Special Issue:

Emerging and Re-Emerging Animal Health Challenges in Low and Middle-Income Countries

Molecular Identification of Several Pseudomonas aeruginosa Virulence Genes

Baraa Qasim Mohammed1, Asmaa Hamoody Abdullah1, Ahmed Raheem Rayshan2*

1Department of Microbiology, College of Veterinary Medicine, University of Baghdad, Baghdad, Iraq; 2Department of Physiology, Pharmacology, and Biochemistry, College of Veterinary Medicine, University of Al-Qadisiyah, Al-Diwaniyah, Iraq.

Abstract | The investigation was carried out to identify virulence factors activity and to diagnose Pseudomonas aeruginosa from otitis infection of dog and its susceptibility to essential antibiotics. For this purpose, a total of twelve ear swabs were taken from affected canines. The isolates were initially identified based on their morphological characteristics, such as size, color, and shape, as well as by Gram’s staining, biochemical tests, and Vitek2 system confirmation. Pseudomonas aeruginosa was then confirmed by PCR assay. Importantly, all isolates tested positive for the ability to produce the virulence factor hemolysin, a phospholipase enzyme. The 16S rRNA gene was first identified as a virulence gene by polymerase chain reaction study, followed by the identification of the exotoxin T, outer membrane protein I, and phenzaine+ M genes. Three (27.27%) of the isolates were P. aeruginosa carrying exoT genes, four (36.36%) P. aeruginosa isolated carried oprl genes, and three (27.27%) isolates of P. aeruginosa carrying phz+M genes. By using traditional PCR, oprl had the highest prevalence of virulence genes with 504 bp fragments, followed by exoT with 153 bp fragment and phz+M with 128 bp fragment. High levels of significance (P<0.01) were found in all of the study’s components. Finding of the study highlight the prevalence of P. aeruginosa from dog otitis infections and disease associated molecular marker which can guide future design of improved treatments.

 

Keywords | Dogs, Ear samples, P. aeruginosa, PCR, 16Sr RNA


Received | July 12, 2024; Accepted | September 15, 2024; Published | October 31, 2024

*Correspondence | Ahmed Raheem Rayshan, Department of Physiology, Pharmacology, and Biochemistry, University of Al-Qadisiyah, Al-Diwaniyah, Iraq; Email: [email protected]

Citation | Mohammed BQ, Abdullah AH, Rayshan AR (2024). Molecular identification of several Pseudomonas aeruginosa virulence genes. J. Anim. Health Prod. 12(s1): 67-74.

DOI | http://dx.doi.org/10.17582/journal.jahp/2024/12.s1.67.74

ISSN (Online) | 2308-2801

 

BY%20CC.png 

Copyright: 2024 by the authors. Licensee ResearchersLinks Ltd, England, UK.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).



Introduction

Pseudomonas aeruginosa (P. aeruginosa) is a Gram-negative, rod-shaped, extracellular, obligatory aerobic bacterium which may grow anaerobically in the presence of arginine or nitrate, motile by monotrichous flagellum. Some species of types P. aeruginosa carry 1-3 flagella, are non-capsulated and are non-spore forming bacteria (Hameed et al., 2014). The pathogenesis of P. aeruginosa is due to the production of extracellular virulence factors (such as pili, hemolysins, pyocyanin, proteases, alginate, lipopolysaccharide, and the Type III secretion system) and effector proteins (such as Exotoxin U, Exotoxin T, Exotoxin Y, and Exotoxin S) (Chirani et al., 2018; Harrison et al., 2010). Dogs presenting with Pseudomonas otitis externa may exhibit one or a combination of the following clinical signs: head shaking, aural pruritus, malodor from the ear, erythema, alopecia, signs of self-trauma to the pinnae and pre-auricular region, shyness around the head, discharge from the ear canal, aural hematoma, and ulceration of the external ear canal (Miller et al., 2013; Al-Nassry, 2011; Barnard and Foster, 2017). It causes inflammation of the eye and the ear, and soft tissue infections, endocarditis, bacteremia and other infections as well as a number of injuries, especially in hosts who suffer from burns and discouraged immunologically such as cancer patients (Rajan et al., 2003). P. aeruginosa is characterized by special odor with production of many soluble pigments that are helpful for identification of this bacterium such as greenish blue pyocyanin pigment, which has bacteriocin activity that inhibits other bacteria, in addition to radioactive pyoverdin pigment, red pyorubin pigment, pyomelanin pigment and greenish-yellow fluorescence pigment (Lau et al., 2004).

Ear infections are among the ten most frequent reasons for dogs to be presented to veterinarians and may affect up to 20% of dogs (Angus, 2004; Cole, 2004). Bacteria are one of the main causes of middle ear infections, as well as some other pathogens such as viruses and fungi. One or more microorganisms may participate in the infection events, and other factors such as age, sex, genetic, ethnic, social, economic and climate factors influence (Daiy et al., 1999). The polymerase chain reaction (PCR) technique has been widely used to diagnose and identify many pathogens in molecular biology (Hery-Arnaud et al., 2017). P. aeruginosa is resistance to many antimicrobials and it frequently causes infection in animals undergoing antibiotic treatment or in immunocompromised hosts. Additionally, the bacteria are found infrequently as a part of microbial flora of healthy animals (Abedey et al., 2009). As a more powerful technique for identifying bacteria, ribosomal RNA sequencing has been developed. In a prior study, 16S rRNA gene sequencing was successfully used in the clinical laboratory to identify bacterial pathogens (Woo et al., 2008; Suardana, 2014).

Materials and Methods

Sampling

One hundred twenty ear samples were collected from otitis infected dog of both sexes and were obtained from five cities of Baghdad province, Iraq (Hattin district, Al-Kadhimiya, Al-Mashatel Street, Al-Sidiya and Al-Rahmaniya). Samples were collected in a five-month period from October 2021 to February 2022. Samples were collected from dogs suffering from clinical signs (the head tends frequently as a result of inflammation, itching, clear redness in the ear, earwax secretion and an unpleasant odor). Ear samples were transferred into sterile 10-ml universal tubes with transport medium (BHI broth) and labeled by a special number, then placed in a cool box and immediately, send to the Laboratory of Veterinary Medicine College in Baghdad University.

Isolation and identification of Pseudomonas aeruginosa

All samples were streaked on nutrient agar, MacConkey agar and sub-cultured on cetrimide agar and were incubated aerobically for 24 hrs at 37° C. The bacteria were identified depending on microscopical feature by using Gram stain to detect their response to stain, arrangement and shape (Markey et al., 2014). In addition, the morphological features on culture media such as beta-hemolysis on blood agar, non-lactose ferment on MaCConkey agar also several biochemical tests were used to identify the Pseudomonas isolates, such as citrate utilization tests, methyl red / Voges - proskauer (MR/VP) tests, catalase test, gelatin liquefaction test, oxidase test, motility test and triple sugar iron test (Markey et al., 2014). Finally, samples were confirmed with Vitek2 system (Logan and Turnbull, 2013).

Vitek® 2 compact identification system

The BCL identification cards (Bio Merieux) were used based on established biochemical methods and newly developed substrates. This device included 64 biochemical tests which were used in the diagnosis of bacteria to reach the 98 % degree of accuracy (Logan and Turnbull, 2013). Bacteria were subjected for identification by VITEK 2 compact system according to the instruction provided by the BioMérieux company were followed: 3-5 colonies from each isolate were transferred to a glass tube containing 3 ml normal saline to calculate and modify turbidity must be equal to 0.5 Macfarlane standard. Negative pressure was used to transfer bacterial suspension to cassettes which contains 64-wells with 43 colorimetric substrates for phenotypic identification of bacterial species. After complete biochemical reaction within 12 hours, the results were performed according to special software to identify bacterial species and strain.

 

Table 1: Primers set used for detection of P. aeruginosa (Macrogen/ Korea).

Primer Primer sequence 5'- 3' Product size bp Annealing temp. (°C)
16S rRNA1

27F/ AGAGTTTGATCCTGGCTCAG

1492R/TACGGTTACCTTGTTACGACTT

1500 60
Oprl

F/ ATGGAAATGCTGAAATTCGGC`

R/ CTTCTTCAGCTCGACGCGACG

55 504
exoT

F/ AATCGCCGTCCAACTGCATGCG

R/ TGTTCGCCGAGGTACTGCTC

56 153
Phz+M

F/ ACCTGGCCTTCCACGAGAT

R/ CAACAGGCTGGAGAGGTTGT

59 128

Molecular detection of P. aeruginosa isolates

To study bacterial phylogeny and taxonomy, the determination of 16S rRNA gene sequences by polymerase chain reaction (PCR) was applied. With the gene presence in almost all bacteria, often existing as a multi-gene family, or operons, the function of the 16S rRNA gene over time has not changed, suggesting that random sequence changes are a more accurate measure of time and the 16S rRNA gene (1500 bp) is large enough for informatics purposes (Patel, 2001). Genomic DNA extraction of P. aeruginosa was performed by isolation of DNA from bacterial growth according to the protocol of G-spin DNA Extraction (Genomic DNA Mini Kit, Geneaid, Thailand). Amplification of a fragment of the P. aeruginosa 16SrRNA by PCR was conducted using primers: forward (5’- AGAGTTTGATCCTGGCTCAG - 3’) and reverse (5’- TACGGTTACCTTGTTACGACTT - 3’). Primers were procured from IDT (Integrated DNA Technologies company, Macrogen (Korea)). The primers were diluated and used in the interaction according to Mackichan et al. (2015).

Results and Discussion

In the present study, a total of 120 swab of otitis infections in dogs were collected from different areas in Baghdad city and from different age groups between October 2021 and February 2022. Of these 120 samples, Pseudomonas aeruginosa only was detected in 12 (10%) samples while other samples were tested positive for Staphylococcus spp., 30 (25%), Salmonella spp., 10 (8.33%), Streptococcus spp., 4 (3.33%), Klebsiella spp., 8 (6.67%), Proteus spp., 20 (16.67%), E. coli 10 (8.33%), respectively. All other samples were negative for any bacterial growth (Table 2). This agrees with Al-Charrakh et al. (2016) who have recorded 20% P. aeruginosa isolates from ear infections in Egypt. The incidence of P. aeruginosa isolates according to the status of the examined dogs and ages either young or adults, as it showed higher incidence with P. aeruginosa, as reported by Gonzalez et al. (2004).

 

Table 2: The bacteria isolated from samples collected from infected dogs.

Percentages of isolates Number of isolates

Identification of bacterium

10% 12 Pseudomonas aeruginosa
12.50% 15

Salmonella spp.

16.67% 20

Proteus spp.

6.67% 8

Klebsiella spp.

8.33% 10 E. coli
25.00% 30

Staphylococcus spp.

3.33% 4

Streptococcus spp.

17.50% 21 Negative samples
100% 120 Total No.
8.719 ** ---

Chi-Square (χ2)

** (P≤0.01).

The twelve samples were positive for P. aeruginosa (showing a percentage positivity of 10%). The infection rate of Pseudomonas aeruginosa was high 4 (33.33%) in Al_kadhimiya aerra, 4 (33.33%) in Al-amriya aera, 3 (25%) in Al-Sayidia area, and low infection rate 1 (8.33%) in Al-dhamiya aera, while the other samples observed negative for any bacteria as show in the Figure 1 and Table 3.

 

 

Table 3: The incidence of P. aeruginosa isolated from dog’s ear samples according to area.

Percentages %

Pseudomonas aeruginosa isolates

Percen`tages % Examined samples Area
33.33% 4 37.50% 45 Al-Amriya
33.33% 4 37.50% 45 Al_Kadhimiya
8.33% 1 8.33% 10 Al_ Dhamiya
25.00% 3 8.33% 10 Al_Sayidia
  0 8.33% 10 Al-Rahmaniya
100% 12 100% 120 Total No.
4.0278* ---   ---

Chi-Square (x2)

* (P≤0.05).

 

Table 4: The incidence of P. aeruginosa isolated from dog’s ear samples according to date.

Percentages %

Pseudomonas aeruginosa isolates

Percentages % No. of samples isolates Months
16.67% 2 8.33% 10 October
0% 0 25.00% 30 November
25.00% 3 33.33% 40 December
33.33% 4 20.83% 25 January
25.00% 3 12.50% 15 February
100% 12 100% 120 Total
4.517 * --- 23.750 **  

Chi-Square (x2)

* (P≤0.05, ** (P≤0.01).

 

The positivity rates in samples collected between October 2021 to February 2022 were higher in January (4, 33.33%) followed by February (3, 25%) and low rate of positivity was observed in December (3, 25%) and even lower in October (2, 16.67%). These results indicate a low incidence of P. aeruginosa infection in October and high incidence of P. aeruginosa infection in January (Table 4).

 

Table 5: The incidence of P. aeruginosa isolated from young and adult dogs.

Percentages

Pseudomonas aeruginosa isolates

Percentages Examined samples Age of dogs
66.67% 8 58.33% 70 Adult
33.33 4 41.67% 50 Young
100% 12 100% 120 Total
0.248 NS --- 3.371 * ---

Chi-square (x2)

* (P≤0.05).

 

Out of 120 ear samples of dogs, adult (70, 58.3%) showed higher positivity compared to young dogs (50, 41.67%). The isolation of P. aeruginosa was higher (8, 66.6%) in adult and low (4, 33.3%) in young dogs. This clearly articulate that a high infection rate of P. aeruginosa in adult dog with low infection rate in young (Table 5).

 

Confirmation of P. aeruginosa isolates

Bacteriologic culture of ear samples was recovered on selective media. Smooth round colonies with pale yellow color on MaCconkey agar occurred by utilizing of non-lactose in the agar, while cetrimed agar was considered as a rapid and accurate method for distinguishing P. aeruginosa from other Gram-negative bacteria. The visible colonies appeared blue or yellow green, which indicated non lactose fermentation by producing a pyocyanin (blue green), fluorescein (yellow green) pigments as noticed by Forbes et al. (2002).

Bacterial colonies were observed to be blue colored on nutrient agar. On nutrient agar, several odors ranging from a sweet to earth smell were observed. The colonies were large, low, oval, convex and rough, sometimes surrounded by serrated growth (Pitt and Simpson, 2006). On the cetrimide agar, the bacterial colonies appeared as greenish yellow, most of which produce pyocyanin, which is green blue and pyoverdine, as reported earlier (Sudhakar et al., 2015).

Determination of some virulence factors produce by P. aeuroginosa

Distribution of virulence factors in clinical isolates of P. aeruginosa showed all isolates were β-hemolysis bacteria where colonies appeared on blood agar, and evidence of hemolysin enzyme production. The results are in agreement with Selim et al. (2015) which showed 100% positivity for lecithinase. On the egg yolk agar, the bacterial colonies showed an opaque zone around the colonies indicating phospholipase production. It has been identified previously that most of the P. aeruginosa form brown opaque zones around growing colonies (Atlas,1995; Mahmood, 2015) (Table 6).

 

Table 6: The production of some virulence factor by P. aeuroginosa.

Results

Virulence factors

Hemolysin

Lecithinase

Positive 12(100%) 12(100%)
Negative 0 0

 

The optimum growth of P. aeruginosa in the biochemical testes occurred at 37 °C. The growth on triple sugar iron agar (TSI) with a (K/K/g-H2S-) profile, (Alkaline- Alkaline) on both the slant and bottom with appear no gas bubbles but no H2S production. We also noticed that IMVIC was negative for P. aeruginosa, as well as indole negative, methyl red-negative and VP negative. However, we observed that the citrate test was positive. It also gave positive results in the motility test. The results of catalase tests was positive as well as for oxidase (Todar, 2011).

Biochemical confirmation by VITIK 2 compact system

The suspected isolates were confirmed by VITIK 2 compact system

The VITEK2 small system was used (Biomerieux- France), which offers an advanced approach to bacterial inspection by delivering more dependable technology, high speed, and high sensitivity for bacterial identification, with 99 % accuracy findings. As shown in Figure 5, the study’s conclusion was that isolates were indeed (99%) P. aeruginosa.

 

Molecular techniques

PCR was applied to confirm genomic DNA for P. aeruginosa. The invention of polymerase chain reaction (PCR) and automated DNA sequencing has allowed the characterization of bacteria thoroughly and economically. A comparison of the genomic sequences of bacterial species showed that the 16S ribosomal RNA (16S rRNA) gene is highly conserved within a species and among species of the same genus and, hence, can be used as the new gold standard for the specification of bacteria (Woo et al., 2000).

The G-spin DNA extraction kit (Intron Biotechnology, Korea) was used for isolation of genomic DNA from bacteria. All six isolates, detected positive for bacteriological characteristics, were also detected positive for genomic DNA amplification on agarose gel electrophoresis. The amplification of bacterial 16s rRNA gene showed an expected 1500 bp (Figure 6).

 

Four of the twelve P. aeruginosa isolates found in dog’s otitis were selected for virulence genes identification. Each of the three DNA samples was examined for four genes (oprl, exo T andphz+M) as showed in Figure 7.

Out of four of P. aeruginosa isolates, three (27.27%) isolates were P. aeruginosa carried exo T genes, four (36.36%) isolates carried oprl genes, and three (27.27%) isolates were positive for phz+M genes Table 7.

 

Table 7: The result of virulence genes in P. aeruginosa isolate.

Percentages

No. of isolates carrying gene

No. of total isolates

Name of genes

27.27% 3 11 ExoT
36.36% 4 11 Oprl I
27.27% 3 11 Phz+M
0.903 NS --- ---

Chi-Square (x2)

** (P≤0.01).­

All of P. aeruginosa strains tested here contained the oprI genes (sensitivity= 100%, specificity= 80%). Similar in this study, all of the 268 isolates were remarkably positive for both oprI genes (Lavenir et al., 2007). In this study, we observed a lower prevalence of exoT gene (5%, respectively) (Berthelot et al., 2003). Six of the P. aeruginosa isolates were selected and sent to Korean laboratory for the identification of the sequences and comparison with similar sequence of the 16Sr RNA gene of the reference strains of P. aeruginosa in GenBank. These isolates were confirmed by using small subunit ribosomal PCR gene (16s rRNA gene) amplified by a specific primer. Sequencing and analysis for similarities across GenBank sequences were conducted. The full gene sequences of the strains were compared automatically using the Basic Local Alignment Search Tool (BLAST) in the NCBI against the sequences of bacteria available in databanks. The aim of the sequence analysis for P. aeruginosa was to analyze the novel sequence of the 16S rRNA gene of strains isolated in this study in order to understand the phylogenetic relationships between these sequences and those between the sequences of bacteria available in databanks. Six isolates were confirmed by using small subunit ribosomal PCR gene (16s rRNA gene) amplified by a specific primer. Based on the sequencing and analysis for similarities across GenBank, it appeared that six isolates showed a 100% nucleotide sequence identity (Table 8).

 

Table 8: The isolates of P. aeruginosa by 16s rRNA gene sequencing ID in gene bank and nucleotide sequence identity from (NCBI).

Gene: 16S ribosomal RNA gene

Identities

Sequence ID with compare

Accession

numbers

Source

Isolate No.

100% ID: MT646431.1 OM918231.1 P. aeruginosa 1
100% ID: MN889007.1 OM918232.1 P. aeruginosa 2
100% ID: MT180543.1 OM918233.1 P. aeruginosa 3
100% ID: MT448952.1 OM918234.1 P. aeruginosa 4
100% ID: CP053747.1 OM918235.1 P. aeruginosa 5
100% ID: MT598026.1 OM918236.1 P. aeruginosa 6

 

CONCLUSIONs and Recommendations

The findings of this study clearly show that dogs with otitis serve as an ecological reservoir for strains of Pseudomonas aeruginosa that are resistant to antibiotics, which may be transmissible and dangerous to cats, cattle, and people. The comparatively low prevalence of Pseudomonas aeruginosa in ear samples would suggest that domestic dogs do not have a significant impact on the epidemiology of this bacteria. But in the case of multidrug-resistant Pseudomonas aeruginos, dogs can be crucial emerging host. It appears that using the oprI, exoT, and phzM genes simultaneously increases the reliability of P. aeruginosa detection based on the PCR. The identification of many virulence genes in P. aeruginosa isolates led to believe that these genes are linked to various degrees of intrinsic virulence and pathogenicity, which warrant future investigations.

Acknowledgements

Authors are thankful to both of Universities; University of Baghdad and University of Al-Qadisiyah for their supports.

Novelty statement

Molecular identification of Pseudomonas aeruginosa virulence genes in Baghdad region add novel finding in this domain which warrant future investigations.

Author’s Contribution

Authors of manuscript Baraa Qasim Mohammed, Asmaa Hamoody Abdullah, and Ahmed Raheem Rayshan had similar participation in this study.

Conflict of interest

The authors have declared no conflict of interest.

REFERENCES

Abedey SJM, Muhna BMM, Al-Shwelly JRE (2009). Pseudomonas aeruginosa’s bacterial strain Determine the sensitivity of an isolate from several pathogenic cases at the hospital for obstetrics and pediatrics and teaching hospital in Diwaniya. Iraqi J. Vet. Med., 33(2): 32-36. https://doi.org/10.30539/iraqijvm.v33i2.687

Al-Charrakh AH, Al-Awadi SJ, Mohammed AS (2016). Detection of Metallo-β-Lactamase Producing Pseudomonas aeruginosa Isolated from Public and Private Hospitals in Baghdad, Iraq. Acta Med. Iranica, 2(54): 107-113.

Al-Nassry BS (2011). Isolation and identification of bacterial isolates from ear infection and their sensitivity to usual antibiotics in human and dogs. Iraqi J. Vet. Med., 35(1): 159–166. https://doi.org/10.30539/iraqijvm.v35i1.619

Angus JC (2004). Otic cytology in health and disease. The veterinary clinics of North America. Small Anim. Pract., 34(2): 411–424. https://doi.org/10.1016/j.cvsm.2003.10.005

Atlas RM (1995). Principles of microbiology, 1st Ed. Mosby, Inc. Missouri. pp. 364.

Barnard N, Foster A (2017). Pseudomonas otitis in dogs: A GP’s guide to treatment. Practice, 39(9). https://doi.org/10.1136/inp.j892

Berthelot P, Attree I, Plésiat P, Chabert J, de Bentzmann S, Pozzetto B, Grattard F Groupe d’Etudes des Septicémies à Pseudomonas aeruginosa (2003). Genotypic and phenotypic analysis of type III secretion system in a cohort of Pseudomonas aeruginosa bacteremia isolates: Evidence for a possible association between O serotypes and exo genes. J. Infect. Dis., 188(4): 512–518. https://doi.org/10.1086/377000

Chirani AS, Majidzadeh R, Pouriran R, Heidary M, Nasiri MJ, Gholami M, Goudarzi M, Omrani VF (2018). The effect of in silico targeting Pseudomonas aeruginosa patatin-like protein D, for immunogenic administration. Comp. Biol. Chem., 74: 12–19. https://doi.org/10.1016/j.compbiolchem.2018.02.001

Cole LK (2004). Otoscopic evaluation of the ear canal. The Veterinary clinics of North America. Small Anim. Pract., 34(2): 397–410. https://doi.org/10.1016/j.cvsm.2003.10.004

Daiy A, Brow E, Lingren R, Meland HT, Scott Giebink G (1999). Epidemivlogy of otitis media onset by six month of age. Dediatrics, 103(6): 1158-1166. https://doi.org/10.1542/peds.103.6.1158

Forbes BA, Sahm DF, Weissfeld AS (2002). Bailey and Scott, S. diagnostic microbiology. 11th ed. Mosby Company. Missouri, 7(9): 384-398.

Gonzalez A, Espinosa V, Merino A, Roy W (2004). Most frequent diseases in ornamental birds and their influence on biodiversity. Laboratory results. Rev. Cubana Ciencia Avicola, 28(1): 43-47.

Hameed AM, Malla S, Kumar RS (2014). Molecular characterization of Pseudomonas sp. isolated from milk samples by using RAPD-PCR. Eur. J. Exp. Biol., 4: 78-84.

Harrison EM, Carter ME, Luck S, Ou HY, He X, Deng Z, O’Callaghan C, Kadioglu A, Rajakumar K (2010). Pathogenicity islands PAPI-1 and PAPI-2 contribute individually and synergistically to the virulence of Pseudomonas aeruginosa strain PA14. Infect. Immune., 78(4): 1437–1446. https://doi.org/10.1128/IAI.00621-09

Hery-Arnaud G, Nowak E, Caillon J, David V, Dirou A, Revert K, Le Bihan J (2017). Evaluation of quantitative PCR for early diagnosis of Pseudomonas aeruginosa infection in cystic fibrosis: A prospective cohort study. Clin. Microbiol. Infect., 3(23): 203-207. https://doi.org/10.1016/j.cmi.2016.11.016

Lau GW, Hassett DJ, Ran H, Kong F (2004). The role of pyocyanin in Pseudomonas aeruginosa infection. Trends Mol. Med., 10(12): 599–606. https://doi.org/10.1016/j.molmed.2004.10.002

Lavenir R, Jocktane D, Laurent F, Nazaret S, Cournoyer B (2007). Improved reliability of Pseudomons aeruginosa PCR detection by the use of the specific ecfx gene target. J. Microbiol. Methods, 70: 20-29. https://doi.org/10.1016/j.mimet.2007.03.008

Logan NA, Turnbull PCB (2003). Bacillus and recently derived genera. In: Manual of clinical microbiology, american society for microbiology, washington, DC, pp. 445-460.

MacKichan J, Kato-Maeda M, Miller S (2015). Use of 16S rRNA Gene for Identification of a Broad Range of Clinically Relevant Bacterial Pathogens. PLoS One, 10(2): e0117617. https://doi.org/10.1371/journal.pone.0117617

Mahmood AN (2015). Isolation and identification of pseudomonas aeruginosa from infected sheep and detection of phosolipase C (lecithinase: Ahmed N. Mahmood and Assma H. Aljobori. Iraqi J. Vet. Med., 39(1): 28–32. https://doi.org/10.30539/iraqijvm.v39i1.193

Markey BK, Leonard FC, Achambault M, Cullinana A, Maguire D (2014). Clinical veterinary microbiology. 2nd ed. Mosby Elsevier, pp. 275-288.

Miller WH, Griffin CE, Campbell KL, Muller, Kirk’s (2013). Small animal dermatology. 7th ed. Toronto, Ontario: Elsevier. pp. 741–767. https://doi.org/10.1111/jsap.12063

Patel JB (2001). 16S rRNA gene sequencing for bacterial pathogen identification in the clinical laboratory. Mol. Diagn., 6(4): 123-313. https://doi.org/10.1054/modi.2001.29158

Pitt TL, Simpson AJ (2006). Pseudomonas aeruginosa and Burkholderia spp. In: Hawkey PM, Gillespie SH, editors. Principles and Practice of Clinical Bacteriology. Chichester: John Wiley and Sons. pp. 426-443.

Pollack M (1995). Pseudomonas aeruginosa. In: Principles and practice of infectious diseases by (G.L. Mandel and J.E. Bennett), Churchill Livingstone, New York, pp. 1980-2003.

Cruickshank JP, Duguid BP, Marmion, Swain RHA (1975). Medical microbiology, 12th Edition, Edward Arnold Publishers, Vol. II.

Rajan S, Cacasano G, Bryan R, Ratner AJ, Sonitch CU, Heerakeren AV, Davis P, Prince A (2003). Pseudomonas aeruginosa inductin of apoptosis in respiratory epithelial cells. Am. J. Respir. Cell Mol. Biol., 23(3): 304-312. https://doi.org/10.1165/ajrcmb.23.3.4098

Razzaq AHA (2017). Bacteriological and molecular study of Pseudomonas aeruginosa strains isolated from different clinical cases in Erbil and Kurkuk. Iraqi J. Vet. Med., 41(2): 124-130. https://doi.org/10.30539/iraqijvm.v41i2.61

Selim S, Elkholy I, Hagagy N, ElAlfay S, Abedl-Aziz M (2015). Rapid identification of Pseudomonas aeruginosa by pulsed field gel electrophoresis. Biotechnol. Biotechnol. Equip., 1(29): 152-651. https://doi.org/10.1080/13102818.2014.981065

Suardana IW (2014). Analysis of nucleotide sequences of the 16S rRNA gene of novel Escherichia coli strains isolated from feces of human and Bali cattle. J. Nucl. Acids, 2014: 475754 https://doi.org/10.1155/2014/475754

SudhaKar T, Karpngam S, Premkumer J (2015). Biosynthesis antibacterial activity of pyocyanin pigment ced produced by pseudomonas aeruginosa SU1. JCPRG5. 7(3): 921-924.

Todar K (2011). Pseudomonas aeruginosa. Textb. Bacteriol. Sci. J., 304: 14219.

Woo PCY, Leung PKL, Leung KW, Yuen KY (2000). Identification by 16S ribosomal RNA gene sequencing of an Enterobacteriaceae species from a bone marrow transplant tneipicer. Mol. Pathol., 53: 812-112. https://doi.org/10.1136/mp.53.4.211

Woo PCY, Lau SKP, Teng JLL, Tse H, Yuen KY (2008). Then and now: Use of 16S rDNA gene sequencing for bacterial identification and discovery of novel bacteria in clinical microbiology laboratories. Clin. Microbiol. Infect., 14(10): 908-934. https://doi.org/10.1111/j.1469-0691.2008.02070.x