Special Issue:

Veterinary Medicine between Sustainable Development and Public Health to Confront Global Changes

Non-Typhoidal Salmonella in Chicken and Human: Prevalence, Serotyping, Antibiogram, Virulence, Antimicrobial Resistance Genes and stn Gene Sequencing

Mahmoud Ezzat1, Fatma Youssef2, Ahmed Eid1, Marwa E. Abo Hashem1*

1Department of Bacteriology, Immunology, and Mycology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia, Egypt; 2Department of Clinical Pathology, Animal Health Research Institute, Ismailia, Egypt.

Abstract | Non-typhoidal Salmonella is a zoonotic bacterium having a worldwide risk to public health and chicken industry. Primary aim of study is to assess Salmonella prevalence in chicken and human then serotyping, antibiogram, virulence and antibiotic resistance genes identification by PCR and sequence analysis. In total, 300 samples were gathered (100 chicken liver, 150 chicken feces, 50 human stool). Bacteriological examination, serotyping, antibiogram, virulence (invA, stn) and antibiotic resistance genes (ermB, aadB) PCR screening for detection of virulence and antimicrobial resistance of strains and stn gene sequencing in S. Typhimurium of poultry (STP), S. Enteritidis of poultry (SEP) and S. Typhimurium of human (STH) were accomplished. Salmonella prevalence was 4% for both chicken (12/300) and human samples (2/50). Chicken isolates serotyped as S. Typhimurium (50%) and S. Enteritidis (50%). Human isolates typed as S. Typhimurium (100%, 2/2). All serovars were resistant to clindamycin and erythromycin (100%). Multidrug-resistance (MDR) was detected in SEP, STP, STH by 100%, 80% and 50%, respectively. invA, stn genes were detected by 100% in all serovars. ermB was detected in SEP, STH and STP by 100%, 100% and 80% respectively. aadB gene was detected in SEP, STP and STH by 100%, 80% and 50%, respectively. stn sequencing revealed similarity between S. Typhimurium of human and S. Typhimurium and S. Enteritidis of chicken origin was 98.4% and 99.3%, respectively. It could be concluded that S. Typhimurium, S. Enteritidis of chicken and S. Typhimurium of human were MDR and share high stn gene similarity suggesting a public health alarm.

Keywords: Salmonella, Chicken, Serotyping, Antibiogram, virulence, Antibiotic resistance genes, Sequencing


Received | June 26, 2024; Accepted | August 01, 2024; Published | November 06, 2024

*Correspondence | Marwa El Sayed Hassan Abo Hashem, Department of Bacteriology, Immunology, and Mycology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia, Egypt; Email: [email protected]

Citation | Ezzat M, Youssef F, Eid A, Hashem MEA (2024). Non-typhoidal Salmonella in chicken and human: Prevalence, serotyping, antibiogram, virulence, antimicrobial resistance genes and stn gene sequencing. Adv. Anim. Vet. Sci. 12(s1): 310-319.

DOI | https://dx.doi.org/10.17582/journal.aavs/2024/12.s1.310.319

ISSN (Online) | 2307-8316; ISSN (Print) | 2309-3331

Copyright: 2024 by the authors. Licensee ResearchersLinks Ltd, England, UK.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).



INTRODUCTION

Within the family Enterobacteriaceae, Salmonella is a prominent genus. Its species are motile, aerobic, facultative anaerobes, non-spore-forming, and gram-negative (Mahamedin et al., 2024). An agglutination test using polyvalent antisera for somatic O antigens can be used to determine the serogroup of Salmonella. Afterwards, specific serovar can be identified by slide agglutination tests with monovalent antisera to certain O antigen and tube agglutination tests with antisera to flagella H antigens (Gast and Porter Jr, 2020).

Salmonellae are categorized into three primary classes according to the animals and humans they infect. The serotypes in the first group are unique to the human host; the serotypes in the second group are adapted to certain animal hosts; and the serotypes in the third group are not adapted and can cause diseases in in both a variety of animal species and humans (Ali and Sultana, 2015). The two main ways to contract nontyphoidal Salmonella are via eating contaminated food products sourced from animals and by coming into contact with animals. The most common human serovars of Salmonella are also found in poultry, which may indicate an epidemiologic link between chickens serving as a reservoir for people infections (Foley et al., 2011).

In Egypt, the prevalence of Salmonella spp. was 4.7% in chicken cloacal samples and 4.4% in human stool samples (Diab et al., 2019). The most frequently detected serotypes in chicken farms in Egypt were Salmonella Enteritidis, S. Typhimurium, S. Shangani and S. Gueuletapee (El-Sharkawy et al., 2017). Elkenany et al. (2019) detected the most common identified Salmonella serotype from chickens cloacal swabs in Egypt was S. enteritidis by 11.4% followed by S. typhimurium (8.6%). Salmonellosis is a costly disease in the chicken industry as it significantly impair performance, 24% broiler weight gain may dropping as well as 12% raising in food conversion ratio. Chicks are vulnerable to contracting Salmonella at an early age from a variety of sources. Over 200 Salmonella serovars were thought to be capable of colonizing a chicken’s digestive system. Salmonella Typhimurium is an infectious serotype found in chickens and cause salmonellosis in humans. Antibiotics and immunizations are examples of preventive strategies used to combat this infection (Aljumaah et al., 2020).

Typhimurium is one of the most prevalent serotypes of Salmonella enterica, which still a significant worldwide contributor to foodborne illnesses in people. It is often derived from cattle, poultry, pigs, or their products (Sun et al., 2020). S. typhimurium (17.85%), S. enteritidis (14.28%) were the most prevalent serotypes detected in human stool in Egypt (Youssef et al., 2021) while S. enteritidis (39.4%) and S. typhimurium (24.1%), were the most prevalent serotypes detected in human stool in Ghana (Andoh et al., 2017).

Three mechanisms account for Salmonella enterica infections’ pathogenicity: Colonization, intracellular survival, and host cell invasion. All these actions are regulated by the virulence genes present in Salmonella pathogenicity islands (SPI). The type III secretion system encoded in the SPI-1 is necessary for the most widespread invasion. Invasion protein A (invA) and other bacterial effector proteins are injected into cells of epithelium using this instrument, which resembles a needle. invA is a virulence factor that has been studied in great details since infection to cross epithelial cells, it must first occur (Zermeño-Ruiz et al., 2022).

A combination of socioeconomic, environmental, and ecological factors, including the usage of antibiotics, have contributed to the the growing number of multidrug-resistant (MDR) bacteria, are the main causes of infectious disease development. Due to its high transmission capability, multidrug-resistant Salmonella (MDR) is becoming a greater threat and challenge. A few tactics that bacteria can employ to adapt to new surroundings and survive are virulence factors and antimicrobial resistance (AMR) (Sun et al., 2020). Two molecular methods are essential for characterizing pathogens: Sequencing and phylogenetic analysis (Azab et al., 2019).

The relentless usage of antibiotics may trigger the development of bacterial resistance, which could endanger public health by dispersing resistance from farm animals to people worldwide (CSE, 2014). Hence, the objectives of the study was to reveal Salmonella prevalence in chicken and human, serotyping of isolates, the antibiogram profiles, virulence (invA, and stn) and antibiotic resistance genes (ermB and aadB) detection and sequence analysis of stn gene of S. typhimurium of chicken and human and S. enteritidis from poultry.

MATERIALS AND METHODS

Sample collection

Two hundred and fifty chicken samples (100 from liver, 150 from feces) were collected from different poultry farms at Ismailia government, Egypt. Fifty stool samples were collected from human at different Ismailia laboratories. Samples size was selected based on the large number of poultry farms in Ismailia compared to the number of human analysis laboratories. All samples were collected aseptically into buffered peptone water (Oxoid, UK), quickly sent as possible to the microbiology lab for identification bacteriologically.

Salmonella isolation and identification

For Salmonella isolation according to ISO (2002), pre-enrichment was performed in Rapport–Vassiliadis broth (Oxoid, Hampshire, UK), incubated for 18-24 hours at 37°C then cultivation on two selective media: xylose lysine deoxycholate (XLD) agar (HiMedia) and Salmonella–Shigella (SS) agar (HiMedia) for 18-24 hours at 37°C. Based on colonial characteristics, Gram stain and biochemical reactions (methyl-red, catalase test, oxidase test, citrate-utilization, indole, Voges-Proskauer, H2S production and urease), the expected Salmonella colonies were identified in accordance with ISO (2002).

Salmonella serotyping

Using Salmonella antiserum (Denka Seiken Co., Japan), Salmonella isolates were serotyped based on flagellar (H) and somatic (O) antigens using the scheme of Kauffman-White (Kauffman, 1974).

Salmonella antimicrobial susceptibility

Ten antibacterial agents (Oxoid Hampshire, UK): ciprofloxacin, trimethoprim/ sulfamethoxazole, oxytetracyclines, amoxicillin, gentamycin, erythromycin, ofloxacin, clindamycin, amoxicillin-clavulanic acid, and chloramphenicol have been tested on the isolates using the disk diffusion approach as outlined by Finegold (1988), antibiograms were carried out. The CLSI (2018) was followed in the interpretation of the results.

Virulence and antimicrobial resistance genes molecular determination

stn (Salmonella enterotoxin) and invA (invasion protein A) virulence genes and aadB (aminoglycoside resistance gene) and ermB (macrolide resistance gene) antimicrobial resistance genes were detected by PCR. Following the directions provided by the manufacturer, the QIAamp DNA Mini kit (Qiagen, GmbH, Germany/Catalogue No. 51304) was utilized for DNA extraction. Every reaction included both positive (positive strains supplied by animal health research institute, Egypt) and negative controls (reactions without a DNA template). Salmonella virulence and antibiotic resistance gene DNA amplification was carried out in accordance with the references listed in Table 1. Using agarose gel electrophoresis 1.5% (w/v) (Applichem GmbH, Darmstadt, Germany) at 100 V in 1X TAE buffer (0.04 M Tris, 0.0001 M EDTA, pH 8.0) for 45 minutes, amplified PCR products were screened. Visualization was performed using 15 μL ethidium bromide (Sigma Aldrich, USA) and receive photographs using a UV transilluminator.

Sequencing

The stn gene was sequenced for three Salmonella isolates (one isolate from human, two isolates from poultry). Sequencing of a purified PCR product was performed using a ready-made Bigdye Terminator V3.1 cycle sequencing kit (Perkin-Elmer/Applied Biosystems, Foster City, CA) with Cat. No. 4336817 in both directions forward and reverse using an Applied Biosystems 3130 automated DNA sequencer (ABI, 3130, USA).

The initial step in proving sequence identity to GenBank accessions was, according to Altschul et al. (1990), a BLAST analysis (basic local alignment search tool). A comparative sequences analysis was conducted via the Clustal W multiple sequence alignment program, version 12.1 of MegAlign module of Lasergene DNA star software pairwise (Madison, Wisconsin, USA) which was designed by Thompson et al. (1994) and Phylogenetic analysis were executed through maximum likelihood, neighbour joining and maximum parsimony in MEGA6 (Tamura et al., 2013).

Statistical analysis

All the data analysis were done by SPSS version 26.

RESULTS AND DISCUSSION

Phenotypic characteristics of Salmonella recovered from chicken and human

Salmonella showed colorless colonies with a black center on SS media, while exhibited red colonies with a black center on XLD media. Salmonella microscopically were identifiable as medium-sized, motile, non-sporulating, Gram-negative rods. Biochemical assays revealed positive results for citrate utilization, methyl-red, catalase and H2S production for all Salmonella isolates while indole, Voges-Proskauer, oxidase and urease were negative.

Salmonella prevalence in the examined samples of chicken and human

Ten Salmonella isolates were isolated from 250 bacteriologically investigated poultry samples with a prevalence of 4%. Five isolates from feces (3.3%) and five isolates from liver (5%). Moreover, two Salmonella isolates were isolated from 50 examined human stool samples with a prevalence of 4%. Table 2, Figure 1 show that there is

 

Table 1: Target genes, primer sequences, specific amplicon size of Salmonella virulence and antimicrobial resistance genes.

Gene type

Primer

Sequence

Amplified product

References

Virulence

genes

stn

TTG TGT CGC TAT CAC TGG CAA CC

617 bp

Murugkar et al. (2003)

ATT CGT AAC CCG CTC TCG TCC

invA

GTGAAATTATCGCCACGTTCGGGCAA

284 bp

Oliveira et al. (2003)

TCATCGCACCGTCAAAGGAACC

Antimicrobial resistance genes

aadB

GAGCGAAATCTGCCGCTCTGG

319 bp

Frana et al. (2001)

CTGTTACAACGGACTGGCCGC

ermB

GAAAAAGTACTCAACCAAATA

639 bp

Nguyen et al. (2009)

AATTTAAGTACCGTTACT

 

Table 2: The prevalence of Salmonella isolates in poultry and human samples.

Source of samples

Type of samples

No. of examined samples

No. of positive samples

Percentage of positive samples

Poultry

Feces

150

5

3.3%

Liver

100

5

5%

Human

Stool

50

2

4%

p value

0.8

 

 

no statistically significant difference in the distribution of Salmonella isolates between the studied human and poultry samples (p > 0.05%).

The current study, detected 4% (10/250) total Salmonella prevalence in poultry and this was nearly just like Da Cunha-Neto et al. (2018) who reported Salmonella prevalence by 3.7% from chicken samples at Mato Grosso, Brazil. Moreover, lower prevalence was found by Rahmani et al. (2011) by 2.8% in Tehran, Iran and Dagnew et al. (2020) who found 2.9% Salmonella prevalence in poultry feces in Adama and Modjo towns, Ethiopia but Kayode et al. (2010), Mohammed and Dubie (2022) detected higher prevalence from chicken fecal samples in Ibadan, Nigeria and Addis Ababa, Ethiopia by 11%, 11.50%, respectively.

Concerning Salmonella prevalence in human stool, the following data detected it by 4% and it was the same recorded by Gharieb et al. (2015) and nearly just like Abate and Assefa (2021) who detected Salmonella prevalence by 4.8% in human stools in Ethiopia. Lower prevalence (2.8%) was detected by Dagnew et al. (2020) in Adama and Modjo towns, Ethiopia. Meanwhile, Tadesse (2014) proved higher prevalence of Salmonella recovered from human stool in Ethiopia (5.68%).

Serotyping of Salmonella isolates obtained from chicken and human samples

Ten Salmonella isolates isolated from poultry were serotyped as S. typhimurium (50%) and S. Enteritidis (50%). Concerning the two Salmonella isolates isolated from human were serotyped as S. Typhimurium (100%) as shown in Table 3. The following data proved that S. typhimurium and S. enteritidis were the serotypes recovered from poultry samples, the same results were reported by El-Kenany et al. (2019) who stated that S. enteritidis and S. typhimurium were the most commonly isolated serovars in poultry. S. typhimurium and S. enteritidis ability to infiltrate non-phagocytic cells and survive and multiply within macrophages and dendritic cells is what provides it its pathogenicity (Gal-Mor et al., 2014). While Esaki et al. (2004) isolated only S. enteritidis from poultry. Certain strains of Salmonella, including S. enteritidis and S. typhimurium, pose a potential threat to public health as they are the primary sources of foodborne infections contracted from contaminated eggs and poultry products (Chlebicz and Slizewska, 2018).

 

Table 3: Number and percentage of different Salmonella serotypes (n=12; 10 from poultry, 2 from human).

Source of isolates

No. of tested isolates

Serotype

No. of Salmonella serotypes

Percentage of Salmonella serotypes

Poultry

10

S. typhimurium

5

50%

S. enteritidis

5

50%

Human

2

S. typhimurium

2

100%

 

The current data detected S. typhimurium in human, this was confirmed by Andoh et al. (2017) who proved that the dominant serovars among hospital Salmonella isolates were S. enteritidis and S. typhimurium as. In most parts of the world, surveys have reported S. enteritidis and S. typhimurium as the major serovars found in humans (Saba et al., 2013; Stevens et al., 2008). S. enteritidis and S. typhimurium were the most commonly isolated from diarrheal illnesses in Ghana and the majority of other African nations (Bonkoungou et al., 2013).

Antimicrobial sensitivity testing of S. typhimurium, S. enteritidis in chicken and S. typhimurium in human

In the following data, all Salmonella serovars from poultry and human were resistant to clindamycin and erythromycin by 100%. Ezzat et al. (2014) found that Salmonella serovars recovered from Dakahlia displayed excessive resistance to erythromycin. Additionally, Fagbamila et al. (2017) said that, all serotypes of Salmonella confirmed high resistance to erythromycin, (100%). When treating poultry infections,

 

erythromycin is the first drug that is advised to be administered. Subsequently, it is not taken for the appropriate length of time or at the suitable dose, the risk of acquiring antimicrobial resistance strains of bacteria against it is high (Shalaby et al., 2022).

 

 

All Salmonella serovars from poultry and human were sensitive to amoxicillin -clavulanic acid and ciprofloxacin by 100% as presented in Table 4 and Figure 2. Talukder et al. (2023) detected sensitivity of Salmonella to ciprofloxacin. Ciprofloxacin usage is regarded as the first medication line of preference (Gokul et al., 2010). S. typhimurium serovar isolated from poultry was resistant to gentamycin by 80% but was sensitive by 80% to sulfonamide and ofloxacin, 60% to oxytetracycline and 40% to chloramphenicol. Thung et al. (2016) who recorded penicillin and erythromycin resistance to while gentamicin, amoxicillin/ clavulanic acid, trimethoprim and tetracycline sensitivity. Meanwhile, Fagbamila et al. (2017) said that, all serotypes of Salmonella confirmed low resistance to gentamicin (5.9%).

S. enteritidis serovar isolated from poultry was resistant to gentamycin by 100% and was resistant to chloramphenicol and amoxicillin by 40% but was sensitive by 100% to trimethoprim-sulfamethoxazole and ofloxacin, 40% to oxytetracycline. These results were disagreed with El-Kenany et al. (2019) detected resistance of S. enteritidis by 100% against trimethoprim-sulfamethoxazole additionally, Mohammed and Dubie (2022) confirmed sensitivity to gentamycin (the highest level of antibiotic efficacy), ciprofloxacin and ampicillin by 95.7%, 78.3% and 69.6%. Nevertheless, tetracycline resistance was high (65.2%).

S. typhimurium serovar isolated from human was resistant to oxytetracycline, chloramphenicol, gentamycin and amoxicillin by 50% meanwhile, was sensitive to trimethoprim-sulfamethoxazole and ofloxacin by 50%. These findings nearly agreed with Andoh et al. (2017). Talukder et al. (2023) detected resistance against tetracycline (37.64%), trimethoprim/ sulfamethoxazole (32.92%), amoxicillin (32.18%). The expanding problem of antimicrobial resistance is caused by the misuse and/or overuse of antibiotics throughout veterinary and human medicine (Gilchrist et al., 2007). It is commonly recognized that antimicrobial-resistant Salmonella in chicken and other food products will result in Salmonella resistance in people (Kagambèga et al., 2013). Statistically in this study, S. typhimurium, S. enteritidis of poultry showed a significant difference in their susceptibility patterns to the studied antimicrobial classes (p < 0.05) but S. typhimurium of human serovars exhibited no significant difference in their susceptibility patterns (p > 0.05%).

Virulence and antimicrobial resistance genes prevalence in Salmonella typhimurium and Salmonella enteritidis

In this data, S. typhimurium (2 strains from human, 5 strains from poultry) and S. enteritidis (5 strains from poultry) were screened for virulence (invA, stn) and antimicrobial resistance genes (aadB, ermB) using PCR. Concerning invA, stn virulence genes were identified by 100% overall the recovered strains of S. typhimurium and S. enteritidis as illustrated by Table 5. Shu et al. (2023) detected the same result of invA, stn genes prevalence by 100% in all Salmonella serovars. SPIs genes enable nontyphoidal Salmonella to cause invasive illness, invA is belong to SPI 1–5 in Salmonella (Kuang et al., 2015). Any strain of Salmonella can be identified in field samples by PCR using the distinct sequence found in the stn gene, which is present in all serotypes (Singh et al., 2017; Ammar et al., 2019). invA contributes to cellular adhesion and invasion. stn plays a major role in the actual demonstration of pathogenic pathways (Murugkar et al., 2003).

Concerning, ermB antimicrobial resistance gene detection in the current data it was detected by 100% (5/5) of S. enteritidis of poultry origin, 80% (4/5) of S. typhimurium of poultry origin and 100% (2/2) of S. typhimurium of human origin. Shalaby et al. (2022) and Feng et al. (2024) were detected ermB gene in erythromycin resistant Salmonella isolates. The ermA, ermB, and ermC genes, control the emergence of erythromycin resistance (Gatermann et al., 2007).

Moreover, our results detected aadB antimicrobial resistance gene by 100% (5/5) in S. enteritidis of poultry origin, 80% (4/5) of S. typhimurium of poultry origin and 50% (1/2) of S. typhimurium of human origin as shown in Table 5 and Figure 3. Similarly, aadB resistance gene was detected by Doosti et al. (2016) and Ahmed et al. (2016). Gentamicin resistance phenotypically is caused by the aadB gene (Cameron et al., 1986). Statistically, the following study revealed no significant difference (p > 0.05%) in antibiotic resistance and virulence genes the distribution in poultry and human Salmonella serovars.

 

Table 5: Virulence and resistance genes prevalence among S. typhimurium (n=5 from poultry, 2 from human) and S. enteritidis (n=5 from poultry).

p value

%

n

Bacterial serotype

Types of genes

1.0

100

5

S. typhimurium of poultry origin

invA

Virulence-determinant genes

100

2

S. typhimurium of human origin

100

5

S. enteritidis of poultry origin

100

5

S. typhimurium of poultry origin

stn

100

2

S. typhimurium of human origin

100

5

S. enteritidis of poultry origin

0.86

80

4

S. typhimurium of poultry origin

ermB

Antimicrobial resistance genes

100

2

S. typhimurium of human origin

100

5

S. enteritidis of poultry origin

80

4

S. typhimurium of poultry origin

aadB

50

1

S. typhimurium of human origin

100

5

S. enteritidis of poultry origin

 

Table 6: Prevalence of multidrug-resistance patterns and the resistance genes Salmonella serovars.

Serotype (source, No. of strains)

%

Type of resistance

Multidrug resistance profiles

Antimicrobial resistance genes

MAR Index

S. typhimurium (poultry, 4)

80

MDR

Three classes: Clindamycin, Gentamycin, Erythromycin

ermB, aadB

0.3

S. enteritidis (poultry, 5)

100

MDR

Three classes: Clindamycin, Gentamycin, Erythromycin

ermB, aadB

0.3

S. typhimurium (human, 1)

50

DR

Two classes: Clindamycin, Erythromycin

ermB

0.2

S. typhimurium (human, 1)

50

MDR

Four classes: Oxytetracycline, Chloramphenicol, Gentamycin, Amoxicillin

ermB, aadB

0.4

 

Salmonella serovars patterns of multidrug resistance

The results evidenced that 80% (4/5) of S. typhimurium of poultry and 100% (5/5) of S. enteritidis of poultry were MDR to three antimicrobial classes (Lincosamide: clindamycin, Aminoglycoside: Gentamycin, and Macrolide: erythromycin) and harbored ermB and aadB resistance genes. Moreover, 50% (1/2) of S. typhimurium of human were MDR to four antimicrobial classes (Tetracycline: oxytetracycline, Chloramphenicol: Chloramphenicol, Aminoglycoside: Gentamycin and Penicillin: Amoxicillin) and harbored ermB and aadB resistance genes. Nearly the same results were detected by Andoh et al. (2017) who revealed that 54.5% of Salmonella strains were multi-resistant. While, 50% (1/2) of S. typhimurium of human were drug resistant (DR) to two antimicrobial classes (Lincosamide: Clindamycin and Macrolide: Erythromycin) and harbored ermB resistance gene as shown in Table 6. The current investigation’s MAR index values (0.2–0.4) revealed several patterns of resistance, suggesting that the Salmonella serovars originated from high-risk contamination.

Animal products containing antibiotic residues have the potential to cause antimicrobial drug resistance, as well as to enhance pathogenicity, virulence of the infection and lengthen and increase the cost of treatment. Humans are typically using more antibiotics every time, which raises the proportion of people who are resistant to antimicrobial medications. The capability to transfer resistance genes horizontally between Salmonella strains and other bacterial species exists. These other species may carry antibiotic resistance genes that aren’t found in the Salmonella genetic pool (Hassan et al., 2016).

Sequence analysis of stn virulence gene for S. typhimurium and S. enteritidis from poultry origin and S. typhimurium from human origin

One strain of S. typhimurium and one strain of S. enteritidis of poultry origin and one strain of S. typhimurium from human origin were sequenced for stn gene. Concerning, S. typhimurium and S. enteritidis of poultry origin the results revealed similarity (96.7-99.8%) of stn gene of the current S. typhimurium of poultry origin and other Salmonella serotypes of various origin. For example, the similarity was 97.6% - 99.8% for the following Salmonella serotypes: S. typhimurium SL1344 with Accession No. FQ312003, S. typhimurium ATCC 13311 with Accession No. CP009102, S. typhimurium SL1344RX with Accession No. CP011233, S. typhimurium SO2 with Accession No. CP014356 and S. typhimurium LT2 (97.6 - 99.8%) with Accession No. AE006468. Also, the similarity was 98.6% - 98.8% for the following Salmonella serotypes: S. enteritidis ATCC BAA-708 with Accession No. CP025554, S. enteritidis EC20120916 with Accession No. CP007332, S. Enteritidis EC20110222 with Accession No. CP007323. Additionally, 97.6% - 99.5% similarity with S. paratyphi AATCC 9150 with Accession No. CP000026 and 97.7% - 99.3% similarity with S. Dublin RM099 with Accession No. CP117354.

 

In case of S. typhimurium from human origin, the results revealed similarity (99.7%) of stn gene of the current S. typhimurium of human origin and other Salmonella serotypes of various origin. For example, the similarity was 99.7% for S. typhimurium FORC50 with Accession No. CP019383. Also, the similarity was 99.5% for the following Salmonella serotypes: S. enteritidis ATCC BAA-708 with Accession No. CP025554, S. enteritidis EC20120916 with Accession No. CP007332, S. enteritidis EC20110222 with Accession No. CP007323. The similarity was 98.3% for the following Salmonella serotypes: S. typhimurium SL1344 with Accession No. FQ312003, S. typhimurium ATCC 13311 with Accession No. CP009102, S. typhimurium SL1344RX with Accession No. CP011233. The similarity between the current S. typhimurium of human origin and the current S. typhimurium and S. enteritidis of poultry origin was 98.4% and 99.3%, respectively as shown in Figures 4 and 5.

 

Similarity between the stn virulence gene of human Salmonella and the stn gene of poultry refers to the degree to which the genetic sequences and functions of the stn gene in both human and poultry Salmonella strains are alike. In both human and poultry Salmonella, this gene is involved in producing an enterotoxin that can disrupt the intestinal lining, leading to symptoms like diarrhea. Similarity between the genes suggests that Salmonella in both humans and poultry may share a common mechanism of causing illness, which can have implications for zoonotic transmission besides the development of strategies to maintain controlling Salmonella infections. High similarity would suggest that the pathogenic mechanisms used by Salmonella in poultry and humans are closely related, even if the strains infect different hosts.

CONCLUSIONS and Recommendations

S. typhimurium and S. enteritidis were the serotypes detected in chicken samples while S. typhimurium was the Salmonella serovar found in human samples. All serovars were resistant to clindamycin and erythromycin. All serovars were harbored the virulence genes invA and stn. ermB and aadB resistance genes were detected genotypically in serovars showed resistance against erythromycin and gentamycin phenotypically. S. enteritidis, S. typhimurium of chicken and S. typhimurium of human showed MDR against several antimicrobial classes (such as tetracycline, chloramphenicol, aminoglycoside and penicillin) suggesting a public health alarm. stn sequencing revealed similarity between S. typhimurium of human and S. typhimurium and S. Enteritidis of poultry origin that confirm presence of stn among many Salmonella serovars.

Author’s Contribution

ME and MEA: The idea and study design. ME, FY, AE and MEA: Performed the experiments. AE and MEA: Drafted the manuscript. ME, FY, AE and MEA: Conducted the statistical analysis, data accuracy, and supervision. AE and MEA: Wrote and critically revised the manuscript. All authors have read and approved the final manuscript.

Conflict of interest

The authors have declared no conflict of interest.

REFERENCES

Abate D, Assefa N (2021). Prevalence and antimicrobial resistance patterns of Salmonella isolates in human stools and animal origin foods in Ethiopia: A systematic review and meta-analysis. Int. J. Health Sci., 15(1): 43.

Ahmed HA, El-Hofy FI, Shafik SM, Abdelrahman MA, Elsaid GA (2016). Characterization of virulence-associated genes, antimicrobial resistance genes, and class 1 integrons in Salmonella enterica serovar Typhimurium isolates from chicken meat and humans in Egypt. Foodb. Pathog. Dis., 13(6): 281-288. https://doi.org/10.1089/fpd.2015.2097

Ali MZ, Sultana S (2015). Determination of humoral immune response in chickens against formalin-inactivated alumprecipitated fowl cholera vaccine. Int. J. Anim. Biol., 1(4): 114-117.

Aljumaah MR, Suliman GM, Abdullatif AA, Abudabos AM (2020). Effects of phytobiotic feed additives on growth traits, blood biochemistry, and meat characteristics of broiler chickens exposed to Salmonella typhimurium. Poult. Sci., 99(11): 5744-5751. https://doi.org/10.1016/j.psj.2020.07.033

Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990). Basic local alignment search tool. J. Mol. Biol., 215(3): 403-410. https://doi.org/10.1016/S0022-2836(05)80360-2

Ammar AM, Abdeen EE, AboShama UH, Fekry E, Kotb Elmahallawy E (2019). Molecular characterization of virulence and antibiotic resistance genes among Salmonella serovars isolated from broilers in Egypt. Lett. Appl. Microbiol., 68(2): 188-195. https://doi.org/10.1111/lam.13106

Andoh LA, Ahmed S, Olsen JE, Obiri-Danso K, Newman MJ, Opintan JA, Dalsgaard A (2017). Prevalence and characterization of Salmonella among humans in Ghana. Trop. Med. Health, 45: 1-11. https://doi.org/10.1186/s41182-017-0043-z

Azab MS, Zowail ME, Elsadek GM, Mohamed SZ (2019). Sequencing and phylogenetic analysis of the Salmonella enterotoxin (stn) gene of Salmonella spp. isolated from Egyptian broiler breeder chickens farms. Egypt. Acad. J. Biol. Sci. C, Physiol. Mol. Biol., 11(3): 139-147. https://doi.org/10.21608/eajbsc.2019.70775

Bonkoungou IJ, Haukka K, Österblad M (2013). Bacterial and viral etiology of childhood diarrhea in Ouagadougou, Burkina Faso. BMC Pediat., 13: 36. https://doi.org/10.1186/1471-2431-13-36

Cameron FH, Obbink DJG, Ackerman VP, Hal RM (1986). Nucleotide sequence of the AAD{2”) aminoglycoside adenylyl transferase determinant aadB. Evolutionary relationship of this region with those surrounding aadA in R538-1 and dhfrll in R388. Nucl. Acids Res., 14(21): 8625-8635. https://doi.org/10.1093/nar/14.21.8625

Centre for Science and Environment (CSE) (2014). CSE study: Antibiotics in chicken meat. Available from: https://cdn.cseindia.org/userfiles/Antibiotics%20in%20Chicken_Lab%20Report_Final%2029%20July.pdf

Chlebicz A, Slizewska K (2018). Campylobacteriosis, salmonellosis, yersiniosis, and listeriosis as zoonotic foodborne diseases: A review. Int. J. Environ. Res. Publ. Health, 15: 863. https://doi.org/10.3390/ijerph15050863

CLSI (2018). Performance standards for antimicrobial susceptibility testing. 28th CLSI Supplement M100. Clinical and Laboratory Standards Institute, Wayne.

Da Cunha-Neto A, Carvalho LA, Carvalho RCT, Rodrigues DPD, Mano SB, Figueiredo DSEE, Conte-Junior CA (2018). Salmonella isolated from chicken carcasses from a slaughterhouse in the state of Mato Grosso, Brazil: Antibiotic resistance profile, serotyping, and characterization by repetitive sequence-based PCR system. Poult. Sci., 97(4): 1373-1381. https://doi.org/10.3382/ps/pex406

Dagnew B, Alemayehu H, Medhin G, Eguale T (2020). Prevalence and antimicrobial susceptibility of Salmonella in poultry farms and in-contact humans in Adama and Modjo towns, Ethiopia. Microbiol. Open, 9(8): e1067. https://doi.org/10.1002/mbo3.1067

Diab MS, Zaki RS, Ibrahim NA, El-Hafez AMS (2019). Prevalence of multidrug resistance non-typhoidal Salmonellae isolated from layer farms and humans in Egypt. World’s Vet. J., 4: 280-288. https://doi.org/10.36380/scil.2019.wvj35

Doosti A, Mahmoudi E, Jami MS, Mokhtari-Farsani A (2016). Prevalence of aadA1, aadA2, aadB, strA and strB genes and their associations with multidrug resistance phenotype in Salmonella Typhimurium isolated from poultry carcasses. Thai J. Vet. Med., 46(4): 691-697. https://doi.org/10.56808/2985-1130.2790

Elkenany R, Elsayed MM, Zakaria AI, El-Sayed SAES, Rizk MA (2019). Antimicrobial resistance profiles and virulence genotyping of Salmonella enterica serovars recovered from broiler chickens and chicken carcasses in Egypt. BMC Vet. Res., 15: 1-9. https://doi.org/10.1186/s12917-019-1867-z

El-Sharkawy H, Tahoun A, El-Gohary AE, El-Abasy GA, El-Khayat MF, Gillespie T, Kitade Y, Hafez HM, Neubauer H, El-Adawy H (2017). Epidemiological, molecular characterization and antibiotic resistance of Salmonella enterica serovars isolated from chicken farms in Egypt. Gut Pathog., 9: 1-12. https://doi.org/10.1186/s13099-017-0157-1

Esaki H, Morioka A, Ishihara K, Kojima A, Shiroki S, Tamura Y, Takahashi T (2004). Antimicrobial susceptibility of Salmonella isolated from cattle, swine and poultry report from the Japanese veterinary antimicrobial resistance monitoring program. J. Antimicrob. Chemother., 53(2): 266-270. https://doi.org/10.1093/jac/dkh081

Ezzat ME, Shabana II, Esawy AM, Elsotohy ME (2014). Detection of virulence genes in Salmonella serovars isolated from broilers. Anim. Vet. Sci., 12(3): 189-193. https://doi.org/10.11648/j.avs.20140206.16

Fagbamila I, Okeke A, Dashen M, Lar P, Ngulukun S, Audu B, Ehizibolo D, Ankeli P, Luka P, Muhammad M (2017). Detection, serotyping and antimicrobial resistance pattern of Salmonella from chicken slaughter slabs in Jos, North-Central Nigeria. Vet. Sci. Res. Rev., 3(1): 25-33. https://doi.org/10.17582/journal.vsrr/2017.3.1.25.33

Feng J, Huang Y, Chen H, Xie S, Yang C, Zheng W, Lv F (2024). Sensitive and specific loop-mediated isothermal amplification assays for detection of Salmonella, CTX-M-1 group genes, mph(A), and ermB in stool and blood samples based on orange to green visible dye. Foodb. Pathog. Dis., https://doi.org/10.1089/fpd.2023.0094

Finegold K (1988). Agriculture and the politics of US social provision: Social insurance and food stamps. The politics of social policy in the United States, pp. 199-234. https://doi.org/10.1515/9780691222004-010

Foley SL, Nayak R, Hanning IB, Johnson TJ, Han J, Ricke SC (2011). Population dynamics of Salmonella enterica serotypes in commercial egg and poultry production. Appl. Environ. Microbiol., 77(13): 4273–4279. https://doi.org/10.1128/AEM.00598-11

Frana TS, Carlson SA, Griffith RW (2001). Relative distribution and conservation of genes encoding aminoglycoside modifying enzymes in Salmonella enterica serotype Typhimurium phage type DT104. Appl. Environ. Microbiol., 67(1): 445-448. https://doi.org/10.1128/AEM.67.1.445-448.2001

Gal-Mor O, Boyle EC, Grassl GA (2014). Same species, different diseases: How and why typhoidal and non-typhoidal Salmonella enterica serovars differ. Front. Microbiol., 5: 391. https://doi.org/10.3389/fmicb.2014.00391

Gast RK, Porter Jr RE (2020). Salmonella infections. Dis. Poult., pp. 717-753. https://doi.org/10.1002/9781119371199.ch16

Gatermann SG, Koschinski T, Friedrich S (2007). Distribution and expression of macrolide resistance genes in coagulase-negative staphylococci. Clin. Microbiol. Infect., 13(8): 777-781. https://doi.org/10.1111/j.1469-0691.2007.01749.x

Gharieb RM, Tartor YH, Khedr MH (2015). Non-typhoidal Salmonella in poultry meat and diarrhoeic patients: prevalence, antibiogram, virulotyping, molecular detection and sequencing of class I integrons in multidrug resistant strains. Gut Pathog., 7: 1-11. https://doi.org/10.1186/s13099-015-0081-1

Gilchrist MJ, Greko C, Wallinga DB, Beran GW, Riley DG, Thorne PS (2007). The potential role of concentrated animal feeding operations in infectious disease epidemics and antibiotic resistance. Environ. Health Persp., 115(2): 313-316. https://doi.org/10.1289/ehp.8837

Gokul BN, Menezes GA, Harish BN (2010). Acc-1 β-lactamase–producing Salmonella enterica serovar Typhi, India. Emerg. Infect. Dis., 16(7): 1170. https://doi.org/10.3201/eid1607.091643

Hassan ARH, Salam HS, Abdel-Latef GK (2016). Serological identification and antimicrobial resistance of Salmonella isolates from broiler carcasses and human stools in Beni-Suef, Egypt. Beni-Suef Univ. J. Basic Appl. Sci., 5(2): 202. https://doi.org/10.1016/j.bjbas.2016.04.002

ISO P (2002). Microbiology of food and animal feeding stuffs. Horizontal method for the detection of Salmonella spp. Geneva, Switzerland: ISO Norm, pp. 6579.

Kagambèga A, Lienemann T, Aulu L, Traoré AS, Barro N, Siitonen A, Haukka K (2013). Prevalence and characterization of Salmonella enterica from the feces of cattle, poultry, swine and hedgehogs in Burkina Faso and their comparison to human Salmonella isolates. BMC Microbiol., 13: 253–261. https://doi.org/10.1186/1471-2180-13-253

Kauffman G (1974). Kauffmann white scheme. J. Acta Pathol. Microbiol. Sci., 61: 38.

Kayode F, Folasade O, Frank MA, Rene SH (2010). Antimicrobial susceptibility and serovars of Salmonella from chickens and humans in Ibadan, Nigeria.

Kuang D, Xu X, Meng J, Yang X, Jin H, Shi W, Pan H, Liao M, Su X, Shi X (2015). Antimicrobial susceptibility, virulence gene profiles and molecular subtypes of Salmonella Newport isolated from humans and other sources. Infect. Genet. Evol., 36: 294–299. https://doi.org/10.1016/j.meegid.2015.10.003

Mahamedin MM, Mahamedin MM, Ed-Dra A (2024). New discoveries in toxins from gram negative bacteria Salmonella. In microbial toxins in food systems: Causes, mechanisms, complications, and metabolism. Cham: Springer Nature Switzerland, pp. 277-288. https://doi.org/10.1007/978-3-031-62839-9_21

Mohammed Y, Dubie T (2022). Isolation, identification and antimicrobial susceptibility profile of Salmonella isolated from poultry farms in Addis Ababa, Ethiopia. Vet. Med. Sci., 8(3): 1166-1173. https://doi.org/10.1002/vms3.762

Murugkar HV, Rahman H, Dutta PK (2003). Distribution of virulence genes in Salmonella serovars isolated from man and animals. Indian J. Med. Res., 117: 66-70.

Nguyen T, Nioi P, Pickett CB (2009). The Nrf2 antioxidant response element signaling pathway and its activation by oxidative stress. J. Biol. Chem., 284(20): 13291-13295. https://doi.org/10.1074/jbc.R900010200

Oliveira SD, Rodenbusch CR, Ce MC, Rocha SLS, Canal CW (2003). Evaluation of selective and non-selective enrichment PCR procedures for Salmonella detection. Lett. Appl. Microbiol., 36(4): 217-221. https://doi.org/10.1046/j.1472-765X.2003.01294.x

Rahmani M, Peighambari SM, Yazdani A, Hojjati P (2011). Salmonella infection in birds kept in parks and pet shops in Tehran, Iran. Int. J. Vet. Res., 5(3): 145-148.

Saba CKS, Escudero JA, Herrera-Leon S, Porrero MC, Suarez M, Dominguez L, Demuyakor B, Gonzalez-Zorn B (2013). First identification of Salmonella Urbana and Salmonella Ouakam in humans in Africa. J. Infect. Dev. Count., 7: 691–695. https://doi.org/10.3855/jidc.3548

Shalaby A, Ismail MM, El-Sharkawy H (2022). Isolation, identification, and genetic characterization of antibiotic resistance of Salmonella species isolated from chicken farms. J. Trop. Med., 1: 6065831. https://doi.org/10.1155/2022/6065831

Shu G, Qiu J, Zheng Y, Chang L, Li H, Xu F, Lin J (2023). Association between phenotypes of antimicrobial resistance, ESBL resistance genes, and virulence genes of Salmonella isolated from chickens in Sichuan, China. Animals, 13(17): 2770. https://doi.org/10.3390/ani13172770

Singh Y, Tiwari A, Kumar R, Saxena MK (2017). Cloning, sequencing and phylogenetic analysis of stn gene of Salmonella typhimurium. Biosci. Biotechnol. Res. Asia, 14(4): 1387-1393. https://doi.org/10.13005/bbra/2583

Stevens A, Kerouanton A, Marault M, Millemann Y, Brisabois A, Cavin JF, Dufour B (2008). Epidemiological analysis of Salmonella enterica from beef sampled in the slaughterhouse and retailers in Dakar (Senegal) using pulsed-field gel electrophoresis and antibiotic susceptibility testing. Int. J. Food Microbiol., 123(3): 191-197. https://doi.org/10.1016/j.ijfoodmicro.2008.01.007

Sun H, Wan Y, Du P, Bai L (2020). The epidemiology of monophasic Salmonella typhimurium. Foodb. Pathog. Dis., 17(2): 87-97. https://doi.org/10.1089/fpd.2019.2676

Tadesse G (2014). Prevalence of human salmonellosis in Ethiopia: A systematic review and meta-analysis. BMC Infect. Dis., 14: 1-10. https://doi.org/10.1186/1471-2334-14-88

Talukder H, Roky SA, Debnath K, Sharma B, Ahmed J, Roy S (2023). Prevalence and antimicrobial resistance profile of Salmonella isolated from human, animal and environment samples in South Asia: A 10-year meta-analysis. J. Epidemiol. Glob. Health, 13(4): 637-652. https://doi.org/10.1007/s44197-023-00160-x

Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013). MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol., 30(12): 2725. https://doi.org/10.1093/molbev/mst197

Thompson JD, Higgins DG, Gibson TJ, Clustal W (1994). Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucl. Acids Res., 22(22): 4673-4680. https://doi.org/10.1093/nar/22.22.4673

Thung TY, Mahyudin NA, Basri DF, Radzi CWM, Nakaguchi Y, Nishibuchi M, Radu S (2016). Prevalence and antibiotic resistance of Salmonella enteritidis and Salmonella typhimurium in raw chicken meat at retail markets in Malaysia. Poult. Sci., 95(8): 1888-1893. https://doi.org/10.3382/ps/pew144

Youssef RA, Abbas AM, El-Shehawi AM, Mabrouk MI, Aboshanab KM (2021). Serotyping and antimicrobial resistance profile of enteric nontyphoidal Salmonella recovered from febrile neutropenic patients and poultry in Egypt. Antibiotics, 10(5): 493. https://doi.org/10.3390/antibiotics10050493

Zermeño-Ruiz M, Rangel-Castañeda IA, Suárez-Rico DO, Hernández-Hernández L, Cortés-Zárate R, Hernández-Hernández JM, Castillo-Romero A (2022). Curcumin stimulates the overexpression of virulence factors in Salmonella enterica serovar typhimurium: In vitro and animal model studies. Antibiotics, 11(9): 1230. https://doi.org/10.3390/antibiotics11091230