isolate viral RNA from our samples. The extracted RNA was subsequently assessed using a Nano-Drop instrument. This purified RNA then served as the starting material for cDNA synthesis, which was subsequently stored until ready for RT-PCR analysis as shown in the following Figure 1.
cDNA Synthesis
Complementary DNA (cDNA) was synthesized from the extracted RNA, specifically targeting mRNA transcripts. This was achieved by employing the HiSenScript™ RH (-) RT Premix Kit, following the directions provided by the manufacturer.
The RT-PCR product was further amplified using semi-nested PCR with SAT2-specific primers targeting a 506 bp amplicon within the VP1 gene. The primers were designed in this study using the NCBI database and Primer3Plus software and were synthesized by Macrogen, Korea, as shown in the following Table 1.
Table 1: Primer sequences of SAT-2 utilized in (snRT-PCR).
|
Primer |
Sequence |
PCR amplicon |
|
|
Universal FMD |
F |
GCCTGGTCTTTCCAGGTCT |
328 |
|
R |
CCAGTCCCCTTCTCAGATC |
||
|
FMD SAT2 |
F |
CACACATGTCCACACAGGGA |
715 |
|
R |
GCGCGTCGAATCTGTCTCTA |
||
|
Nested PCR Universal FMD |
F |
GTACTGTGTTTGGCTCCACG |
239 |
|
R |
GCATCCTTAGCCTGTCACCA |
||
|
Semi-nested PCR FMDV SAT2 |
F |
CACACATGTCCACACAGGGA |
506 |
|
R |
GACTGGCTTGTCGACGGTTA |
||
SEMI NESTED PCR Thermocycling Conditions
PCR thermal conditions were conducted by using Semi nested PCR thermocycler system as mentioned in the following Table 2.
Table 2: Semi Nested PCR thermal cycling conditions.
|
PCR step |
conditions |
cycle |
|
Pre-template denature |
5min at 95˚C |
1 |
|
template denature |
30sec at 95˚C |
30 cycles |
|
Primer anneals |
30sec at 59˚C |
|
|
Primer extension |
30 sec at 72˚C |
|
|
Final extension |
5min at 72˚C |
1 |
|
Inactivation |
4 C |
- |
RESULTS AND DISCUSSION
The clinical investigation results, depending on semi-nested RT-PCR, are listed in Table 3. The important clinical manifestations observed are profuse salivation hanging in long ropy strings up to the ground (Figure 2A). In addition, there are erosions and ulcers on the nostrils and muzzle (Figure 2B). There were erosions, or ulcers on the gums, dental pad, hard palate, tongue, and inside of the mouth (Figure 3A). There were also skin sores in the coronary region and interdigital cavity of the hoof (Figure 3B).
The results of study of recurrent clinical signs, showed the highest rate was observed in Anorexia was seen in 79 buffaloes, accounting for 77.45% of the total, whereas 23 buffaloes (22.55%) did not show this symptom. Salivation was seen in 73 buffaloes (71.57%), while 29 buffaloes (28.43%) did not exhibit this indication. Oral lesions were present in 71 buffaloes (69.61%), while 31 buffaloes (30.39%) lacked this symptom. Nostril lesions afflicted 46 buffaloes (45.10%), whereas 56 buffaloes (54.90%) did not show this symptom. Lameness was seen in 43 buffaloes (42.16%), while 59 buffaloes (57.84%) did not exhibit this symptom.
Table 3: Clinical signs of FMD in Buffalo results.
|
Clinical signs |
Observed with signs |
No signs |
||
|
N |
% |
N |
% |
|
|
Anorexia |
79 |
77.45% |
23 |
22.55% |
|
Saliva |
73 |
71.57% |
29 |
28.43% |
|
Oral lesion |
71 |
69.61% |
31 |
30.39% |
|
Nostril lesion |
46 |
45.10% |
56 |
54.90% |
|
Lameness |
43 |
42.16% |
59 |
57.84% |
|
Interdigital lesion |
32 |
31.37% |
70 |
68.63% |
|
Calculated χ2 |
32.744 |
|||
|
Calculated P value |
0.0000042 HS |
|||
HS: High significant difference between groups (p <0.01).
Finally, interdigital lesions were seen in 32 buffaloes (31.37%), whereas 70 buffaloes (68.63%) were clear of this condition. The chi-square statistic of 32.744 and p-value of 0.0000042 show a significant difference (p < 0.01). This major finding shows that the incidence of these clinical indications varies greatly across buffaloes, with some being more prevalent than others. Table 3, shown in Figure 4.
Infection Rate of FMD According to Age
The results of the epidemiological study according to age groups showed that the youngest age groups (6-18 months and 18-36 months) had the lowest incidence of FMD, with 82.05% and %82.14 Furthermore, the age groups with the highest incidence of FMD virus were those 36 months and above, with percentages of (88.57 %) Table (4), shown in Figure (5).
Table 4: FMD infection rate according to age.
|
Age |
Buffaloes |
Infected buffaloes N (%) |
Non-Infected buffaloes N(%) |
|
6-18 (months) |
39 |
32 (82.05%) |
7 (17.95%) |
|
18-36 (months) |
28 |
23 (82.14%) |
5 (17.86%) |
|
36 months and above |
35 |
31 (88.57%) |
4 (11.43%) |
|
Total |
102 |
86 (84.31%) |
16 (15.69%) |
|
Calculated χ2 |
0.542 |
||
|
P value |
0.763 NS |
||
NS: Non significant difference between groups (p > 0.05).
Infection Rate of FMD According to Gender
The result of incidence of FMD according to age revealed that the male at percentage (80.55%) had less affected than female had percentage (86.36%) Table 5, shown in Figure 6.
Detection of FMD using ELISA and RT-PCR
The percentage of incidence of FMD confirmed using multiple methods and two different types of samples, including blood and tissue samples, revealed 72/102 (70.58), 82 (80.39%), 86/102 (84.31) for conventional RT-PCR, ELISA, and semi-nested RT-PCR respectively as shown in Table 6, shown in Figure 7. The study findings indicated that there was statistically significant variation observed among the different tests used, as determined by the Chi-Square evaluation.
Table 5: FMD infection rate according to gender.
|
Gender |
Buffaloes |
Infected buffaloes N (%) |
Non-Infected buffaloes N (%) |
|
Male |
66 |
57 (82.14%) |
9 (17.86%) |
|
Female |
36 |
29 (88.57%) |
7 (11.43%) |
|
Total |
102 |
86 (84.31%) |
16 (15.69%) |
|
Calculated χ2 |
0.594 |
||
|
P value |
0.441 NS |
||
NS: Non significant difference between groups (p > 0.05).
Table 6: FMD infection rate in buffaloes based on the different test.
|
Tests |
Infected buffaloes N (%) |
Non-Infected buffaloes N (%) |
Calculated 𝛘2 |
P value |
|
|
RT-PCR |
Conventional |
72 (70.58%) |
30 (29.42%) |
6.027 |
0.0491 S |
|
Semi-nested |
86 (84.31%) |
16 (15.69%) |
|||
|
ELISA |
82 (80.39%) |
20 (19.61%) |
|||
|
Total |
102 (100%) |
||||
S: Significant difference between groups (p < 0.05).
Molecular Detection
Detection of FMD using RT-PCR: A total of 102 buffalo samples were analysed using conventional reverse transcription-polymerase chain reaction (RT-PCR). Initially, a universal FMDV primer targeting the VP1 gene was used, yielding a 328 bp amplicon in positive samples. Subsequent testing with a serotype-specific primer for SAT2 FMDV, targeting a 715 bp amplicon within the VP1 gene, revealed 86 out of the initial 102 samples (84.31%) to be positive for this serotype. No samples tested positive for serotypes O or A (Figure 8).
Semi-Nested RT-PCR result: The results of using a specific primer for the viral protein 1 gene (VP1) of SAT-2 of FMD at (506 pb) were amplified by semi-nested RT-PCR.The results showed that 86 (84.31%) buffalo out of 102 community isolates tested positive for SAT-2 serotypes (Figure 9).
Enzyme-Linked Immunosorbent Assay
The result of serological study showed that 80.39% (82/102) positive results for FMDV as shown in the following Table 6.
Epidemiological Study of FMD
Clinical manifestation: The clinical study showed that animals infected with FMD suffered from anorexia, saliva, oral lesion, nostril lesion, lameness and interdigital lesion the results of this study agree with the findings of previous studies on FMD in buffalo (Hashem et al., 2018). Depression and anorexia are common early signs of the disease, while lesions of the mouth, nose, and feet appear later. The lameness can be so severe that affected animals are unable to move (Mohebbi et al., 2017). Vesicles occur when cytokines, cellulose, other proteins, and inflammatory cells from blood vessels enter the tissue, manifesting as oedema (Zhang et al., 2022). The body temperature may have increased due to the release of endogenous pyrogens including interleukins and tumour necrosis factor-α in response to antigen interaction (Jafarsab, 2022).
Infection rate of FMD according to age: The infection rate of FMD according to age the results of this study from suggest a possible reduction in FMD in young cattle (6-18 months and 18-36 months) compared to adult animals (greater than 36 months) but do not have statistical significance differences at (p > 0.05). The results agreed with many other epidemiological studies on FMD that found no significant differences between different age groups and FMDV infection rates (Awel et al., 2021). The lack of significant differences in the high incidence of infection between different age groups might be due to the attributed of rearing by not separating young animals from their mothers as well as the communal grazing practices (Al-Ajeeli et al., 2018). However, it’s important to note that our study may have been underpowered to detect subtle differences due to the relatively small sample size. On the other hand, other researchers (Salim et al., 2020) mentioned that all age groups infected with FMD were equal.
Infection rate of FMD according to gender:
The results did not find statistically significant differences between the infection rates with the FMD virus between males and females, although the infection rate in females was slightly higher. The results of this study agreed with (Dubie et al., 2021). This may be attributed to physiological factors like lactation, pregnancy, and estrus (Aghaalikhani, Hossein and Ahmadi, 2018).However, it’s worth noting that other studies have reported different findings, with some showing a higher prevalence in males (Chowdhury et al., 2020) and others finding no difference (Belina et al., 2016). These discrepancies could be due to variations in study populations, diagnostic methods, or other factors.
Molecular Detection
The high prevalence (70.58%) of SAT2 FMDV in the conventional PCR-tested buffalo population and the detection rate was 84.31% by semi-nested RT-PCR aligns with previous studies (El Damaty et al., 2021) reported 100% prevalence of SAT2 FMDV in 54 examined buffalo samples using RT-PCR targeting the VP1 gene. Similarly (Hagag et al., 2019) found 96% of 100 buffalo samples to be positive for FMDV using VP1 gene-based primers. In Iran, (Fs et al., 2022) reported a 73% prevalence of FMDV in cattle using PCR. However, the high prevalence observed in this study contrasts with lower rates reported in other countries (Abd El-Rahim et al., 2016) found a 26% seroprevalence of FMD in Saudi Arabia. These differing prevalence rates might be due to several factors, including differences in diagnostic methods, animal breeds, disease stage, vaccination programs, and geographic/climatic variations (Ullah et al., 2023).
Furthermore, a wide range of genetic variants of FMD virus and its presence in 7 different serotypes present significant difficulties in identifying the virus but this study used a semi-nested RT-PCR method which proved successful in detecting SAT-2 (Chen et al., 2022; Wong et al., 2020).
Enzyme-Linked Immunosorbent Assay
In this study, use of ELISA as a diagnostic tool to detect FMDV antibodies in buffalo serum samples showed its effectiveness and reliability (Wong et al., 2020; Yan et al., 2023). The results of serological tests showed the presence of antibodies to FMDV virus in 80.39% of the samples, indicating a high prevalence of the disease among the study population. The high seropositivity in our results from this investigation is agreed with high seropositivity reported (Dickmu et al., 2022).
The high seropositivity in our results from this investigation agrees with a high seropositivity reported in Al-Qadisiyah and Basrah (Ajeeli et al., 2012; Al-Rodhan, 2018). while the infection rates in Al-Najaf and Diyala were 34% and 25.33%, respectively (Abd Hatem et al., 2022; Al-Ajeeli et al., 2018).
This variation in seroprevalence across different regions of Iraq may be attributed to differences in vaccination coverage, animal husbandry practices, or the presence of other confounding factors. Differentiation between vaccinated and infected animals is important for prevention planning. ELISA is used to detect infected animals by detecting non-structural proteins such as 3AB, 3ABC, 2C,2B and other targets. Antibodies occurred on days 4-10 post-infection in all animals with no history of prior exposure to FMDV antigens (Wong et al., 2020).
The high distribution suggests that the SAT-2 serotype is responsible for the outbreak, consistent with previous reports of an SAT-2 outbreak in Iraq in 2023 (McLaws et al., 2023).
This study has several limitations. The convenience sampling method may not be representative of the entire buffalo population in Iraq. The relatively small sample size limits the generalizability of the findings. Additionally, the study may have lacked data on certain potential confounding factors, such as vaccination history and animal movement patterns, which could influence the observed infection rates. Future studies should aim to address these limitations by using more representative sampling methods, increasing sample sizes, and collecting more comprehensive data on potential confounding factors. Further research is also needed to investigate the transmission dynamics of FMDV SAT2 in Iraqi buffalo populations, evaluate the effectiveness of current vaccination strategies against this serotype.
CONCLUSIONS AND RECOMMENDATIONS
The SAT2 serotype is responsible for the foot and mouth disease outbreaks in Iraq in 2023. which were not previously documented in the country. The study verifies previously documented clinical indications of FMD in buffaloes, such as fever, decreased appetite, ulcers in the mouth and foot, and restricted movement. While we found no statistically significant differences in infection rates between age groups or genders, it is important to note that our study may have been underpowered to detect subtle differences due to the relatively small sample size. There were no significant differences in infection rates between age groups or genders. Compared to ELISA, semi-nested RT-PCR demonstrated higher effectiveness and accuracy in SAT-2 serotype detection. This study represents the first comprehensive analysis of FMD serotype SAT2 in Iraqi buffaloes and provides crucial insights into the epidemiology and molecular characteristics of this newly emerged strain in the region. Based on our findings, we recommend that surveillance and control efforts be intensified and specifically targeted towards the SAT2 serotype. Existing vaccination strategies should be evaluated for their effectiveness against this new strain, and novel vaccine formulations may need to be developed to ensure adequate protection for Iraqi buffalo populations.
ACKNOWLEDGEMENTS
Thanks, from the authors to the staff at Department of Internal and Preventive Veterinary Medicine, College of Veterinary Medicine at Al-Qadisiyah University in Iraq for their cooperation and the facilities they provided while processing the samples.
NOVELTY STATEMENT
The study’s novelty is its focus on diagnosing the SAT 2 strain of FMD recently introduced to Iraq and its effect on the Iraqi buffalo using different field and laboratory methods. It is considered the first study in Iraq to study this strain in detail. We have registered the first Iraqi SAT 2 strain in the International Gene Bank.
AUTHORS’ CONTRIBUTIONS
Both of these authors contributed equally.
Conflict of Interest
The authors have declared no conflicts of interest.
REFERENCES
Ajeel AY, Alordhan ANM, Kshash HQ (2012). Clinical and Diagnostic Study of Foot and Mouth Disease by using ELISA test in Cattle of AL-DiwaniyA AL-Qadisiyah J. Vet. Med. Sci., 11 (2): 91-98.
Abd El-Rahim IHA, Asghar AH, Mohamed AM, Fat’hi SM (2016). The impact of importation of live ruminants on the epizootiology of foot and mouth disease in Saudi Arabi. A Rev. Sci. Tech., 35 (3): 769-778. https://doi.org/10.20506/rst.35.3.2567
Abd Hatem A, Ahmed Abdul Wahid Al Anbagi N, Al-Alo KZK, Sabah Bustani G (2022). Detection of Antibody against Non-Structural Proteins of Foot-and-Mouth Disease Virus in Cattle in Najaf, Iraq. Arch. Razi Inst., 77 (3): 1185-1189. https://doi.org/10.22092/ARI.2022.357621.2074
Aghaalikhani Hossein, Ahmadi E (2018). Research Article Research Article. Arch. Anesthesiol. Crit. Care, 4 (4): 527-534. http://wwW globalbuddhisM org/jgb/index.php/jgb/article/view/88/100
Al-Ajeeli KS, Al-Azawy AK, Al-Anbagi GK, Abdul-Rasoul LMS (2018). Sero-prevalence of foot and mouth disease in cattle by 3ABC NSP ELISA. Indian J. Nat. Sci., 9 (51): 15425-15435.
Al-Husseiny SH, Kshash QH, Jassim A (2020). Sero-detection of foot and mouth disease virus serotypes a and o in one-humped camels (Camelus dromedarius) in the middle of Iraq. Kafkas Univ. Vet. Fak. Derg., 26 (6): 743-747. https://doi.org/10.9775/kvfd.2020.24276
Al-Rodhan AM (2018). Detection of Cattle Foot and Mouth disease Virus by RT-PCR and ELISA In Kufa. J. Vet. Med. Sci., 2 (5): 6-9.
Al-Salihi KA (2019). The epidemiology of foot-and-mouth disease outbreaks and its history in Iraq. Veterinary World, 12 (5): 706-712. https://doi.org/10.14202/vetworld.2019.706-712
Amirouche A, Ait-Ali D, Nouri H, Boudrahme-Hannou L, Tliba S, Ghidouche A, Bitam I (2021). TRIzol-based RNA extraction for detection protocol for SARS-CoV-2 of coronavirus disease 2019. New Microb. New Infect., 41: 100874. https://doi.org/10.1016/j.nmni.2021.100874
Awel SM, Dilba GM, Abraha B, Zewde D, Wakjira BS, Aliy A (2021). Seroprevalence and Molecular Detection of Foot and Mouth Disease Virus in Dairy Cattle Around Addis Ababa Central Ethiopi. A Veterinary Medicine. Res. Rep., 12: 187-197. https://doi.org/10.2147/vmrr.s317103
Belina D, Girma B, Mengistu S (2016). Sero-Prevalence of Bovine Foot and Mouth Disease in Selected Districts of Eastern Showa Zone, Oromia Regional State, Ethiopia Sero Prevalence of Bovine Foot and Mouth Disease in Selected Districts of Eastern Showa Zone Oromia Regional State Ethiopia. Global J. Sci. Front. Res., 16 (7): 79-84.
Chen W, Wang,W, Wang X, Li Z, Wu K, Li X, Li Y, Yi L, Zhao M, Ding H, Fan S, Chen J (2022). Advances in the differential molecular diagnosis of vesicular disease pathogens in swine. Front. Microbiol., 13 (10): 1-18. https://doi.org/10.3389/fmicb.2022.1019876
Chowdhury MSR, Ahsan MI, Khan MJ, Rahman MM, Hossain MM, Harun-Al-Rashid A, Ahmed SSU, Uddin MB (2020). Data on prevalence, distribution and risk factors for Foot and Mouth Disease in grazing cattle in haor areas of Banglades H. Data in Brief, 28: 104843. https://doi.org/10.1016/j.dib.2019.104843
Commission E, Disease F (2024). Foot-and-mouth disease quarterly report January - February - March.
Dawood AA, Alsaad KM (2018). Clinical and Diagnostic Studies of Myocarditis Result from FMD In Lambs. IOSR J. Agric. Vet. Sci., 11 (7): 1-10. https://doi.org/10.9790/2380-1107010110
Dickmu SJ, Awah-Ndukum J, Aziwo NT, Sevidzem SL, Mouliom MM, Rueda CB, Kassimi LB, Wade A, Garabed R, El-Yuguda AD, Rodriguez L, Baba SS (2022). Molecular and Serological Epidemiology of Foot-and-Mouth Disease Virus in North Region of Cameroon. Adv. Microbiol., 12 (10): 579-595. https://doi.org/10.4236/aim.2022.1210040
Dubie T, Negash W (2021). Seroprevalence of bovine foot and mouth disease (FMD) and its associated risk factors in selected districts of Afar region. Ethiop. Vet. Med. Sci., 7 (5): 1678-1687. https://doi.org/10.1002/vms3.574
El Damaty HM, Fawzi EM, Neamat-Allah ANF, Elsohaby I, Abdallah A, Farag GK, El-Shazly YA, Mahmmod YS (2021). Characterization of foot and mouth disease virus serotype sat-2 in swamp water buffaloes (Bubalus bubalis) under the egyptian smallholder production system. Animals, 11 (6): 22-28. https://doi.org/10.3390/ani11061697
Fs M, B AK Khosravi A, Khorasani A, Mk K, Mm R, Ar Y, Mahravani H, Majidi S, Ranji M (2022). Original Article Comparison of Immune Assay and Molecular Methods for Diagnosis of FMD Virus. Iran. J. Virol., 16 (2): 57-63.
Hagag NM, Hamdy ME, Sargious MA, Elnomrosy SM, Ahmed NA, Hamed AA, Habashi AR, Ibrahiem EI, Abdel-Hakim MA, Shahein MA (2019). Molecular and Genetic Characterization of Newly Circulating Foot and Mouth Disease Virus (FMDV) Serotype SAT2 in Egypt during 2018 and Early 2019. Hosts and Viruses, 6 (5): 5-10. https://doi.org/10.17582/journal.hv/2019/6.5.103.108
Hashem M, El-Mandrawy S, El-Araby I, El-Sayed A (2018). Molecular Diagnosis of Foot and Mouth Disease Virus in Cattle with Reference to Hematological and Biochemical Changes. Zagazig Vet. J., 46 (2): 105-116. https://doi.org/10.21608/zvjz.2018.14382
Jafarsab, Ravindra B, Sandeep H, Bhagavantappa B, Prashantkumar W, Vivek RK, NAP (2022). Diagnostic evaluation of foot and mouth disease in cattle. The Pharm. Inn. J., 11 (7): 2360-2363. www thepharmajournal.com
Li Q, Wubshet A K, Wang Y, Heath L, Zhang J (2023). B and T Cell Epitopes of the Incursionary Foot-and-Mouth Disease Virus Serotype SAT2 for Vaccine Development. Viruses, 15 (3): 1-23. https://doi.org/10.3390/v15030797
Mansour KA, Naser HH, Hussain MH (2018). Clinical, molecular detection and phylogenetic analysis study of local foot-and-mouth disease virus in Al-Qadisiyah province of Iraq. Vet. World, 11 (9): 1210-1213. https://doi.org/10.14202/vetworld.2018.1210-1213
Mohebbi MR, Barani SM, Mahravani H (2017). An uncommon clinical form of foot-and-mouth disease in beef cattle presented with cornual skin lesions. Iran. J. Vet. Res., 18 (4): 291-293.
Muhammed Saleh WM, Hasso SA, Abdulla FA (2013). Serological diagnosis of FMD in sheep in basra by ELISA test. Iraqi J. Vet. Sci., 27 (2): 79-84. https://doi.org/10.33899/ijvs.2013.82785
Nielsen SS, Alvarez J, Bicout DJ, Calistri P (2021). Scientific Opinion on the assessment of the control measures for category A diseases of Animal Health Law: Foot and Mouth Disease. EFSA J., 19 (6): e06632. https://doi.org/10.2903/j.efsa.2021.6632
McLaws M, Ahmadi BV, Condoleo R, Limon G, Kamata A, Arshed M, Rozstalnyy A, Rosso F, Dhingra M (2023). Risk of foot-and-mouth disease SAT2 introduction and spread in countries in the Near East and west Eurasia. FAO Qualitative Risk Assessment, 10 (3):6-10. https://doi.org/10.4060/cc8173en
Salim SAS, Talb AOQ, Yousif AS, Daher HS (2020). Prevalence and risk factors of foot and mouth disease virus in Nineveh province, Iraq. Adv. Anim. Vet. Sci., 8 (1): 1-10. https://doi.org/10.17582/journal.aavs/2020/8.1.1.10
Ullah M, Li Y, Munib K, Rahman HU, Zhang Z (2023). Sero-Epidemiology and Associated Risk Factors of Foot-and-Mouth Disease (FMD) in the Northern Border Regions of Pakistan. Vet. Sci., 10 (5): 56-63. https://doi.org/10.3390/vetsci10050356
Wong CL, Yong CY, Ong HK, Ho KL, Tan WS (2020). Advances in the Diagnosis of Foot-and-Mouth Disease. Front. Vet. Sci., 7 (8): 1-24. https://doi.org/10.3389/fvetS 2020.00477
Yan J, Gao Y, Li J, Li M, Guo C, Bai J, Jiang P (2023). The Establishment and Application of Indirect 3AB-ELISA for the Detection of Antibodies against Senecavirus a virus. Front. Vet. Sci., 15 (4): https://doi.org/10.3390/v15040861
Zhang T, Lu B, Yang B, Zhang D, Shi X, Shen C, Cui H, Yuan X, Zhao D, Yang J, Hao Y, Chen X, Liu X, Zhang K, Zheng H (2022). Component Identification and Analysis of Vesicular Fluid from Swine Infected by Foot-and-Mouth Disease Virus. In Front. Vet. Sci., 7 (9): 44-49. https://www frontiersin.org/articles/10.3389/fvetS 2022.860978