Research Article
Genetic Characterization of the Vang Cattle Population using mtDNA Chromosomal, Y Chromosomal Haplotypes and Polymorphisms of Genes Associated with Economic Traits
Nguyen Ba Trung1,2*, Pham Thi Kim Phuong1,2
1An Giang University, An Giang, Vietnam. No. 18, Ung Van Khiem Street, Dong Xuyen Ward, Long Xuyen, An Giang, Vietnam; 2Vietnam National University, Ho Chi Minh City, Vietnam.
Abstract | The local Vang cattle currently live primarily in the An Giang Seven Mountains, Vietnam. In some of the villages of the ethnic minority, cattle have phenotypes of Vietnam native Vang cattle, with very poor milk yield, carcass weight, and limited information about fertility. Consequently, cattle are at risk of becoming extinct, and the genetic diversity and polymorphism of genes linked to economically important traits have not yet been examined. This study centered on examining the genetic traits of Vang cattle by utilizing molecular markers. We investigated the nucleotide sequences of mitochondrial DNA and the SRY gene on the Y chromosome, as well as performed genotyping of the DGAT1, NCAPG, and RNF212 genes related to economically important traits such as milk yield, carcass weight, and fertility within the Vang cattle population. The analysis of the mitochondrial DNA sequences indicated that the Vang cattle carry the Bos indicus type I1 haplotype, which implies a significant level of genetic diversity within their maternal lineage. According to the SRY gene sequence study, all of the males have a zebu-type haplotype, which could have resulted from a hybrid between Bos javanicus and zebu. Based on the genotyping analysis of the functional genes, the DGAT1 gene exhibits polymorphism, whereas the NCAPG and RNF212 genes display monomorphism. This result may have important implications for improving milk yield of the Vang breed based on molecular markers of the DGAT1 gene. Therefore, the present study may provide useful information for future breeding and conservation efforts of this Vang breed.
Keywords | Vang cattle, Genetic diversity, mtDNA, Polymorphisms, SNPs, Y chromosome
Received | August 12, 2024; Accepted | September 09, 2024; Published | October 24, 2024
*Correspondence | Nguyen Ba Trung, An Giang University, An Giang, Vietnam. No. 18, Ung Van Khiem Street, Dong Xuyen Ward, Long Xuyen, An Giang, Vietnam; Email: nbtrung@agu.edu.vn
Citation | Trung NB, Phuong PTK (2024). Genetic characterization of the vang cattle population using mtdna chromosomal, y chromosomal haplotypes and polymorphisms of genes associated with economic traits. Adv. Anim. Vet. Sci. 12(12): 2418-2426.
DOI | https://dx.doi.org/10.17582/journal.aavs/2024/12.12.2418.2426
ISSN (Online) | 2307-8316; ISSN (Print) | 2309-3331
Copyright: 2024 by the authors. Licensee ResearchersLinks Ltd, England, UK.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
INTRODUCTION
There are more than six unique indigenous cattle breeds and more than fourteen imported cattle breeds in Vietnam (Pham et al., 2013; Hoang Kim Giao, 2009). Of which, the Vietnamese Vang (Yellow) cattle is a native breed, and there is no purebred breed. These animals are referred to by various names depending on the region and ethnic group. They are adaptable to harsh environments, resistant to diseases, low feed requirements, and have a beautiful coat color with a bright yellow color. Therefore, this was the main breed of cattle, raised for a long time in Vietnam (Huyen Le Thi and Karen, 2020). The specific type of cattle focused on in this research is known as the Vang cattle among the ethnic minorities residing in the Seven Mountains area of An Giang Province. Accordingly, the milk production and carcass weight of the cattle are notably low, and there is also a scarcity of data regarding their fertility. As a result, the Vang cattle are at risk of extinction. Therefore, the decline in genetic diversity is happening rapidly, while information on population genetic diversity and the phylogenetic relationship of the An Giang Vang cattle has not been clearly published.
Since livestock’s economically important characteristics, like milk yield, carcass weight, and fertility, are impacted by a combination of genes, the genetic profiles of these genes can be utilized to assess the livestock’s genetic potential. For instance, studies by Ripol et al. (2006); Hoashi et al. (2007); Kong et al. (2008), Yamada et al. (2008), Lindholm-Perry et al. (2013); Cardoso et al. (2014) have demonstrated the impact of genetic variations on beef cattle productivity. Additionally, research by Nishimaki et al. (2016); Okuda et al. (2017); Le et al. (2018) explored genotype distribution and frequency in cattle breeds to assess their genetic capabilities. Since` genetic polymorphisms can be applied to marker-assisted selection for economically valuable traits, investigating genetic polymorphisms in Vang cattle could aid in both genetic characterization and conservation efforts of this traditional breed, as well as enhancing their genetic potential. In this study, we analyzed the polymorphisms of three key genes in the Vang cattle. These included the diacylglycerol O-acyltransferase 1 (DGAT1) gene, which is linked to milk production and fat content (Grisart et al., 2002), the non-SMC condensin I complex subunit G (NCAPG), associated with carcass weight (Eberlein et al., 2009), and the ring finger protein 212 (RNF212) gene, which plays a significant role in controlling crossover events during meiosis and is related to high fertility (Sandor et al., 2012). These were genotyped using PCR-RFLP methods. Additionally, we studied mitochondrial DNA (mtDNA) and Y-chromosome haplotypes in Vang cattle. Since mtDNA is maternally inherited and Y-chromosomal sequences follow paternal inheritance, these markers have been widely used to trace the maternal and paternal phylogenetic lineages of livestock. (Edwards et al., 2007; Mohamad et al., 2012; Syed et al., 2013; Le et al., 2018). Notably, bovine mtDNA and Y-chromosome haplotypes are divided into Bos taurus and Bos indicus (zebu) haplogroups (Achilli et al., 2009; Verkaar et al., 2003).
MATERIALS AND METHODS
Sample Collection
Due to budget limitations as well as the suitable sample sizes in the studies of Okuda et al. (2017); Le et al. (2018), a total of thirty blood samples were randomly collected from healthy Vang cattle aged between 2 and 5 years, comprising fifteen females and fifteen males, from a household in the villages of the ethnic minority in the Seven Mountains area of An Giang Province, Vietnam. In adherence to ethical animal practices, approximately 2 mL of blood was drawn from the jugular vein, and the blood samples were preserved at 4°C. Genomic DNA extraction involved standard procedures for isolating white blood cells through centrifugation, followed by protein digestion using Proteinase K, DNA extraction with a combination of phenol, chloroform, and isoamyl alcohol, and DNA precipitation using ethanol (Barker, 1998). The concentration of the total DNA yield was assessed with a Nanodrop 2000 spectrophotometer (ThermoFisher Scientific, USA).
Examination of mtDNA and SRY Gene Haplotype Diversity
To assess the haplotype diversity of mitochondrial DNA (mtDNA) in Vang cattle, a 650-bp mtDNA fragment was amplified using specific primer pairs (Table 1), based on the forward primer described by Loftus et al. (1994) and the reverse primer outlined by Le et al. (2018). The resulting
Table 1: Sequences of primers, lengths, and the annealing temperatures for functional genes.
|
Gene |
Primer sequences (5’- 3’) |
Lengths (bp) |
Annealing temperatures (oC) |
Resources |
|
mtDNA |
F: CTGCAGTCTCACCATCAACC R: CCTTTGACGGCCATAGCTGA |
650 |
58 |
Loftus et al. (1994) Thu et al. (2018) |
|
SRY |
F: CCGGGCTATAAATATCGACCT |
1062 |
58 |
Nijman et al. (2008) |
|
R:GATGAAACCTTGGGTCTCACAG |
||||
|
DGAT1 |
F: GCACCATCCTCTTCCTCAAG |
411 |
66 |
Grisart et al. (2002) |
|
R: GGAAGCGCTTTCGGATG |
||||
|
NCAPG |
F: ATTTAGGAAACGACTACTGG |
129 |
51 |
Eberlein et al. (2009) |
|
R: ATTTGTATTCTCTTATTATCATC |
||||
|
RNF212 |
F: GGGTCACCACAGTCCAGAGT |
567 |
58 |
Sandor et al. (2012) |
|
R: GCTGCCTGTAAGGAGGTTCT |
Table 2: Restriction enzymes and genotyping.
|
Gene |
Cut positions |
Restriction enzymes |
Temperature (oC)/time |
Genotype |
Allele size (bp) |
|
DGAT1 (K232A) |
5’…AA/GC…3’ |
EaeI |
37/24 hours |
KK KA AA |
411 411; 203; 208 203; 208 |
|
NCAPG (A>G) |
5’…AA/TT..3’ |
Tsp509I |
65/45 minutes |
GG GT TT |
129 129; 66; 63 66; 63 |
|
RNF212 (C>T) |
GGATC(N)4 CCATG(N)5 |
AlwI |
37/24 hours |
CC CT TT |
386; 168; 13 386; 203; 168; 183; 13 203; 183; 168 |
amplified fragment was subsequently sequenced directly using these primers. The polymerase chain reaction (PCR) was conducted with a total volume of 10 μl DNA, containing 0.2 μM of each primer, 0.2 μmol/l dNTPs, 2×PCR buffer, and 1U of Kod FX Taq DNA polymerase (Toyobo, Osaka, Japan). The PCR protocol consisted of 35 cycles involving denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 90 seconds. Following amplification, the PCR products were run on an agarose gel in TAE buffer, stained with 6X GelRed® dye (Biotum, USA), and separated through electrophoresis on a 2% agarose gel using 0.5X TAE buffer at 100V for 25 minutes, with HaeIII serving as a standard molecular weight ladder. The results from electrophoresis were analyzed using the Gel DocTM XR+ system (Bio Rad, USA).
The electrophoresis outcomes following purification with Exo sap enzymes were subjected to Sanger sequencing. The resulting sequence data were aligned utilizing MEGA11 software (Tamura et al., 2021), ultimately producing a 240-bp dataset spanning from position 16,023 to 16,262 of the mtDNA gene sequence. This was compared with sequences and accession codes in GenBank (NCBI), specifically V00654 for Bos taurus and L27733 for Bos indicus (Troy et al., 2001; Chen et al., 2010).
To examine the Y-chromosomal haplotypes of fifteen male Vang cattle, a 1,062 bp fragment of the SRY gene located in the male-specific region of the Y chromosome was amplified using a primer pair listed in Table 1 (Nijman et al., 2008). These amplified fragments were sequenced simultaneously using the same primers. The PCR reactions were conducted in 10 μL mixtures, each containing 10 ng of genomic DNA, 0.2 μM primers, 0.25 μmol/L dNTPs, 2× PCR buffer, and 1 U of Kod FX Taq polymerase (Toyobo, Osaka, Japan). The amplification protocol consisted of 35 cycles, featuring a denaturation step at 94°C for 15 seconds, annealing at 58°C for 30 seconds, and an extension phase at 72°C for 45 seconds (Verkaar et al., 2004). The resulting sequences were aligned using Clustal W, and a phylogenetic tree was constructed using the Neighbor-Joining method in MEGA11 software (Tamura et al., 2021).
Determination of Genetic Relationships Between Cattle Populations
An investigation into the genetic relationships among different cattle populations was conducted by assessing the sequence polymorphisms of the mitochondrial D-loop region. This analysis utilized the Tamura and Nei method (1993). A phylogenetic tree for the An Giang Vang cattle was created using 240 base pairs of mtDNA derived from 127 sequences, which comprised 30 sequences from An Giang Vang cattle and 97 sequences from native cattle found in South Asian nations, China, Southeast Asia, and India. The regions represented include Bhutan (Chen et al., 2010; Lin et al., 2007), Nepal (Takeda et al., 2004; Fujise et al., 2003), Bangladesh (Bhuiyan et al., 2007), India (Chen et al., 2010), Pakistan (Chen et al., 2010), China (Lei et al., 2006), Myanmar (Chen et al., 2010), Cambodia (Chen et al., 2010), Laos (Chen et al., 2010), and Vietnam (Chen et al., 2010). The construction of the tree was performed using the Neighbor-Joining (NJ) method via MEGA11 software (Tamura et al., 2021).
Genetic relationships between populations were identified by evaluating the SRY gene sequence polymorphisms of the An Giang Vang cattle and exotic cattle populations by referencing sequences from Genbank DQ336526 (Bos taurus), DQ336527 (Bos indicus), and DQ336528 (Bos javanicus) (Namikawa et al., 1983).
Identification of Functional Genotypes
To genotype the functional genes DGAT1, NCAPG, and RNF212, amplification was performed using the primer pairs listed in Table 1. Genotyping was conducted through PCR-RFLP utilizing the restriction enzymes EaeI, Tsp509I, and AlwI, in accordance with the methodologies outlined by Grisart et al. (2002); Eberlein et al. (2009); Sandor et al. (2012), respectively (Table 2). The PCR reactions occurred in 10 μl mixtures consisting of 10 ng of genomic DNA, 0.2 μM primers, 0.25 μmol/L dNTPs, 2 × PCR buffer, and 1 U of Kod FX Taq DNA polymerase (Toyobo, Osaka, Japan). The cycling conditions included 35 to 40 cycles of denaturation at 94°C for 30 to 120 seconds, the appropriate annealing temperatures as indicated in Table 1 for 30 to 60 seconds, followed by extension at 72°C for 30 to 120 seconds.
Following PCR amplification and subsequent digestion with restriction enzymes, the PCR fragments were subjected to electrophoresis on an agarose gel using TAE buffer and then stained with Gelred. For size reference, HaeIII was employed, displaying bands measured at 2,000, 1,500, 1,000, 600, 500, 400, 300, 200, and 100 bp, with visualization achieved via a UV transilluminator. Allele and genotype frequencies were determined in accordance with the Hardy-Weinberg equilibrium (HWE) principle, calculating the variance between expected and observed values (p = P + H/2, q = Q + H/2), where p and q represent allele frequencies (Mader, 2001; Dino et al., 2018; Le et al., 2018).
The key research question of this study aims to investigate: What genetic diversity and phylogenetic relationships characterize the Vang cattle population in An Giang? Additionally, how do gene polymorphisms correlate with significant economic traits such as meat production, milk quality, and fertility?
RESULTS AND DISCUSSION
mtDNA Haplotype Diversity in An Giang Vang Cattle
To evaluate the genetic diversity of mtDNA haplotypes, the Vang cattle samples were sequenced for the nucleotides of the D-loop region. Analysis of 240 bp mtDNA, from position 16023-16262. The results in Table 3 show that these cattle possess twelve nucleotide polymorphisms and seven haplotype groups (haplogroups) consisting of I1, I2, and five haplotypes belonging to I1. The nucleotide sequences of these five haplotypes have only one nucleotide substitution from haplotype I1, and therefore they are classified into group I1 (Figure 1) and are tentatively named: I1.V.NH1, I1.V.NH2, I1.V.NH3, I1.V.NH4, and I1.V.NH5. All these seven haplotypes were similar to the Bos indicus sequence, and were submitted to GenBank with accession numbers from OR449742 to OR449747 and OR449752. Nearly all mtDNA sequences from Bos taurus fall under the macro-haplogroup T, which comprises six sub-haplogroups: T (originating from the Near East), T1 (originating from Africa), T2 (also originating from the Near East), T3 (originating from both the Near East and Europe), T4 (originating from East Asia), and T5 (Troy et al., 2001; Mannen et al., 2004; Achilli et al., 2009). In contrast, all Bos indicus mtDNA sequences group together within macro-haplogroup I, which can be further categorized into two sub-haplogroups: I1 (based in the Indus Valley) and I2 (Chen et al., 2010). When compared with the standard reference sequence V00654 (Bos indicus), the D-loop mtDNA region in Vang cattle had twelve substitution polymorphisms (G < - > A); and (C < - > T); there were seventeen Vang cattle individuals with mtDNA carrying the same genetic pattern as the reference sequence; 7 individuals (I1.V.NH1) had the same genetic pattern as the I1- 49; 2 individuals had the I1-2 haplotype; 1 cattle had mtDNA carrying the same genetic pattern as I2 (I2-28); and 3 individuals I1.V.ANH3, I1.V.ANH4, and I1.V.ANH5 carrying the haplotype belonging to I1, in which I1.V.ANH5 is a new haplotype and has not been observed in cattle breeds (accession numbers OR449752). This result suggests that An Giang Vang cattle belong to the Bos indicus I1 group.
Table 3: mtDNA haplotype diversity of Vang cattle.
|
Nucleotide position |
|||||||||||||
|
1 |
1 |
1 |
1 |
1 |
1 |
1 |
1 |
1 |
1 |
1 |
1 |
||
|
6 |
6 |
6 |
6 |
6 |
6 |
6 |
6 |
6 |
6 |
6 |
6 |
||
|
Cattle Haplotype |
0 |
0 |
0 |
0 |
0 |
0 |
0 |
0 |
1 |
1 |
2 |
2 |
|
|
4 |
5 |
5 |
5 |
5 |
7 |
8 |
8 |
1 |
4 |
3 |
3 |
||
|
|
9 |
0 |
1 |
6 |
7 |
4 |
4 |
5 |
0 |
1 |
0 |
3 |
|
|
L27733a |
I1 |
T |
C |
T |
A |
A |
C |
T |
T |
C |
T |
G |
C |
|
V00654b |
T3 |
C |
C |
T |
A |
G |
T |
C |
T |
C |
T |
A |
C |
|
Vang cattle(n=17) |
I1 |
. |
. |
. |
. |
. |
. |
. |
. |
. |
. |
. |
. |
|
Vang cattle (n=7) |
I1.V.NH1c |
. |
. |
. |
. |
. |
. |
. |
. |
. |
. |
. |
T |
|
Vang cattle (n=1) |
I1.V.NH2c |
. |
. |
. |
. |
. |
. |
. |
. |
. |
. |
C |
. |
|
Vang cattle (n=2) |
I1.V.NH3c |
. |
. |
. |
. |
. |
. |
. |
. |
T |
. |
. |
. |
|
Vang cattle (n=1) |
I1.V.NH4c |
. |
. |
. |
. |
G |
. |
. |
. |
. |
. |
. |
. |
|
Vang cattle (n=1) |
I1.V.NH5c |
. |
. |
. |
G |
. |
. |
. |
. |
. |
. |
. |
. |
|
Vang cattle (n=1) |
I2 |
. |
. |
. |
. |
. |
. |
C |
C |
. |
C |
. |
T |
aBos taurus; b Bos indicus; cVang haplotype.
Okuda et al. (2017) analyzed 27 mtDNA samples from Laotian native cattle, and the results also found only 3 haplogroups belonging to I1, no new haplotypes, and no haplotypes belonging to the Bos taurus group. Moreover, analyzing 28 mtDNA samples from Pesisir native cattle in Indonesia, Dino et al. (2018) presented that there was 1 haplotype I2, and 1 out of 5 haplotypes were new, all belonging to group I1 of Bos indicus. The results of the study of Yellow cattle in Vietnam (Le et al., 2018) suggested that this Yellow cattle population belongs to the Bos Indicus I1 group. In Ha Giang Province of Vietnam, Berthouly et al. (2010) also reported that the Ha Giang indigenous cattle population (H’mong cattle) belongs to the taurine-zebu group. Most of the I2 haplotype occurred in Southeast Asia with very low rates, as shown not only in the above studies but also in studies by Dino et al. (2018); Le et al. (2018); Xia et al. (2019). Therefore, Chen et al. (2010) suggested that the near absence of the I2 group in Southeast Asia may be due to the later introduction of this group into the domestic cattle group in the country and possibly because the culture at that time prevented the spread of the I2 group. The later scattered appearance of I2 in the region may be explained by trade exchange.
As a result, the analysis of the An Giang Vang cattle in this study identified seven haplogroups, classified into groups I1, I2, and a novel haplotype. Their relative frequencies exceed those documented in previous research performed in Laos, Japan, Indonesia, and Vietnam (Mannen et al., 2000; Mannen et al., 2017; Dino et al., 2018; Le et al., 2018, respectively). This finding suggests that the An Giang Vang cattle population exhibits a significant level of genetic diversity within its maternal lineage.
Diversity of SRY Haplotype in Vang Cattle
We also identified the Y chromosomal haplotype of the An Giang Vang cattle by sequencing a 1,062 bp fragment of the SRY gene found on the Y chromosome. In their study on the Y-chromosomal haplotypes among cattle, Nijman et al. (2008) categorized these haplotypes into three groups: Bos taurus, Bos indicus, and Southeast Asian Banteng-Bos javanicus, based on five SNPs within this region. As outlined in Table 4, all fifteen male cattle displayed a unique haplotype defined by 10 polymorphic positions. Of these, seven nucleotide positions matched the haplotype nucleotide sequences in Bos indicus, while the other seven were aligned with the haplotype nucleotide sequences of Bos javanicus, with no representation of the Bos taurus haplotype. This Vang haplotype has been provisionally designated as VAGY. Genetic studies on local breeds of Indonesian native cattle have revealed that there is gene flow from Banteng into several of these breeds (Namikawa et al., 1983; Nijman et al., 2003; Tanaka et al., 2011; Mohamad et al., 2012). Conversely, other research indicates that male cattle in Indonesia and Vietnam display zebu traits (Dino et al., 2018; Le et al., 2018), with a limited occurrence of Bos taurus type also noted in Vietnam (Le et al., 2018). These findings suggest a possible paternal gene flow from Banteng into Vang cattle. Consequently, the examination of mtDNA gene nucleotypes and polymorphisms of the Y chromosome SRY gene revealed that An Giang Vang cattle are derived from zebu cattle on both the maternal and paternal sides. Notably, the paternal lineage may represent a hybrid of Southeast Asian wild cattle and zebu cattle, offering valuable insights into the origin and historical development of An Giang Vang cattle in Vietnam.
Table 4: Haplotype diversity of the SRY gene in Vang cattle.
|
Haplotype |
Nucleotide position |
|||||||||
|
1 |
1 |
2 |
2 |
2 |
2 |
2 |
2 |
2 |
2 |
|
|
7 |
7 |
0 |
0 |
1 |
1 |
2 |
2 |
3 |
3 |
|
|
0 |
9 |
1 |
5 |
0 |
1 |
2 |
3 |
0 |
1 |
|
|
7 |
0 |
8 |
9 |
3 |
6 |
9 |
8 |
7 |
4 |
|
|
AB0397481 |
G |
T |
A |
C |
T |
A |
A |
C |
C |
C |
|
AY0791452 |
T |
C |
A |
T |
T |
G |
G |
T |
T |
T |
|
AY0791463 |
T |
T |
G |
C |
C |
A |
A |
T |
T |
T |
|
(VAGY4, (n=15) |
T |
T |
A |
T |
T |
A |
A |
T |
T |
T |
1Bos taurus; 2Bos indicus; 3Bos javanicus; 4An Giang Vang cattle.
Table 5: Allele frequencies and genotypes associated with economic traits.
|
Gene |
n |
Genotpye |
Allele frequency |
Chi-square values |
|||
|
DGAT1 |
30 |
K/K |
K/A |
A/A |
K |
A |
|
|
27 |
3 |
0 |
0.95 |
0.05 |
0.77 |
||
|
NCAPG |
30 |
T/T |
G/T |
G/G |
T |
G |
|
|
30 |
0 |
0 |
1 |
0 |
NA |
||
|
RNF212 |
30 |
CC |
CT |
TT |
C |
T |
|
|
30 |
0 |
0 |
1 |
0 |
NA |
||
NA: Not applicable; does not follow Hardy- Weinberg equilibrium.
Polymorphism of Genes Associated with Economic Traits
We then investigated the genetic polymorphisms linked to specific economic traits in cattle, focusing on the DGAT1 gene, which influences milk fatty acid composition. The K allele of this gene is associated with increased fat content (Grisart et al., 2002). We also examined the NCAPG gene, known for its connection to carcass weight, where the G allele enhances carcass weight (Eberlein et al., 2009). Additionally, we looked at the RNF212 gene, crucial for regulating crossover during meiotic recombination; the T allele of RNF212 is recognized for boosting the meiotic recombination rate in cattle (Reynolds et al., 2013; Qiao et al., 2014). According to the data presented in Table 5, the distribution of the genotypes KK and KA within the DGAT1 gene shows 27 and 3 individuals, respectively, highlighting the presence of both K and A alleles in the An Giang Vang cattle population. In a study examining 27 local cattle samples from Laos and 30 samples of Central Vietnam Yellow cattle, it was found that all cattle in these two regions displayed a single genotype, KK (Okuda et al., 2017; Le et al., 2018). As a result, allele A of the DGAT1 gene was identified in the An Giang Vang cattle population, indicating a low-frequency polymorphism for this gene (A = 0.05).
The NCAPG I442M is a mutation that replaces T with G at position g.38245413 (exon 9) and changes the amino acid isoleucine to methionine at position 442 of the NCAPG protein (Setoguchi et al., 2011). In this study, the analysis of NCAPG gene polymorphism by the PCR-RFLP method showed that there was only one genotype, TT, proving that the NCAPG I442M gene does not show polymorphism in this cattle population. It means that this population has not detected the T > G substitution mutation related to carcass weight. This result is similar to the result of Okuda et al. (2017) where 100% of the research samples had the TT genotype. Thus, there is no presence of the G allele of the NCAPG gene in the An Giang Vang cattle population, meaning there is no polymorphism in this gene.
Furthermore, the RNF212 P259S mutation involves a C to T substitution at genetic position g.118327636 on Chromosome 6 (NC_032655.1), leading to a change from proline to serine at position 259 within the RNF212 protein. This specific mutation results in an elevation of the meiotic recombination rate in cattle. Given that meiotic recombination rate directly influences reproductive efficiency, this mutation could serve as a significant marker associated with enhanced fertility in cattle, as highlighted by studies (Sandor et al., 2012; Kadri et al., 2016). To identify the presence of the C > T mutation at position g.118327636 (located in exon 12) within the analyzed samples, we opted for the use of the restriction enzyme AlwI. This selection was based on the screening outcomes from the NEBcutter V2.0 tool (New England Biolabs; http://nc2.neb.com/NEBcutter2/), which identified AlwI as a suitable enzyme capable of recognizing and cleaving at the specific mutation site. The PCR-RFLP analysis results of the RNF212 genotype indicated the presence of solely one CC genotype, indicating the absence of polymorphism in the cattle population for the RNF212 gene. Consequently, the specific C > T substitution mutation linked to enhanced fertility in An Giang Vang cattle was not identified.
The genotype analysis results of Vang cattle revealed the presence of the milk fat ratio gene polymorphism, specifically linked to DGAT1. These gene variations are associated with distinct characteristics in beef and dairy cattle of the Bos taurus species. However, information on the distribution of these genetic variations within the Zebu group remains limited. Previous studies have highlighted notable variations in allele frequencies of genes between Bos taurus and Zebu cattle populations, as documented in studies by Kaneda et al. (2011); Yonesaka et al. (2016); Okuda et al. (2017). Our research indicates the presence of DGAT1 gene polymorphisms in the An Giang Vang cattle population, mirroring findings from studies on taurine cattle.
So far, studies have indicated minimal variation in the NCAPG gene among Zebu cattle. Interestingly, the G allele of this gene was found to be absent in the An Giang Vang cattle population in this research. Despite displaying genetic diversity in genes linked to milk fat quality characteristics, the An Giang cattle do not exhibit diversity in genes associated with meiotic recombination crossover regulation or enhancing carcass weight. Consequently, An Giang Vang cattle in this study showed polymorphisms in genes related to milk fat quality. They did not show polymorphisms in genes related to high fertility and increased carcass weight. Therefore, it is possible that their small size and low carcass rate are due to the fact that they do not carry the G allele in the population. Therefore, the results of this study can be used as a reference in improving the Vang cattle breed in the direction of improving milk quality, which will be more feasible. However, the number of observed samples in this study is quite modest, which may have certain limitations.
CONCLUSIONS AND RECOMMENdATIONS
An investigation into mitochondrial DNA, SRY haplotype diversity, and genotypes of functional genes revealed that An Giang Vang cattle possess considerable genetic diversity inherited from Bos indicus cattle through both maternal and paternal lineages. The paternal lineage may be a hybrid derived from Bos javanicus and zebu cattle, along with the presence of beneficial alleles for economically significant traits. This study represents the first detailed genetic characterization of An Giang Vang cattle utilizing molecular markers, which may provide valuable insights for the future conservation and breeding of this breed. Nonetheless, it is important to note that the sample size for the Vang cattle population in this research was relatively small, which may impose certain limitations.
ACKNOWLEDGEMENTS
The research is funded by Vietnam National University HoChiMinh City (VNU-HCM) under grant number C2023-16-16.
NOVELTY STATEMENT
It is possible to evaluate population genetic diversity and select milk trait in the Vang cattle herd based on these molecular markers.
AUTHOR’S CONTRIBUTIONS
Nguyen Ba Trung: Conceived, designed, performed the experiments, and analyzed the data.
Nguyen Ba Trung and Pham Thi Kim Phuong: Wrote the paper, all authors collected the samples, reviewed, and approved the final manuscript.
Conflict of Interest
We certify that there is no conflict of interest.
REFERENCES
Achilli A, Bonfiglio S, Olivieri A, Malusà A, Pala M (2009). The Multifaceted Origin of Taurine Cattle Reflected by the Mitochondrial Genome. PLOS ONE 4(6): e5753. https://doi.org/10.1371/journal.pone.0005753
Barker (1998). Phenol-Chloroform Isoamyl Alcohol (PCI) DNA Extraction
Berthouly C, Maillard JC, Doan LP, Van TN, Bed B, Leroy G, Thanh HH, Laloë D, Bruneau N, Chi CV, Dang VN, Verrier E, Rognon X (2010). Revealing fine scale subpopulation structure in the Vietnamese H’mong cattle breed for conservation purposes. BMC Genetics, 11: 45. https://bmcgenomdata.biomedcentral.com/articles/10.1186/1471-2156-11-45
Bhuiyan M, Bhuiyan A, Yoon D, Jeon J, Park C, Lee J (2007). Mitochondrial DNA Diversity and Origin of Red Chittagong Cattle. Asian-Aust. J. Ani. Sci., 20: 1478-84. https://doi.org/10.5713/ajas.2007.1478
Cardoso DF, de Souza FR, de Camargo GM, Fonseca PD, Fonseca LF, Braz CU, Boligon AA, Mercadante ME, de Albuquerque LG, Tonhati H (2014). Polymorphism analysis in genes of the somatotropic axis in Nellore cattle selected for growth. Gene, 545(2): 215-219. https://doi.org/10.1016/j.gene.2014.05.033
Chen S, Lin B, Baig M, Mitra B, Lopes R, Santos A, Beja A (2010). Zebu cattle are an exclusive legacy of the South Asia neolithic. Mol. Biol. Evo., 27: 1-6. https://doi.org/10.1093/molbev/msp213.
Dino E, Ripon C, Le Nu Anh Thu, Okuda Y, Yurnalis T, Kunieda T (2018). Genetic characterization of Indonesian Pesisir cattle using mitochondrial DNA and Y-chromosomal haplotypes and loci associated with economical traits and coat color. J. Anim. Genet., 46: 17-23. https://doi.org/10.5924/abgri.46.17.
Eberlein A, Takasuga A, Setoguchi K, Pfuhl R, Flisikowski K, Fries R, Kühn C (2009). Dissection of genetic factors modulating fetal growth in cattle indicates a substantial role of the Non‐SMC condensin I complex, subunit G (NCAPG) gene. Genetics, 183(3): 951-964. https://doi.org/10.1534/genetics.109.106476
Edwards J, Baird F, MacHugh E (2007). Taurine and zebu admixture in Near Eastern cattle: a comparison of mitochondrial, autosomal and Y-chromosomal data. Anim. Genet., 38(5): 520-524. https://doi.org/10.1111/j.1365-2052.2007.01638.x
Fujise H, Murakami M, Devkota B, Dhakal I, Takeda K, Hanada H, Fujitani H, Sasaki M, Kobayashi K (2003). Breeding distribution and maternal genetic lineages in Lulu, a dwarf cattle population in Nepal. Ani.Sci. J., 74: 1-5. https://doi.org/10.1046/j.1344-3941.2003.00078.x
Grisart B, Coppieters W, Farnir F, Karim L, Ford C (2002). Positional candidate cloning of a QTL in dairy cattle: Identi cation of a missense mutation in the bovine DGAT gene with major effect on milk yield and composition. Genome Res., 12: 222-231. https://doi.org/10.1101/gr.224202
Hoang Kim Giao (2009). Atlas of Vietnam animal husbandry. Minist. Agric. Rural Dev., 68. https://www.angrin.tlri.gov.tw/english/Vietnam/viet%20nam.pdf
Hoashi S, Ashida N, Ohsaki H, Utsugi T, Sasazaki S, Taniguchi M, Mannen H (2007). Genotype of bovine sterol regulatory element binding protein‐1 (SREBP‐1) is associated with fatty acid composition in Japanese Black cattle. Mammalian Genome, 18(12): 880-886. https://doi.org/10.1007/s00335-007-9072-y
Huyen Le Thi, Karen M (2020). Animal breeding. Int. Liv. Res. Ins. (ILRI), 3-4. https://hdl.handle.net/10568/113157
Kadri N, Harland C, Faux P, Cambisano N, Karim L, Coppieters W, Druet T (2016). Coding and noncoding variants in HFM1, MLH3, MSH4, MSH5, RNF212, and RNF212B affect recombination rate in cattle. Genome Res., 26(10): 1323-1332. https://doi: 10.1101/gr.204214.116
Kaneda M, Lin BZ, Sasazaki S, Oyama K, Mannen H (2011). Allele frequencies of gene polymorphisms related to economic traits in Bos taurus and Bos indicus cattle breeds. Anim. Sci. J., 82: 717-721. https://doi.org/10.1111/j.1740-0929.2011.00910.x
Kong A, Thorleifsson G, Stefansson H, Masson G, Helgason A, Jonsdottir M, Sverrisson S, Theodora T, Jonasdottir P, Stefan H, Stefansson K (2008). Sequence Variants in the RNF212 Gene Associate with Genome-Wide Recombination Rate. Science, 319(5868): 1398-1401. https://doi.org/10.1126/science.1152422
Lei C, Chen H, Zhang H, Cai X, Liu R, Luo L, Wang C, Zhang W, Ge Q, Zhang R, Lan X, Sun W (2006). Origin and phylogeographical structure of Chinese cattle. Ani. Gen., 37: 579-82. https://doi.org/10.1111/j.1365-2052.2006.01524.x
Le Th, Hai Vu, Yu O, Huong D, Trung Ba N, Van N, Phung L, Tetsuo K (2018). Genetic characterization of Vietnamese Yellow cattle using mitochondrial DNA and Ychromosomal haplotypes and genes associated with economical traits. Anim. Sci. J., 45: 609-10. https://doi.org/10.1111/asj.13099
Lin B, Odahara S, Sasazaki S, Yamamoto Y, Namikawa T, Tanaka K, Dorji T, Tshering G, Mukai F, Mannen H (2007). Genetic diversity of Bhutanese Cattle analyzed by mitochondrial DNA variation. J. Ani.Gen., 35: 5-10. https://doi.org/10.5924/abgri2000.35.5
Lindholm-Perry AK, Kuehn LA, Oliver WT, Sexten AK, Miles JR, Rempel LA, Freetly HC (2013). Adipose and muscle tissue gene expression of two genes (NCAPG and LCORL) located in a chromosomal region associated with cattle feed intake and gain. PLoS ONE, 8(11): 1-7. https://doi.org/10.1371/journal.pone.0080882
Loftus R, MacHugh D, Bradley D, Sharp P, Cunningham P (1994). Evidence for two independent domestications of cattle. Pro. Nat. Aca. Sci., 91: 2757-61. https://doi.org/10.1073/pnas.91.7.2757
Mader Sylvia S (2001). Biology (10th ed.). New York, NY: McGraw-Hill. 285-286. http://www.khanacademy.org/science/biology/v/hardy-weinberg-principle
Mannen H, Koumoto M, Tsuji S, Kurosawa Y, Nishibori M, Yamamoto Y, Okada Y, Kuroiwa A, Yamagata T, Namikawa T, Kiao K, Siksidao P, Thongsay, Phet P, Bouahom B (2000). Mitochondrial DNA variation and phylogenetic analysis of Laos native cattle. Rep. Soc. Res. Native Livestock, 18: 59-64.
Mannen H, Kohno M, Nagata Y, Tsuji S, Bradley DG, Yeo JS, Nyamsamba D, Zagdsuren Y, Yokohama M, Nomura K, Amano T (2004). Independent mitochondrial origin and historical genetic differentiation in North Eastern Asian cattle. Mol. Phylogenet. Evol., 32(2): 539-544. https://doi.org/10.1016/j.ympev.2004.01.010
Mannen H, Yonesaka R, Noda A, Shimogiri T, Oshima I, Katahira K, Sasazaki S (2017). Low mitochondrial DNA diversity of Japanese polled and kuchinoshima feral cattle. Anim. Sci. J., 88(5): 739-744. https://doi.org/10.1111/asj.12716
Mohamad K, Olsson M, Andersson G, Purwantara B, van Tol T, Rodriguez-Martinez H, Colenbrander B, Lenstra A (2012). The origin of Indonesian cattle and conservation genetics of the Bali cattle breed. Reproduction in domestic animals = Zuchthygiene, 47 1: 18-20. https://doi.org/10.1111/j.1439-0531.2011.01960.x
Namikawa T, Amano T, Takeaka O (1983). Studies on the blood groups and biochemical polymorphisms in the types of cattle and the Bantengs in Indonesia. Rep. Soc. Res. on Native Liv., 10: 68-81.
Nishimaki T, Ibi T, Siqintuya, Kobayashi N, Matsuhashi T, Akiyama T, Yoshida E, Imai K, Matsui M, Uemura K, Eto H, Watanabe N, Fujita T, Saito Y, Komatsu T, Hoshiba H, Mannen H, Sasazaki S, Kunieda T (2016). Allelic frequencies and association with carcass traits of six genes in local subpopulations of Japanese Black cattle. Anim. Sci. J., 87: 469-476. https://doi.org/10.1111/asj.12453
Nijman IJ, Otsen M, Verkaar EL, de Ruijter C, Hanekamp E, Ochieng JW, Shamshad S, Rege JE, Hanotte O, Barwegen MW, Sulawati T, Lenstra JA (2003). Hybridization of banteng (Bos javanicus) and zebu (Bos indicus) revealed by mitochondrial DNA, satellite DNA, AFLP and microsatellites. Heredity, 90: 10-16. https://doi.org/10.1038/sj.hdy.6800174
Nijman IJ, Van Boxtel DC, Van Cann LM, Yindee M, Cuppen E and Lenstra J (2008). Phylogeny of Y chromosomes from bovine species. Cladistics, 24, 723-726. https://doi.org/10.1111/j.1096-0031.2008.00201.x
Okuda Y, Kanii T, Yamamoto Y, Kounnavongsa B, Keonouchanh S, Bouahom B, Kunieda T (2017). Genetic characterization of Laotian native cattle using mtDNA haplotype and loci associated with economical traits, coat color, and a hereditary disorder. The J. Anim. Genet., 45(2): 43-48. https://doi.org/10.5924/abgri.45.43
Pham L, Do D Binh N, Nam L, Van Ba N, Thuy T, Kadarmideen H (2013). Assessment of genetic diversity and population structure of Vietnamese indigenous cattle populations by microsatellites. Livestock Sci., 155(1): 17-22. https://doi.org/10.1016/j.livsci.2013.04.006
Qiao H, Prasada Rao HBD, Yang Y, Fong JH, Cloutier JM, Deacon DC, Nagel KE, Swartz RK, Strong E, Holloway JK, Cohen PE, Schimenti J, Ward J, Hunter (2014). Antagonistic Roles of Ubiquitin Ligase HEI10 and SUMO Ligase RNF212 Regulate Meiotic Recombination. Nat. Genet., 46: 194-199. https://doi.org/10.1038/ng.2858
Reynolds A, Qiao H, Yang Y (2013). RNF212 is a dosage-sensitive regulator of crossing-over during mammalian meiosis. Nat. Genet., 45: 269-278. https://doi.org/10.1038/ng.2541
Ripoli MV, Corva P, Giovambattista G (2006). Analysis of a polymorphism in the DGAT1 gene in 14 cattle breeds through PCR-SSCP methods. Res. Vet. Sci., 80(3): 287-290. https://doi.org/10.1016/j.rvsc.2005.07.006
Sandor C, Li W, Coppieters W, Druet T, Charlier C, Georges M (2012). Genetic Variants in REC8, RNF212, and PRDM9 Influence Male Recombination in Cattle. PLoS Genet., 8: e1002854. https://doi.org/10.1371/journal.pgen.1002854
Setoguchi K, Watanabe T, Weikard R, Albrecht E, Kühn C, Kinoshita A, Takasuga A (2011). The SNP c.1326T>G in the non-SMC condensin i complex, subunit G (NCAPG) gene encoding a p.Ile442Met variant is associated with an increase in body frame size at puberty in cattle. Anim. Genet., 42(6): 650-655. https://doi.org/10.1111/j.1365-2052.2011.02196.x
Syed-Shabthar M, Rosli K, Mohd-Zin A, Romaino M, Fazly-Ann A, Mahani C, Abas-Mazni O, Zainuddin R, Yaakop S, Md-Zain M (2013). The molecular phylogenetic signature of Bali cattle revealed by maternal and paternal markers. Mol. Biol. Rep., 40(8): 5165-5176. https://doi.org/10.1007/s11033-013-2619-y
Takeda K, Satoh M, Neopane S, Kuwar B, Joshi H, Shrestha N, Fujise H, Tasai M, Tagami T, Hanada H (2004). Mitochondrial DNA analysis of Nepalese domestic dwarf cattle Lulu. Ani. Sci. J., 75: 103-10. https://doi.org/10.1111/j.1740-0929.2004.00163.x
Tanaka K, Takizawa T, Dorji T, Amano T, Mannen H, Maeda Y, Yamamoto Y, Namikawa T (2011). Polymorphisms in the bovine hemoglobin-beta gene provide evidence for gene-flow between wild species of Bos (Bibos) and domestic cattle in Southeast Asia. Ani.Sci. J., 82: 36-45. https://doi.org/10.1111/j.1740-0929.2010.00808.x
Tamura K, Stecher G, Kumar S (2021). MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol., 38(7): 3022-3027. https://doi.org/10.1093/molbev/msab120
Tamura K, Nei M (1993). Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol., 10(3): 512-526. https://doi.org/10.1093/oxfordjournals.molbev.a040023
Troy C, MacHugh D, Bailey J, Magee D, Loftus R, Cunningham P, Chamberlain A, Sykes B, Bradley, D (2001). Genetic evidence for Near-Eastern origins of European cattle. Nature, 410(6832): 1088-1091. https://doi.org/10.1038/35074088
Verkaar EL, Vervaecke H, Roden C, Romero Mendoza L,mBarwegen MW, Susilawati T, Nijman IJ, Lenstra JA (2003). Paternally inherited markers in bovine hybrid populations. Heredity, 91: 565-569. https://doi.org/10.1038/sj.hdy.6800359
Verkaar C, Nijman J, Beeke M, Hanekamp E, Lenstra A (2004). Maternal and paternal lineages in cross‐breeding bovine species. Has Wisent a Hybrid Origin?, 21(7): 1165-1170. https://doi.org/10.1093/molbev/msh064
Xia X, Qu K, Zhang G, Jia Y, Ma Z, Zhao X, Huang Y, Chen H, Huang B, Lei C (2019). Comprehensive analysis of the mitochondrial DNA diversity in Chinese cattle. Anim. Genet., 50(1): 70-73. https://doi.org/10.1111/age.12749
Yamada T, Itoh, M, Nishimura S, Taniguchi Y, Miyake T, Sasaki S, Sasaki Y (2008). Association of single nucleotide polymorphisms in the endothelial differentiation sphingolipid G‐protein‐coupled receptor 1 gene with marbling in Japanese Black beef cattle. Anim. Genet., 40: 209-216. https://doi.org/10.1111/j.1365-2052.2008.01822.x
Yonesaka R, Sasazaki S, Yasue H, Niwata S, Inayoshi Y, Mukai F, Mannen H (2016). Genetic structure and relationships of 16 Asian and European cattle populations using DigiTag2 assay. Anim. Sci. j. Nihon chikusan Gakkaiho, 87(2): 190-196. https://doi.org/10.1111/asj.12416