Monitoring and Molecular Detection of Toxoplasma gondii in Food: Vegetables, Fruits, and Fish as Neglected Vehicles for Toxoplasmosis in the Nile Delta of Egypt

Walid Elmonir1*, Ahmed Abdel-Fattah Tayel2, Suzan Abdelbaky Kotb1 and Wael Fawzy El-Tras2

1Department of Hygiene and Preventive Medicine, (Zoonoses), Faculty of Veterinary Medicine, Kafrelsheikh University, Kafrelsheikh, Egypt.

2Faculty of Aquatic and Fisheries Sciences, Kafrelsheikh University, Kafrelsheikh, Egypt

ABSTRACT

This study was conducted in the Nile Delta, Egypt, to investigate the role of vegetables, fruits, and fish as a source of Toxoplasma gondii and to determine effective decontamination approaches. A total of 200 agricultural produce samples (50 per each of carrots, radishes, lettuces, and strawberries) and 315 fish samples (200 Mullet and 115 Tilapia) were collected. The T. gondii were identified in these samples by microscopy and molecular analysis. In total, 9% (18/200) of agricultural produce samples had Toxoplasma oocysts. T. gondii was detected in 14% of carrots, 12% of radishes, 4% of lettuces, and 6% of strawberries. There was no significant difference in prevalence of T. gondii between different fresh produce type (P value= 0.1 – 0.6). T. gondii was not detected in any fish samples. Two agriculture produce (1 carrot and 1 strawberry) samples were misdiagnosed by microscopic analysis, which emphasized the importance of molecular detection of Toxoplasma oocysts in environmental samples. To our knowledge, this is the first molecular detection of T. gondii oocysts in vegetables, and fruits in Egypt. Awareness of public and health professionals about these neglected vehicles of toxoplasmosis is urgently required.


Article Information

Received 02 August 2022

Revised 26 September 2022

Accepted 23 October 2022

Available online 25 May 2023

(early access)

Published 31 October 2024

Authors’ Contribution

WE, AAT, and WFT designed the study. SAK collected the samples. SAK, WE and AAT conducted the experimental work. WE analyzed the data. All authors wrote, reviewed and agreed to publish the manuscript.

Key words

Toxoplasma gondii, Molecular detection, Vegetables and fruits, Fish, Egypt

DOI: https://dx.doi.org/10.17582/journal.pjz/20220802150800

* Corresponding author: [email protected]

0030-9923/2024/0006-2845 $ 9.00/00

Copyright 2024 by the authors. Licensee Zoological Society of Pakistan.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).



INTRODUCTION

Toxoplasmosis is a common zoonotic disease caused by Toxoplasma gondii, a protozoan that is widely spread among animals and humans thoughout the world (Dumètre and Dardé, 2003; WHO, 2015), including Egypt (Al-Kappany et al., 2010; Elmonir et al., 2017). Toxoplasmosis is generally asymptomatic, but severe outcomes may occur in pregnant women after congenital transmission (e.g., abortions, fetal handicapping) and immunocompromised patients (e.g., those with CNS diseases) (WHO, 2015).

The ingestion of sporulated oocysts comprises an important mode of Toxoplasma transmission to humans (Shapiro et al., 2019). Recently, there has been increasing evidence indicating that people may pick up the oocysts by eating untreated vegetables and fruits (Ekman et al., 2012; Shapiro et al., 2019). Toxoplasma oocysts were recovered from these food vehicles at rates ranging from 0.3% to 9.7% (Lass et al., 2012, 2019; Lalonde and Gajadhar, 2016). The vegetables, and fruits may be contaminated with T. gondii oocysts by cat feces either directly or indirectly though contaminated soil in agriculture fields (Shapiro et al., 2019). Sporulated oocysts can survive for up to 18 months in soil under variable ambient temperature (Dumètre and Dardé, 2003; Dubey, 2004). This robustness of Toxoplasma oocysts combined with their hydrophilic and low adhesive nature facilitate their survival and easy dispersion between fresh produce vehicles and also humans or animals that may consume or contact these vehicles.

T. gondii has long been considered a global parasite infecting substantially all warm-blooded animals. Sporadically, cold-blooded animals such as fish may be infected with this parasite (Nayeri et al., 2021). In vitro studies on tissue cells of cold-blooded animals showed that they could be infected by T. gondii at 37°C (Omata et al., 2005). Additionally, in vivo injection of T. gondii oocysts intra-peritoneally in zebrafish resulted in the multiplication of tachyzoites in various tissues including heart, liver, spleen, brain, and blood vessel, with histological and pathological changes similar to that found in acute toxoplasmosis in mammals (Sanders et al., 2015). T. gondii parasite was detected molecularly at various rates (0.08% - 21.7%) in naturally exposed edible freshwater fish (Zhang et al., 2014; Aakool and Abidali, 2016) and marine fish (Marino et al., 2019) worldwide. In positive fish samples, T. gondi DNA was detected in GIT content, gills, and skin-muscle complex (Zhang et al., 2014; Aakool and Abidali, 2016; Marino et al., 2019). Moreover, Massie et al. (2010) confirmed the viability and infectivity of T. gondii oocysts in fish GIT content for up to 8 h by bioassay. All these aforementioned studies did not clarify whether fish can be infected naturally by T. gondii or they just act as mechanical carriers. In both cases, fish might be an under-reported source of human infection.

In Egypt, the high infection rate of T. gondii in cats (Al-Kappany et al., 2010; Elmonir et al., 2017) and the insufficient control of stray cats that can easily access agriculture fields may contribute to the high environmental contamination level of T. gondii. Furthermore, most of the physicians and researchers in Egypt focus on direct contact with cats and consumption of undercooked meat of infected animals as the possible routes of T. gondii infection. Hence, the role of vegetables, fruits, and fish in transmitting this disease still remains neglected in Egypt. Therefore, this study aimed to assess the role of vegetables, fruits, and fish as neglected vehicles of T. gondii transmission in Egypt, and to compare the efficiency of the identification methods of T. gondii oocysts in these vehicles.

MATERIALS AND METHODS

Vegetables and fruits

A total of 200 vegetable and fruit samples (50 strawberries, 50 carrots, 50 radishes, and 50 lettuces) were collected from farms and gardens located in 13 villages distributed in the following thee governorates in the Nile Delta of Egypt: Menoufia (30.52°N 30.99°E; 6 villages), Kafrelsheikh (31.3°N 30.93°E; 4 villages), and Gharbia (30.87°N 31.03°E; 3 villages) (Fig. 1). Stray cats (definite host for T. gondii) had free access to all the sampled fields and gardens as noted by the authors. The amount of each sample per type of vegetable or fruit was as follows: 0.5 kg strawberries, 0.5 kg carrots, 15–20 radishes, and 3–5 lettuces. All samples were transported in plastic bags to the laboratory.

 

Fish

A total of 315 fresh fish: 115 Oreochomis niloticus (Tilapia) and 200 Mugil cephalus (Mullet) were collected from fishermen at Lake Burullus, at Kafrelsheikh governorate (30°22′–31°35′ N; 30°33′–31°08′ E). Fish samples were transferred in ice box for same-day analysis at the laboratory.

Microscopic detection of T. gondii oocyst

Each of the vegetable and fruit samples (carrot root, strawberries fruits, or leaves of radishes and lettuce) was added to fill a space of 500 ml of a glass vessel. Then, the sample was added to 1l of 1% Tween 80 in a 3-l glass vessel and mixed by shaking for 2 h at 100 rpm. The vegetables or fruits were removed, and the oocysts were recovered using the calcium carbonate flocculation method as described by Lass et al. (2012). The concentrated oocyst pellet was purified by the sucrose flotation (Villena et al., 2004). Briefly, the oocyst pellet was mixed at a 1:3 ratio in a sucrose suspension (1.15 specific gravity), and the suspension was centrifuged at 4°C for 10 min (1250 ×g). Then, 2 ml of the supernatant was transferred to 8 ml of distilled water, and centrifugation was repeated. The resulting supernatant was discarded, and the final purified oocyst pellet was separated into two parts; one part was used for microscopic examination, and the other was used for genomic DNA extraction.

For fish samples, a smear of intestinal content of each sample was examined microscopically at 100× and 400× magnifications, and T. gondii-like oocysts (9–12 µm in size) were recorded.

DNA extraction from T. gondii

For vegetables and fruits, T. gondii oocyst pellet (as mentioned in method section 2.2) was lysed by five freezing (−80°C) thawing (65°C) cycles, followed by proteinase K digestion at 60°C for 1 h. DNA extraction was conducted using the QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol.

For fish, genomic DNA was extracted from fish muscles using the DNeasy Blood and Tissue Kit and from the intestinal content using the QIAamp DNA Stool Mini Kit (Qiagen). The extraction methods followed the manufacturers’ protocol with exception of five freezing-thawing cycles, and proteinase K digestion for 1 h. at 60°C, as for vegetables and fruits.

Real-time PCR identification of T. gondii DNA

Real-time PCR identification of T. gondii was conducted using Toxo-F/Toxo-R primers (Table I) targeting the 98-bp fragment of the B1 gene of T. gondii RH strain (Lin et al., 2000). The amplification reaction mixture consisted of 10 µl SsoAdvanced Universal SYBR Green Supermix (Bio-Rad, Foster City, California), 1 µl of each primer (500 nM), 5 µl of DNA template (50–100 ng) in a final volume of 20-µl. Amplification was started by polymerase activation at 95°C for 10 min, succeeded by 40 cycles of (95°C for 15 s and 60°C) for 1 min in the iQ5 thermocycler (Bio-Rad, Foster City, California). Both positive control (T. gondii RH strain genomic DNA) and negative control (sterile distilled water) were used to confirm the efficiency of the reaction and the absence of contamination, respectively. The cycle theshold (Ct) value was determined, and samples that showed Ct values <40 were considered to be positive. All negative samples were reexamined for possible PCR inhibitors by a mixture of 2 μl of sample DNA and 1 μl of T. gondii control DNA as a template for the reaction (Lass et al., 2012). If inhibitors were present, the PCR was repeated with the addition of 8 µg of bovine serum albumin (Boehinger, Mannheim, Germany) to the amplification mixture (Villena et al., 2004).

Standard PCR detection of T. gondii DNA

PCR identification of T. gondii was conducted using the primers pairs TOXO B22/ TOXO B23 (Table I) that target a 115-bp of the B1 gene of T. gondii RH strain (Basso et al., 2007). The 25 μL PCR mixture consisted of 5 μL of DNA template (~50 ng), 12.5 μL of Emerald Amp MAX PCR Master Mix (Takara Bio, Kusatsu, Japan), 1 μL of each primer (20 pmol), and 5.5 μL sterile distilled water. The PCR cycling begins with 94°C for 7 min, succeeded by 35 cycles of (94°C for 1 min, 60°C for 1 min, and 72°C for 1 min), and a final extension for 10 min at 72°C. The PCR cycling was conducted in an Applied Biosystem thermal cycler (Applied Biosystems, Foster City, USA). The distilled water and DNA of T. gondii (RH strain) were used as negative control and positive control, respectively.

Statistical analysis

The univariate logistic regression was conducted using SPSS statistics software version 21.0. (IBM SPSS Inc., Armonk, NY, USA).

RESULTS AND DISCUSSION

The overall prevalence of T. gondii oocysts in vegetables and fruits samples was 9% (Table II). This result was consistent with the prevalence of 9.7% reported in Poland (Lass et al., 2012), but it was higher than other reports in Canada (0.26%) and China (3.6%) by Lalonde and Gajadhar (2016) and Lass et al. (2019), respectively. Cats commonly access agricultural fields and bury their feces in the soil, which may easily spread T. gondii oocysts to agricultural produce. Afonso et al. (2007) recorded that T. gondii oocysts were concentrated in the soil near cat defecation sites, and hence a greater number of oocysts are deposited in the agriculture fields (e.g., vegetables and fruits) where cats can easily access.

Carrots were the most contaminated fresh produce (14%), whereas lettuces were the least contaminated (4%), however these differences were not significant (Table III;

 

Table I. The primer used for detection of Toxoplasma DNA in different samples.

Methods

Primers

Primer sequence (5' – 3')

Product size

Real time PCR

TOXO-F/ TOXO-R

TCCCCTCTGCTGGCGAAAAGT

98 bp

AGCGTT CGTGGTCAACTATCGATTG

Standard PCR

TOXO B22/ TOXO B23

AACGGGCGAGTAGCACCTGAGGAGA

115 bp

TGGGTCTACGTCGATGGCATGACAAC

 

*The primers were purchased from Metabion (Metabion, Steinkirchen, Germany).

 

Table II. Frequency distribution of T. gondii oocysts in vegetables, fruits, and fish samples in this study.

Location*

Category

Vegetables and fruits

Fish

Carrot

Radishes

Lettuce

Strawberry

Subtotal

Kafrelsheikh

Sample No.

16

15

15

12

58

315

Positive (%)

3 (18.7)

1 (6.7)

0 (0)

1 (8.3)

5 (8.6)

0 (0)

Menoufia

Sample No.

18

19

22

38

97

-

Positive (%)

1 (5.5)

3 (15.8)

1 (4.5)

2 (5.3)

7 (7.2)

-

Gharbia

Sample No.

16

16

13

-

45

-

Positive (%)

3 (18.7)

2 (6.2)

1 (7.7)

-

6 (13.3)

-

Total

Sample No.

50

50

50

50

200

315

Positive (%)

7 (14)

6 (12)

2 (4)

3 (6)

18 (9)

0 (0)

 

*There was no significant difference between prevalence of T. gondii in different governorates at P value <0.05.

 

P value > 0.05). This may highlight that the prevalence rate of T. gondii in vegetables and fruits is more associate with rate of soil contamination by oocysts rather than type of fresh produce. Higher odds for isolation of carrots (3.9 times compared to lettuce) may be attributed to the fact that carrots are buried under the ground with a higher probability of soil contamination or due to the nature of the carrot roots that have hair-like structures that have been reported to trap Toxoplasma oocysts (Kniel et al., 2002).

 

Table III. Univariate logistic regression for association between samples type and positive molecular status of T. gondii oocysts.

Sample type

Percent

Odds

P-value

CI 95%

Lettuce

4

-

-

-

Carrots

14

3.9

0.1

0.8 - 19.8

Radishes

12

3.3

0.2

0.6 - 17.1

Strawberries

6

2.1

0.6

0.2 - 9.6

 

*Significant difference at P < 0.05; CI: Confidence Interval; Brackets: Percent.

 

A previous study in Egypt showed that around 12% of residents do not wash vegetables or fruits before consumption (Hamed and Mohammed, 2019). Consuming untreated vegetables and fruits has been reported to cause outbreaks of T. gondii illnesses elsewhere (Ekman et al., 2012) and might also contribute to several cases of asymptomatic infections (Shapiro et al., 2019). Hence, our findings may emphasize the public health risk linked to the ingestion of untreated vegetables and fruits in Egypt.

None of the fish samples (intestinal content and muscle samples) showed evidence of T. gondii infection (Table II, Fig. 2) by all diagnostic tests used in this study. In contrast, other reports detected T. gondii DNA in fish at variable rates (0.08% - 21.7%) in China (Zhang et al., 2014), Iraq (Aakool and Abidali, 2016), and Italy (Marino et al., 2019). This finding highlights the minimum role of fish in the epidemiology of toxoplasmosis in this study region.

 

Regarding the comparison of the microscopic and molecular detection methods in our study, the results revealed that two of vegetables/fruits samples were misdiagnosed and one sample was not detected by the microscopy examination (Table IV). This finding is in agreement with previous reports (Dumètre and Dardé, 2003; Shapiro et al., 2019) and highlights the importance of using molecular techniques in the identification of T. gondii oocysts in environmental samples.

CONCLUSION

In conclusion, this study highlighted that vegetables and fruits may play a role in transmitting toxoplasmosis in Egypt. To our knowledge, this is the first molecular identification of T. gondii oocysts in vegetables, and fruits in Egypt.

 

Table IV. Comparison between different diagnostic tests of T. gondii oocysts in vegetables, fruits, and fish samples in this study.

Type of sample

Positives/total samples (%)

Variance in results/ Method

Microscopic

detection

Standard PCR detection

Real-time PCR detection

Vegetables/ Fruits

Carrot

8/50 (16)

7/50 (14)

7/50 (14)

One NC-PCR

Radishes

5/50 (10)

6/50 (12)

6/50 (12)

One ND-Microscope

Lettuce

2/50 (4)

2/50 (4)

2/50 (4)

No difference

Strawberries

4/50 (8)

3/50 (6)

3/50 (6)

One NC-PCR

Subtotal

19/200 (9.5)

18/200 (9)

18/200 (9)

Two NC-PCR / One ND-Microscope

Fish

Mullet

0/200

0/200

0/200

No difference

Tilapia

0/115

0/115

0/115

No difference

Subtotal

0/315

0/315

0/315

No difference

Total

19/515 (3.7)

18/515 (3.5)

18/515 (3.5)

Two NC-PCR / One ND-Microscope

 

*NC-PCR, not confirmed by PCR; ND-Microscope, not detected by microscope.

 

It is important to inform the public and health professionals about the newly discovered sources of infection and the possible new methods of T. gondii transmission to humans in Egypt.

ACKNOWLEDGEMENT

We would like to thank Dr. Nagwa Elhawary, Parasitology Department, Veterinary Medicine, Kafrelsheikh University, Egypt for technical support.

Funding

This research was financially funded by the Science and Technology Development Fund (STDF), Egypt, (Project no.: 5354).

IRB approval

The protocol of this study was approved by the institutional Animal welfare, Hygiene and Zoonoses committee at Kafrelsheikh University, Egypt (KFS-2018/6).

Ethical statement

The consents were obtained from the owners of vegetables farms and fishermen for the participation in this study and the publication of any relevant data.

Statement of conflict of interest

The authors have declared no conflict of interests.

REFERENCES

Aakool, A.A.K., and Abidali, S.J., 2016. Molecular detection of Toxoplasma gondii in native freshwater fish Cyprinus carpio in Wasit province Iraq. Int. J. Sci. Eng. Res., 4: 7-10.

Afonso, E., Thulliez, P., Pontier, D., and Gilot-Fromont, E., 2007. Toxoplasmosis in prey species and consequences for prevalence in feral cats: Not all prey species are equal. Parasitology, 134: 1963-1971. https://doi.org/10.1017/S0031182007003320

Al-Kappany, Y.M., Rajendran, C., Ferreira, L.R., Kwok, O.C.H., Abu-Elwafa, S.A., Hilali, M., and Dubey, J.P., 2010. High prevalence of toxoplasmosis in cats from Egypt: Isolation of viable Toxoplasma gondii, tissue distribution, and isolate designation. J. Parasitol., 96: 1115-1118. https://doi.org/10.1645/GE-2554.1

Basso, W., Venturini, M.C., Moré, G., Quiroga, A., Bacigalupe, D., Unzaga, J.M., Larsen, A., Laplace, R., and Venturini, L., 2007. Toxoplasmosis in captive Bennett’s wallabies (Macropus rufogriseus) in Argentina. Vet. Parasitol., 144: 157-161. https://doi.org/10.1016/j.vetpar.2006.09.030

Dubey, J.P., 2004. Toxoplasmosis a waterborne zoonosis. Vet. Parasitol., 126: 57-72. https://doi.org/10.1016/j.vetpar.2004.09.005

Dumètre, A., and Dardé, M.L., 2003. How to detect Toxoplasma gondii oocysts in environmental samples? FEMS Microbiol. Rev., 27: 651-661. https://doi.org/10.1016/S0168-6445(03)00071-8

Ekman, C.C.J., Chiossi, M.F. do V., Meireles, L.R., de Andrade, H.F., Figueiredo, W.M., Marciano, M.A.M., Luna, E.J., and de A., 2012. Case-control study of an outbreak of acute toxoplasmosis in an industrial plant in the state of São Paulo, Brazil. Rev. Inst. Med. Trop. S. Paulo, 54: 239-244. https://doi.org/10.1590/S0036-46652012000500001

Elmonir, W., Harfoush, M.A., El-Tras, W.F., and Kotb, S.A., 2017. Toxoplasmosis in stray cats and pregnant women in Egypt: Association between socio-demographic variables and high-risk practices by pregnant women. Life Sci. J., 14: 123-130.

Hamed, A.F., and Mohammed, N.A., 2019. Food safety knowledge, attitude and self-reported practices among food handlers in Sohag Governorate, Egypt. East Mediterr. Hlth. J., 25: 1-10.

Kniel, K.E., Lindsay, D.S., Sumner, S.S., Hackney, C.R., Pierson, M.D., and Dubey, J.P., 2002. Examination of attachment and survival of Toxoplasma gondii oocysts on raspberries and blueberries. J. Parasitol., 88: 790-793. https://doi.org/10.1645/0022-3395(2002)088[0790:EOAASO]2.0.CO;2

Lalonde, L.F., and Gajadhar, A.A., 2016. Cryptosporidium spp., and Toxoplasma gondii on imported leafy green vegetables in Canadian survey. Fd. Waterb. Parasitol., 2: 8-14. https://doi.org/10.1016/j.fawpar.2016.01.001

Lass, A., Ma, L., Kontogeorgos, I., Zhang, X., Li, X., and Karanis, P., 2019. First molecular detection of Toxoplasma gondii in vegetable samples in China using qualitative, quantitative real-time PCR and multilocus genotyping. Sci. Rep., 9: 1-11. https://doi.org/10.1038/s41598-019-54073-6

Lass, A., Pietkiewicz, H., Szostakowska, B., and Myjak, P., 2012. The first detection of Toxoplasma gondii DNA in environmental fruits and vegetables samples. Eur. J. clin. Microbiol. Infect. Dis., 31: 1101-1108. https://doi.org/10.1007/s10096-011-1414-8

Lin, M.H., Che, T.C., Kuo, T.T., Tseng, C.C., and Tseng, C.P., 2000. Real-time PCR for quantitative detection of Toxoplasma gondii. J. clin. Microbiol., 38: 4121-4125. https://doi.org/10.1128/JCM.38.11.4121-4125.2000

Marino, A.M.F., Giunta, R.P., Salvaggio, A., Castello, A., Alfonzetti, T., Barbagallo, A., Aparo, A., Scalzo, F., Reale, S., Buffolano, W., and Percipalle, M., 2019. Toxoplasma gondii in edible fishes captured in the Mediterranean basin. Zoonoses Publ. Hlth., 66: 826-834. https://doi.org/10.1111/zph.12630

Massie, G.N., Ware, M.W., Villegas, E.N., and Black, M.W., 2010. Uptake and transmission of Toxoplasma gondii oocysts by migratory, filter-feeding fish. Vet. Parasitol., 169: 296-303. https://doi.org/10.1016/j.vetpar.2010.01.002

Nayeri, T., Sarvi, S., and Daryani, A., 2021. Toxoplasma gondii in mollusks and cold-blooded animals: A systematic review. Parasitology, 148: 895-903. https://doi.org/10.1017/S0031182021000433

Omata, A.Y., Umeshita, Y., Murao, T., Kano, R., Kamiya, H., Kudo, A., Masukata, Y., Maeda, R., Saito, A., Murata, K., Journal, T., and Omata, Y., 2005. Toxoplasma gondii does not persist in goldfish (Carassius auratus). J. Parasitol., 91: 1496-1499. https://doi.org/10.1645/GE-3503RN.1

Sanders, J.L., Moulton, H., Moulton, Z., Mcleod, R., Dubey, J.P., Louis, M., Zhou, Y., and Kent, M.L., 2015. The zebrafish, Danio rerio, as a model for Toxoplasma gondii. J. Fish Dis., 38: 675–679. https://doi.org/10.1111/jfd.12393

Shapiro, K., Bahia-Oliveira, L., Dixon, B., Dumètre, A., de Wit, L.A., VanWormer, E., and Villena, I., 2019. Environmental transmission of Toxoplasma gondii: Oocysts in water, soil and food. Fd. Waterb. Parasitol., 12: e00049. https://doi.org/10.1016/j.fawpar.2019.e00049

Villena, I., Aubert, D., Gomis, P., Ferte, H., Inglard, J., Dondon, J., Pisano, E., and Pinon, J., 2004. Evaluation of a strategy for Toxoplasma gondii oocyst detection in water. Appl. environ. Microbiol., 70: 4035-4039. https://doi.org/10.1128/AEM.70.7.4035-4039.2004

WHO, 2015. Toxoplasmosis fact sheet. Estimates of the global burden of foodborne diseases. Available at: http://www.euro.who.int/data/assets/pdf_file/0011/294599/Factsheet-Toxoplasmosis-en.pdf?ua=1 (accessed 25 March 2018).

Zhang, M., Yang, Z., Wang, S., Tao, L.F., Xu, L.X., Yan, R.F., Song, X.K., and Li, X.R., 2014. Detection of Toxoplasma gondii in shellfish and fish in parts of China. Vet. Parasitol., 200: 85-89. https://doi.org/10.1016/j.vetpar.2013.10.022