Special Issue:

Veterinary Medicine between Sustainable Development and Public Health to Confront Global Changes

Effects of Bee Venom on Cadmium Toxicity in Albino Rats

Mariam Ismail Ali1*, Rania Helmi Abdou1, Mary Ayad Sargious2, Omnia Mohamed Khattab2, Kawthar Abdelwahed Elhady1

1Deptartment of Forensic Medicine and Toxicology, Faculty of Veterinary , Medicine, Suez Canal University, Ismailia, Egypt; 2Genome Research Unit, Animal Health Research Institute, Dokki, Giza, Egypt.

Received | September 09, 2024; Accepted | October 21, 2024; Published | November 06, 2024

*Correspondence | Mariam Ismail Ali, Deptartment of Forensic Medicine. and Toxicology, Faculty of Veterinary, Medicine, Suez Canal University, Ismailia, Egypt; Email: [email protected]

Citation | Ali MI, Abdou RH, Sargious MA, Khattab OM, Elhady KA (2024). Effects of bee venom on cadmium toxicity in albino rats. Adv. Anim. Vet. Sci. 12(s1): 361-375.

DOI | https://dx.doi.org/10.17582/journal.aavs/2024/12.s1.361.375

ISSN (Online) | 2307-8316; ISSN (Print) | 2309-3331

Copyright: 2024 by the authors. Licensee ResearchersLinks Ltd, England, UK.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

INTRODUCTION

Cd2+ is a major industrial and environmental pollutant considered hazardous to both human and animal health. Moreover, Cd2+ is now placed seventh on the Agency for Toxic Substances and Disease Registry’s list of the top twenty hazardous substances. Exposure to cadmium mostly affects the liver, kidneys, lungs, bones, and testes. In addition, Parkinson’s disease, Alzheimer and other neurodegenerative illnesses are brought due to exposure to cadmium.

Cd2+can disrupt cellular functions and cause tissue damage through multiple toxicological pathways. First, Oxidative Stress Caused by Cadmium affects transcription factors, including NF-κB and AP-1, leading to increased NOX gene expression. These transcription factors are active during inflammatory responses, and their activation can result in increased mRNA levels of NOX subunits, which improves enzyme complex production and assembly. Oxidative stress impairs the cellular antioxidant defense system. Key antioxidant enzymes that include superoxide dismutase (SOD) (Qu F et al., 2024).

Cd2+second mechanism is disruption of cellular signaling pathways. It could activate p38 MAPK pathway, leading to the synthesis and release of cytokines including TNF-α and IL-6. These inflammatory molecules play a crucial role in how cells deal with toxicity (Mijit et al., 2020). Furthermore, p38 MAPK is associated with apoptotic pathways, and its activation can either promote or prevent apoptosis, with the specific effect varying depending on cell type and stress environment.

In a comprehensive investigation of rats, cadmium exposure resulted in a considerable increase in lipid peroxidation (LPO), indicating oxidative damage within neural tissues. Cadmium exposure was also linked to higher serum urea and blood urea nitrogen levels, which are signs of renal impairment (poli et al., 2022).

The molecular mechanism of toxicity in Cd2+ is mainly due to in vivo Apoptosis. Cadmium is characterized by extended biological half-life in humans due to the inability of the body to remove it effectively (Tzirogiannis et al., 2003). Persistent exposure to it is the main cause of Cd’s acute and chronic toxicity (Kasuya et al., 2000; Genchi et al., 2020).

Bee venom, also known as Apitoxin (Apitox®). It has been utilized for the treatment of many diseases Multiple sclerosis (MS), Parkinson’s disease (PD), rheumatoid arthritis (RA), liver fibrosis (LF), multiple sclerosis (MS), inflammatory disorders, and neurodegenerative diseases (Lee et al., 2005). Bee venom contains biogenic amines, polypeptides, and enzymes, primarily phospholipase A2 (PLA2), hyaluronidase, acid phosphatase, lipids like mast cell degranulation peptide, basic peptides, and non-enzymatic proteins (primarily melittin and apamin), histamine, bioactive amines, and non-peptide substances like glucose and fructose (Dennis et al., 2011). Bee venom reduces the quantity of free radical species (ROS) that cause oxidative damage.

Melittin is the main component of Bee Venom, accounting for 60% of its composition. It activates PAL2 and produces anti-inflammatory and anti-arthritic effects. Apamin is the smallest neurotoxin. It crosses the blood-brain barrier and blocks the calcium potassium channel. Melittin inhibit inflammatory cytokines like interleukin-6 (IL-6), IL-8, tumor necrosis factor-α (TNF-α), and interferon-γ (IFN-γ). Moreover, melittin decreases signaling pathways that activate inflammatory cytokines, including nuclear factor-kappa B (NF-κB) (Wehbe et al., 2019).

Alanine and aspartate transaminases ALT and AST, and their changes have been used as tools to investigate differences in liver cell viability and cell membrane permeability because of cadmium toxicity. High levels of ALT and AST are the most important markers for liver damage. In addition, the significant decline in GSH levels in cadmium toxicity was previously recorded which may be explained by cadmium’s strong affinity for the thiol group of GSH. Cadmium-induced oxidative stress is caused by liver inflammation. One major source of inflammation is Cd-induced inflammatory mediators like IL-1β, TNF-α, IL-6, and IL-8 due to the activation of Kupffer cells (Yamano et al., 2000). Cadmium exposure upregulates proinflammatory gene expression, including interleukin-1, interleukin-6, tumor necrosis factor-α, and interferon-γ, while downregulating anti-inflammatory cytokine IL-10 in rat testes (Sivaprakasam and Nachiappan, 2016). Contrarily Kim et al., (2010) suggest that Bee venom possesses anti-fibrogenic properties that are mediated by the suppression of pro-inflammatory cytokines and fibrogenic gene expression like IL-1beta and TNF-alpha.

Excessive cadmium-induced renal damage primarily affects the proximal tubules, interfering with the tubular cells’ cellular and functional integrity, which is the main sites where the metal accumulates in the renal cells (Bernard, 2008) and also a significant increase in plasma urea and creatinine in cadmium intoxication (Ibrahim et al., 2018).

The study aims to investigate the role of Bee venom therapy in the protection of rats against cadmium toxicity regarding the biochemical parameters of the liver and kidney in addition to confirming the effect of bee venom as a protective tool against cadmium toxicity by confirming the downregulation of an inflammatory gene during cadmium administration and in case of Cd2+ and bee venom administration.

MATERIAL AND METHODS

Animals

Forty healthy albino rats, weighing 150 – 250g, were used in this study which were obtained from the Laboratory Animal House at the Faculty of Veterinary Medicine Suez Canal University, Ismailia, Egypt. They were maintained under standard laboratory animal housing conditions and fed a standard diet and water ad libitum. All animals, including the control and experimental groups, were housed under identical environmental conditions throughout the study. These conditions included consistent temperature, humidity, a light/dark cycle, and free access to food and water. The only difference between the groups was the treatment administered; the experimental groups received bee venom and/or cadmium, and the control group received no treatment. All the humanity and ethical respects, in addition to the animal’s euthanasia, were taken into consideration and performed.

Chemicals

Bee venom (Apis mellifera) which was purchased in crude form from (The Department of Bee Research, Plant Protection Institute, Agriculture Research Centre in Dokki, Giza governorate, Egypt), kept desiccated at 4 ◦C and reconstructed for use with sterile saline The bee venom (BV) inintraperitoneally injected with Bee venom at a dose of 2mg/kg BW according to (Hassan et al., 2019). Cadmium chloride (cdcl2) was purchased from LOBAL Chemie (LABORATORY REAGENTS AND FINE CHEMICALS) UN No.2570, CAS No. 35668-66-2 was dissolved in distilled water to a 5 mg/ml concentration. according to (Ojo et al., 2023) and Renugadevi and Prabu (2010).

Experimental Design and Treatments

After an acclimation period of 2 weeks, the rats were randomly grouped into 4 groups (n = 10): 1st group:( Control negative, (c)). 2nd group: (The bee venom (BV) intraperitoneal injected with Bee venom at a dose of 2mg/kg BW.3rd group: the Cd-treated group, was orally gavaged with cdcl2 at a dose of 5mg/kg, Cdcl2. 4th group: Cdcl2/Bee venom group(both)(B), orally dosed cdcl2 followed by Bee venom by the same doses and routes as in groups 3 and 2). The exposure was daily for six weeks.

Blood samples

The first blood sample was collected after the third week, and the second blood sample at the end of the sixth week of the experiment. The rats were weighed and then fasted 12-14 hours before sample collection, Blood was collected using the retro-orbital method. For biochemical assessments. (the blood was further centrifuged at a speed of 3,000 rpm for 10 minutes). The clear serum was collected using a clean dropper in sterilized tubes, properly labeled, and then frozen at -20°C until the biochemical analysis of serum AST, ALT “IFCC Method for Alanine Aminotransferase,” (Bergmeyer et al., 1986). IL-1β according to Durum et al. (1985), TNF-α described by Beutler et al. (1985), IL-10 described by Fichtlscherer et al. (2004), GSH described by Baker et al. (1990), SOD described by Nishikimi et al. (1972) with few modifications, MDA according to Botsoglou et al., (1994)., serum creatinine and urea by the methods of Ilstrup et al. (1985) and Bartels et al. (1972).

Tissue Samples

At the end of the experimental period (after 6 weeks), rats from the control and dosed groups were deeply anesthetized by diethyl ether then tissues were dissected, the selected organs (brain, liver, and kidney) were dissected out and washed several times in saline (0.9% NaCl). The liver from all rats was divided into 2 groups, a formalized group for histopathological examination and the other group kept frozen for molecular examination.

The kidney from all rats was kept formalized for the histopathological examination while the brain from all rats was kept preserved in a Bouin’s solution for histopathological examination.

The liver and kidney of the control and all treated animals were collected and harvested in 10% neutral buffered formalin, meanwhile, cerebral, and cerebellar tissue specimens were sliced and fixed in Bouin’s solution. After proper fixation, all tissue samples were dehydrated in ascending grades of alcohol, cleared in 3 changes of xylene, and then embedded into paraffin at 60 °C. The paraffin blocks were prepared and 5-7 µm thick tissue sections were obtained and placed onto glass slides. The tissue slices were then deparaffinized and stained with hematoxylin and eosin according to the method adopted by Bancroft et al. (2013).

The obtained histological sections were viewed, and photomicrographs were captured and collected using an OLYMPUS BX43 research optical microscope equipped with an OLYMPUS SC100 digital camera. The magnification scale bar was reported on the collected photomicrographs.

Lesion Scoring Evaluation

To assess morphological damage to the liver after treatment with Cd and Bee Venom: pyknotic nuclei, Kupffer cell hyperplasia, Congestion of the central vein, and Mononuclear cell infiltration.

The Histopathological scoring of kidney lesions sections was carried out to assess morphological damage to the kidney in the cortex and medulla after treatment with Cadmium and Bee Venom: Congestion of the inter-tubular capillaries, glomerular and tubular degeneration as glomeruli shrinkage, necrosis of tubules, and presence of inflammatory cells.

To assess morphological damage to the brain after treatment with Cadmium and Bee Venom: Congestion of blood vessels, degenerated neurons(chromatolysis), intracellular vacuoles in Purkinje cell, and vacuolar space around pyramidal cells.

These measures were evaluated on a scale from 0 to 4, which ranged from not present (0) to mild (1), moderate (2), severe (3), and very severe (4).

Real-Time Quantitative PCR (RT-qPCR) for Analysis of Gene Expression

RNA extraction: Total cellular RNA was extracted from fresh and frozen tissues by RNeasy Mini Kit (50 RNeasy Mini Spin Columns, (Qiagen, USA.). cat. no.74104 following the manufacturer’s instruction. Reverse transcription of total RNA (1μg) into cDNA was carried out using the HiSenSc2.4. sript™ RH (−) cDNA Synthesis Kit (iNtRON Biotechnology Co., South Korea).

Real-Time Polymerase Chain Reaction (qPCR)

We used (glyceraldehyde-3-phosphate dehydrogenase, GAPDH) as the housekeeping gene for normalization, ensuring consistent and reliable comparison of gene expression levels across samples. The PCR primers for the genes used in this method are listed in (Table 1).

 

Table 1: F forward primer, R reverse primer Gene Primers for quantitative real-time PCR.

Gene	Primer sequence (5′–3′)
GAPDH	F: CCCCCAATGTATCCGTTGTG
	R: TAGCCCAGGATGCCCTTTAGT
IL-1β	F: GGAAGGCAGTGTCACTCATTGTG
	R: GGTCCTCATCCTGGAAGCTCC
TNF-α	F: AGCCCTGGTATGAGCCCATGTA
	R: CCGGACTCCGTGATGTCTAAGT
NF-ĸΒ	F: AGCACCAAGACCGAAGCAA
	R: TCTCCCGTAACCGCGTAGTC
Bax	F: CCAGGACGCATCCACCAAGAAG
	R: CCCAGTTGAAGTTGCCGTCTGC

 

The HERA SYBR® Green qPCR master mix is a ready-to-use real-time PCR kit optimized for the real-time quantification of target DNA. intercalating dye, which binds to double-stranded DNA and releases fluorescence during each reaction cycle, allowing for the genotype of the sample to be quantified. The PCR cycling conditions included an initial denaturation at 95°C for 15 min followed by 40 cycles of denaturation at 95°C for 30s, annealing at 60°C for 60s, and extension at 72°C for 60s. After obtaining the Ct values using the 2−ΔΔCt method for the reference gene GAPDH, the expression level of the target genes was normalized to that of GAPDH. The relative fold changes in the gene expression were estimated based on the comparative 2− ΔΔCT (Ct: cycle threshold) method with the GAPDH gene as an internal control to normalize target gene expression levels. All mixed reagents in a nuclease-free Eppendorf. Reagents required per sample HERA SYBR® Green Master Mix (2x) 10μl, Forward primers 20x (200nM) 1μl (up to 1μM each), Reverse primers 20x (200nM) 1μl (up to 1μM each), Nuclease free water To 20μl DNA template (up to 250ng) Volume varies.

Statistical Analysis

Results were expressed as the mean ±standard error (Mean ±SE). Statistical analysis was done using the one-way analysis of variance (ANOVA) followed by the post-hoc Tukey’s test. All statistics were carried out using SPSS. In this study, p values <0.05 were considered statistically significant.

RESULTS AND DISCUSSION

Serum Biochemical Assessments, Liver Function Tests

Effects of cadmium chloride and bee venom on serum (ALT and AST) levels in rats: ALT and AST measurements tabulated in Table 2 and graphically represented by Figure 1 panel A, it was denoted that a significant increase in the level of ALT, AST (p< 0.05) was recorded in Cadmium chloride treated rats (group 3) after the end of the third week and the end of the experimental period compared with the negative control group (group 1). Bee Venom-treated rats (group 2) showed no significance in the level of ALT, and AST compared to the negative control group (group 1). In contrast, the administration of cadmium chloride and Bee venom group (group 4) showed a significant decrease compared to the cadmium chloride group (group 3).

Elevated serum hepatic marker enzyme levels, which signify cellular leakage and a loss of functional integrity of the hepatic membrane architecture, are a reliable indicator of

 

Table 2: Effect of Bee venom and Cadmium chloride treatment in the activity of ALT and AST (U/L) in the serum of rats at the end of the third week and the end of the experiment.

	1st group (c)		2nd group (Bee venom)		3rd group (Cd)		(Both) cd +Bee venom
	21 days	45 days	21 days	45 days	21 days	45 days	21 days	45 days
ALT	24.68 ±0.2658	24.7±0.2309	24.33 ±0.2136	23.77 ±0.318	55.85 ±1.498	69.97 ±1.312 183.3% increase	34.35 ±0.9887	42.9 ± 0.7506 38.6% decrease
AST	91.08± 0.5573	91.7± 0.7371	90.15± 0.7354	90.3± 1.026	187.3± 1.526	237.4 ±2.352 160.6% increase	138.6 ±1.127	171.8 ±1.903 27.6% decrease

 

Values are expressed as Mean ± (SE), (n= 10/group). using the post hoc Tukey’s test, one-way ANOVA. (1st group: (control negative group),2nd group: (bee venom group),3rd group: (Cd-treated group),4th group: (cdcl2/BV group). Different small superscript letters indicate significance in the same row (p<0.05);NB: percentage change calculated in cadmium group compared to the control group; Percentage change/improvement of bee venom as a treatment calculated compared both group to the cadmium group.

liver injury following Cd exposure. ALT, AST, and other liver enzymes are important indicators of biliary function and liver cell damage that are measured in liver function tests. It is essential to comprehend these enzymes to diagnose liver disorders and track the effectiveness of treatment (Lala et al , ٢٠٢٤).

 

 

It correlates with the present study which revealed the increased AST and ALT activities in the serum of Cd-treated rats. These enzymes’ activities are key enzymes involved in liver function, and their elevation can indicate liver damage or diseases such as liver inflammation, fatty liver disease, cirrhosis, and liver tumors (Vagvala and O’Connor, 2018).

The most important markers for liver damage detection are high levels of alanine and aspartate transaminases (Williamson et al., 1996).

It correlates with the present study which revealed the increased AST and ALT activities in the serum of Cd-treated rats. These enzymes’ activities are liver-specific, and their changes have been used as a tool to investigate differences in cell viability and cell membrane permeability (Dasgupta et al., 1996).

In our study administration of bee venom (2 mg/kg) attenuated cadmium-induced hepatotoxicity as shown by the decreased levels of AST and ALT thus offering protection against Cd toxicity in rats. The above effects indicate that bee venom may offer protection by stabilizing the cell membrane in cadmium-induced hepatic damage. Consistent with the study of (Kim et al, 2010), studied the anti-fibrosis effects of Bee venom in mouse models of hepatic fibrosis induced by carbon tetrachloride (CCl4) and ethanol-treated hepatocytes (ETH). By suppressing pro-inflammatory cytokines (TNF-α, IL-1β) and fibrogenic genes (TGF-β1, smooth muscle actin, and fibronectin), they discovered that Bee venom significantly inhibited the serum levels of aspartate aminotransferase (AST) and alanine aminotransferase (ALT). also, the study of (Abdulmalek et al., 2022) suggests that supplementation of targeted bee venom-CSNPs resulted in a greater reduction in ALT and AST levels than untreated mice, finally with Aspartate transaminase (AST) and alanine transaminase (ALT) levels show that Bee venom improved the restoration of liver functions (Aly et al., 2023).

Serum Oxidative / Anti-oxidative Status

Serum reduced glutathione (GSH), superoxide dismutase (SOD) levels, and malondialdehyde (MDA) levels: To explain the toxicity of cadmium on organs, several mechanisms have been suggested, the most common is the oxidative damage caused by cadmium through increasing membrane lipid peroxidation, a harmful process only accomplished by free radicals (Agmon et al. 2018). Through a number of mechanisms, cadmium (Cd) exposure amplifies oxidative stress and cellular damage by activating NADPH oxidase. Because NADPH oxidase is essential for ROS overproduction, cadmium exposure causes an imbalance between the production of reactive oxygen species (ROS) and antioxidant defenses (Qu and Zheng, 2024; Singh et al., 2024). 

The significant decline in GSH levels may be explained by cadmium’s strong affinity for the thiol group of GSH, which it oxidizes to GSSG (El-Habit and Abdel Moneim 2014; Espinosa-Diez et al., 2015). In the present study, the decreased levels of GSH in Cd toxicity might increase the susceptibility of the liver to free radical damage. Our findings agree with the other published reports which quoted that GSH concentration is decreased during Cd intoxication (Pari and Muruga-vel, 2005). In the present study administration of bee venom (2 mg/kg) attenuated cadmium-induced hepatotoxicity as shown by the increasing level of GSH thus offering protection against Cd toxicity in rats (Table 3).

 

Table 3: GSH, SOD, and MDA Levels at the end of the third week and the end of the experiment.

	1st group (c)		2nd group (Bee venom)		3rd group (Cd)		(Both) cd +Bee venom
	21 days	45 days	21 days	45 days	21 days	45 days	21 days	45 days
GSH	11.01± 0.0713	10.68± 0.062	11.47± 0.188	11.01± 0.179	6.814± 0.0481	8.642± 0.103 8.6% decrease	8.948±0.0293	11.49±0.264 32.95%increase
SOD	4.616± 0.0089	4.537± 0.025	4.795± 0.0378	4.878± 0.0209	3.029± 0.036	2.652± 0.047 41.5% decrease	4.016±0.065	3.713±0.077 40% Increase
MDA	1.175 ±0.012	1.181 ±0.008	1.119 ±0.0117	1.12 ±0.0149	2.298 ±0.0729	2.841± 0.075 140.5% increase	1.637 ±0.0475	1.795±0.061 36.8%decrease

 

Table 4: Effects of cadmium chloride and bee venom on Serum (IL-1β),(TNF-α), and (IL-10) Levels at the end of the third week and the end of the experiment.

	1st group (c)		2nd group (Bee venom)		3rd group (Cd)		(Both) cd +Bee venom
	21 days	45 days	21 days	45 days	21 days	45 days	21 days	45 days
(IL-1β)	3.928± 0.0472	4.037± 0.051	3.853± 0.0253	3.877± 0.0555	8.71± 0.133	10.93±0.477 170.7% increase	5.663±0.117	6.41±0.2542 41.4% decrease
(TNF-α)	5.603± 0.0335	5.67± 0.0551	5.548± 0.0149	5.42± 0.03215	13.05± 0.278	20.66±0.264 264.3%increase	8.525±0.0595	10.55±0.407 49%decrease
IL-10	68.51± 0.361	67.55± 0.413	69.49± 0.394	66.29± 0.329	44.24 ±0.587	39.86±0.676 41%decrease	57.54±0.479	69.37±0.533 74%increase

 

The impairment of the antioxidant defense system is considered a critical event in cadmium-induced hepatotoxicity as we found that GSH and SOD are significantly decreased, MDA is significantly increased in the serum of Cd-treated rats, consistent with previous studies that find A metalloprotein called SOD catalyzes superoxide radical dismutation (McCord et al., 1976), The substrate is oxidized when lipid hydroperoxides, hydroxyl radicals, and MDA produced during metal intoxication react with other lipids, proteins, and nucleic acids. They might have a role in genotoxic, carcinogenic, and mutagenic effects (Kaplan et al., 2011). This genotoxic effect resulting from increased MDA levels due to oxidative stress can lead to the activation of the NF-Kb signaling pathway, this activation also influences apoptosis by upregulation of the pro-apoptotic gene expression BAX showed in the liver cadmium-administrated group. It was discovered that Bee venom acupuncture reduces the quantity of free radical species (ROS) that cause oxidative damage to synovial fluid proteins (Suh et al., 2006).

which agrees with the current results. Parallel to many studies, there was a significant increase in GSH levels in the bee Venom low dose treated group compared to the diabetic group. These studies suggested many mechanisms, like the antioxidant activity of Bee venom (Gawad et al., 2016), Research has documented the antioxidative properties of PLA2 (Snyder et al., 1985) and Bee venom samples from the USA (Rekka et al., 1990) and Korea (Han et al., 2010).

Regarding the antioxidant effects of Bee venom samples, they have been related to the capacity to inhibit the lipid peroxidation process (Rekka et al., 1990) and to increase superoxide dismutase (SOD) activity (Han et al., 2010). These studies are parallel to the results of this study as the antioxidant effect of bee venom showed in the cd-bee venom group and Bee venom group as GSH and SOD are increased but MDA is decreased in contrast with the cd-treated group.

Serum Pro-inflammatory Cytokines

Effects of cadmium chloride and bee venom on (Serum Interleukin-1Beta (IL-1β) Levels, Serum Tumor Necrosis Factor-Alpha (TNF-α) Levels, and Serum Interleukin-10 (IL-10) Levels at the end of the third week and the end of the experiment.

Another significant mechanism for Cd-induced oxidative stress is inflammation in the liver (Kayama et al., 1995; Yamano et al., 2000). One major source of Cd-induced inflammatory mediators like IL-1β, TNF-α, IL-6, and IL-8 is the activation of Kupffer cells, which are the resident macrophages of the liver (Kayama et al., 1995; Yamano et al., 2000). Additionally, small quantities of Cd-MT complexes bound to thiol-containing substances (such as GSH, L-cysteine, L-homocysteine, and N-acetyl-L-cysteine) in plasma are transported to the kidneys. They can be absorbed through the renal proximal tubule cells (Yang and Shu, 2015). The findings of these studies are parallel to our results which showed that the cd-treated group has a highly significant increase in IL-1beta and TNF-alpha with a significant decrease in IL-10 (Table 4).

In this study Table 4, the bee venom group and the cd-Bee venom group showed the anti-inflammatory effect of bee venom parallel with previous studies say that bee venom (BV) exhibits significant anti-inflammatory effects, primarily through its active components that modulate immune responses and inhibit inflammatory mediators. Studies have shown that BV can scavenge free radicals and inhibit protein denaturation, which are crucial in mitigating inflammation (Florescu et al., 2024). Furthermore, BV has been shown to decrease the release of pro-inflammatory cytokines like TNF-α and IL-1β in a variety of cell models, suggesting that it may be used to treat inflammatory illnesses (Yun et al., 2021; Chung et al., 2016).The ability of bee venom constituents to decrease pro-inflammatory cytokines, such as tumor necrosis factor (TNF-α) and interleukins (IL-1β, or IL-6), as well as other inflammatory mediators, such as prostaglandin E2 (PGE2) and nitric oxide (NO), which are produced by cyclooxygenase (COX) and inducible nitric oxide synthase (iNOS), respectively, The production of these mediators have been demonstrated in several inflammatory tissues involved in the pathogenesis of several diseases, such as atherosclerosis, obesity, metabolic syndrome, diabetes, and several types of cancer. is demonstrated. (Nam et al., 2003, Jang et al., 2005, Janik et al., 2007, Karimzadeh et al., 2013, Mohammadi et al., 2015).

In vivo, experiments with Lewis rats also support the anti-inflammatory effects of Bee venom samples (Chang and Bliven, 1979; Amin and Abdel-Raheem, 2014).

Numerous mechanisms for the anti-inflammatory and/or anti-arthritis effects of Bee venom and its constituents have been reported in recent studies. The anti-arthritis effect of melittin is suggested to be related to the decrease in phospholipase (PL) A2, cyclooxygenase (COX)-2, and tumor necrosis factor-alpha (TNF-α), interleukin (IL)-1, IL-6, nitric oxide (NO), and oxygen reactive species (ROS) levels (Pelletier et al., 1998; Yang et al., 1999; Amin et al., 1999; Cernanec et al., 2002; Murakami et al., 2017).

Real-time quantitative PCR (RT-qPCR) Results

Table 5 Effects of treatments on liver TNF-α, IL-1β, and NF-Kb Gene expression and Effects of treatments in apoptosis in rat’s liver Bax. We used quantitative real-time PCR to determine changes in the mRNA levels of inflammatory genes (IL-1B - TNF-α- NK-Kb) and pro-apoptotic Bax genes. Bee venom slightly reduces mRNA level in IL-1B levels, while the toxic substance (cd) does not significantly alter IL-1B expression. However, the combination of bee venom and cd shows a more substantial reduction. Regarding TNF-α, Bee venom significantly reduces TNF-α levels. Conversely, cd increases TNF-α expression. Interestingly, the combination of bee venom and cd results in a marked increase in TNF-α. For NK-Kb, Bee venom dramatically reduces NF-Kb levels, nevertheless Cd significantly increases NF-Kb expression. However, when combined, bee venom appears to counteract the increase induced by cd, though not to the same extent as when used alone. Finally, Bee venom slightly increases Bax levels. Cd, on the other hand, causes a massive increase in Bax, The combination of both reduces Bax levels compared to cd alone but remains significantly elevated.

 

Table 5: Effects of treatments on liver TNF-α, IL-1β and NF-Kb Gene expression and Effects of treatments in apoptosis in rat’s liver Bax.

Groups	IL-1β	TNF-α	NF-Kb	Bax
1st group(c)	1	1	1	1
2nd group (Bee venom)	0.93	0.79	0.22	1.24
3rd group (Cd)	1.01(1%)	1.09(9%)	3.86(286%)	40.57(3957%)
4thgroup (Both) cd+Bee venom	0.85 15% reduction	1.37 37% increase	0.81 19% reduction	11.74 1074% increase

 

Liver Histopathology

Cadmium is known to affect hepatocytic injuries directly, endothelial cell lining damage is also likely to be the cause in an in vivo system. According to Ince et al. (2016), damaged endothelial lining disrupts microcirculation, obstructing the liver cells’ blood supply and resulting in hemorrhage, vacuolization, and sinusoidal widening in the surrounding area, or Stage I and II alterations. In the current investigation, the liver of rats treated with cadmium had different histological characteristics from those of the control group. The main alterations were disorganization of the hepatocytes’ architecture with marked affection of the hepatocytes. Moreover, borderlines between the hepatocytes were destroyed, and irregular shapes and atypical positions within the hepatic tissue were observed. Some of these cells were hypertrophied and showed extensive cytoplasmic vacuolation and pyknotic nuclei of some hepatocytes were seen. In addition, the central veins and hepatic sinusoids appeared dilated and congested with areas of mononuclear cell infiltration. The sinusoidal Kupffer cells became prominent and increased in number (Figure 2C).

It could be brought on by Cd-induced lipid peroxidation and the subsequent production of extremely reactive radicals, the underlying cause of hepatocellular damage. The necrotic conditions match our biochemical findings, indicating a higher degree of lipid peroxidation.

Similarly to the control group, the hepatic sections of rats of the Bee venom group revealed normal microanatomy with slightly dilated hepatic sinusoids (Figue 2B). The liver of Cd + Bee venom-treated rats restored normal hepatic architecture that exhibited hepatocytic improvement with mild congestion of central veins and hepatic sinusoids (Figure 2D). According to new research, Bee venom prevents liver damage both in vivo and in vitro by acting as an anti-inflammatory and anti-apoptotic agent (Lee et al., 2015). The hepatic cells treated with Bee venom showed promise for improvement, as evidenced by the current microscopic examination. Matched with previous research showed that The Kupffer cell had a nearly normal nucleus, and the mitochondria and glycogen were normal. Melittin from Bee venom was found to protect against severe failure of hepatocyte functions by reducing hepatic inflammatory reactions, lowering the high rate of lethality, and inhibiting hepatocyte apoptosis. This alleviated hepatic pathological injury (Lee and Bae, 2016; Aly et al., 2023).

 

NF-kB signaling pathway is the most important pathway which is involved in liver inflammation. Indeed, NF-kB activation is connected to hepatocyte injury and liver fibrosis.

It was demonstrated that the administration of rat cadmium resulted in significant hepatotoxicity through the overproduction of several inflammatory mediators, including IL-6, NF-kB, and TNF-ɑ (Lee et al., 2011).

Numerous research works have documented the in vivo and in vitro properties of Bee venom, including its anti-mutagenic, anti-inflammatory, anti-nociceptive, and radioprotective properties. It is shown that bee venom can protect Wistar rat lymphocytes from oxidative and basal DNA damage through radio-protective effect It does not cause oxidative damage at low concentrations and is not genotoxic (Gajski and Garaj-Vrhovac, 2009).

The hepatoprotective activity of Bee venom may have been attributed to its anti-inflammatory properties in addition to its antioxidant activity. Much evidence has documented that Bee venom modulated tissue inflammation in various experimental models. Also, recent research revealed that melittin inhibits IκB phosphorylation, which in turn inhibits the DNA-binding activity of NF-κB, a crucial transcriptional factor controlling the expression of inflammatory genes (Park et al., 2004, 2007).

The present study found that concurrent treatment with Bee venom had significantly decreased the serum IL-1β, IL-10, TNF- α, ALT, and AST levels, indicating the hepato-protective effect of Bee venom, which might be explained by the reduction of NF-kB expression in the liver of bee venom administrated group and the 3rd group that administrated both cadmium and bee venom compared to the cadmium administrated group that has high significant elevation of NF-kB expression Figure 3. This was further confirmed by histological examination of the liver Figure 2. These results are consistent with other studies that showed the potent hepato-protective effect of Bee venom by inhibiting the secretion of pro-inflammatory cytokines, such as TNF-a, and decreasing the elevated serum amino-transferase enzymes (Park et al., 2010; Kim et al., 2010).

 

 

By inducing IL-1β and TNF-ɑ overproduction, excessive ROS generation can activate the canonical pathway of NF-kB (Song et al., 2018). Cadmium exposure upregulates proinflammatory gene expression, including interleukin-1, interleukin-6, tumor necrosis factor-α, and interferon-γ, while downregulating anti-inflammatory cytokine IL-10 in rat testes (Sivaprakasam and Nachiappan, 2016). which is consistent with this study showing upregulation of both IL- 1β and TNF-α gene expression in cadmium administered group.

Kim et al., 2010 suggest that Bee venom possesses anti-fibrogenic properties that are mediated by the suppression of pro-inflammatory cytokines and fibrogenic gene expression like IL-1beta and TNF-alpha. which is consistent with this study showing down-regulation of both IL- 1β and TNF-α gene expression in Bee venom administered group.

In this study, we demonstrated that cadmium significantly increases the expression of the pro-apoptotic Bax gene in the liver. Mitochondria play a crucial role in regulating the intrinsic pathway of apoptosis, with Bax protein being a key regulator of this process. Excessive cadmium exposure in mitochondria triggers Bax activation. Bax interacts with components of the mitochondrial permeability transition pore (MPTP), causing the pores to open and allowing the release of cytochrome C (Cyt C) into the cytoplasm. This release ultimately activates caspase-3, leading to cell death. This is following prior studies that showed modulation of the same gene in apoptosis. (Alian, et al., 2018; Ghajari et al., 2019; Arab-Nozari et al., 2020; Mahdavi et al., 2018). Cadmium exposure has been shown to significantly impact BAX gene expression in various tissues.

Results showed that Bax expression was downregulated in the group administered bee venom with cadmium chloride compared to animals exposed to Cadmium only. Interestingly, bee venom administration suppressed apoptosis in the liver tissues of rats via down-regulating pro-apoptotic Bax. These findings were consistent with the data from (Park et al., 2012), which showed that in animals with GalN/LPS-induced acute hepatic failure, melittin (0.1 mg/kg) prevented acute hepatic failure by blocking NF-κB activation, caspase and Bax protein expression levels, and cytochrome c release.

The protective effect of bee venom from a molecular view mentioned by previous studiesThe principal BVT mechanisms. By controlling microglia activity, NF-κB transcription, the MAPK pathway, and the LC-descending coerulospinal pathway, BVT may have an anti-inflammatory effect. BVT reduces pro-apoptotic Bax and caspase-3 activity and increases apoptotic Bcl-2 expression to modify mitochondrial function. BVT may shield hepatocytes from harm in liver fibrosis by inhibiting pro-inflammatory cytokines, pro-apoptotic genes, and the fibrogenic gene. Blood vessel lipoid deposition is inhibited by BVT in the circulatory system through the suppression of pro-inflammatory cytokines, adhesion cytokines, anti-apoptosis genes, and fibrogenic genes like TGF-β. Additionally, in mice with atherosclerosis, BVT inhibits the migration and proliferation of vascular smooth muscle cells (VSMC) through the Akt pathway. (Zhang et al., 2018). Furthermore, it has been demonstrated that PLA2, a major component of bee venom, inhibits inflammatory reactions, protects against cisplatin-induced acute kidney injury (AKI), and regulates the expression of interleukin (IL)-10 and Tregs by binding to CD206 (Kim et al., 2015, Deng et al., 2001; Sinuani et al., 2013).

Park et al. (2014) showed that melittin prevented DNA damage to hepatocytes by preventing the activation of caspase, the bcl-2 family of proteins, and poly ADP-ribose polymerase (PARP)-1 via the NF-κB pathway. By suppressing p38/JNK and NF-B expression, bee venom successfully reduced PMA-induced MMP-9 gene expression, reducing MCF-7 cell invasion and migration (Cho et al., 2010).

Kidney Function Evaluation

An increasing amount of research has demonstrated that apoptosis plays a significant role in Cd-induced nephrotoxicity (Fujiwara et al., 2012; Erboga et al., 2016; Almeer et al., 2019; Zhuang et al., 2019). Significant renal damage was caused by cadmium exposure, as evidenced by decreased body and kidney weights, elevated serum BUN, and creatinine levels, histopathological lesions, inflammatory markers, and oxidative stress in the kidney. These results showed a significant increase in serum urea and creatinine in the Cd-administrated group compared with the Bee Venom-Cd group (Figure 4) The kidneys are a target organ for Cd toxicity, and the renal dysfunction seen in this study may be caused by exposure to the metal during normal excretion (Ibrahim et al., 2018). parallel with previous studies that suggest a protective effect of bee venom on kidney function (Kim et al., 2020) that showed Melittin inhibited creatinine excretion and BUN. According to Clark, (1999), the current study discovered that after bee venom treatment, uric acid increased and kidney function, including urea and creatinine, decreased (Figure 4).

 

In contrast to previous reports, our study found that exposure to Cd resulted in tissue damage not only in the renal cortex but also in the renal medulla. (Figure 5) This was evidenced by pyknotic nuclei in the epithelial cells of collecting ducts and clear hyperemia in the renal medulla. Furthermore, it was discovered by (Nazima et al., 2015) that glomerular atrophy, renal capsule dilatation, tubular degeneration, and necrosis were altered in albino Wistar rats that were given intragastric administration of CdCl2 (5 mg/kg) for four weeks. according to Imed et al. (2008) Observing that the reports of Cd-induced alterations in renal histopathology varied, it is possible that variations in Cd exposure occurred due to variations in exposure time, dosage, route, and animal strain. In our study, rats in the Bee venom- Cd administrated group showed significantly lesser histological damage in the kidney than the Cd administrated group. Furthermore, bee venom reduced cadmium-induced renal tissue damage in a dose-dependent manner. Consistent with previous studies that suggest Melittin prevented renal tubular damage in mice that was caused by cisplatin (Kim et al., 2020). These findings imply that bee venom protects against functional and structural damage caused by lipopolysaccharide (LPS) using renoprotection (Kim et al., 2020) additionally, it was reported that the administration of bee venom improved the renal damage caused by unilateral ureteral obstruction in terms of both structure and function (An et al., 2015). According to Hyunseong et al. (2013), Bee venom can prevent renal tubular injury (epithelial necrosis) Table 6.

 

Table 6: Effect of Bee venom and Cadmium chloride treatment in the activity of urea and Cr (mg/dl) in the serum of rats at the end of the experiment.

	Urea	Creatinine
1st group(c)	18.53±0.4256	0.4133±0.01202
2nd group (Bee venom)	18±0.3606	0.3967±0.008819
3rd group (Cd)	32.13±0.9939 73.4%increase	0.4833±0.003333 16.9 % increase
4th group (Both) cd +Bee venom	25.17±1.049 21.7% decrease	0.45±0.005774 7.8% decrease

 

The obtained results of the brain histological lesions in the Cd-treated group cerebrum revealed pronounced congestion in both cortical blood vessels and pia mater. Moreover, pronounced degenerated neurons with pyknotic nuclei, and vacuolar spaces around the pyramidal cells were noted. The pyramidal cells were more affected than the cerebellar blood capillaries and also showed marked congestion, in addition to degenerated and shrunken Purkinje cells with the appearance of intracellular vacuoles. Most Purkinje cells have irregular outlines with deep homogenous cytoplasm with the absence of Nissl granules and darkly stained pyknotic nuclei (Figure 6). parallel with previous studies Concerning the cadmium-induced pathological lesions observed, in the cerebellum, medulla oblongata, and cerebrum, chromatolysis, pyknosis, and neuronal degeneration have all happened by cadmium treatment (Maodaa et al., 2016).

Interestingly, the Cd + Bee venom-treated group showed a marked improvement in the histological structures of cerebral and cerebellar cortical tissues compared to that obtained from the Cd-treated group. Most cerebral and cerebellar neuronal cells had a similar appearance to the control group (Figure 6) and with the explanations According to Abd El-Hameed et al. (2021), Bee venom has a neuroprotective effect. Its anti-inflammatory and anti-apoptotic characteristics corroborate this in the experimental models’ hippocampal tissues (Lee and Bae, 2016). In male rats exposed to MMC sub-acute intoxication, Bee venom has an in vivo neuroprotective effect by modifying the MMC-induced neurobehavioral deviations, inflammation, oxidative stress, altered TJPs, and TGF-β gene relative mRNA expression at the BBB of the exposed rats (Abu-Zeid et al., 2021). According to the points mentioned before of the kidney and brain lesion evaluation, we suggest that the control negative group score is (0) no lesion present, the bee venom administrated group score is (0) no lesion present, the cadmium administered group score is (4) very severely affected tissue, finally the group administrated both bee venom and cadmium score is (1) mildly affected tissue.

 

CONCLUSIONS AND RECOMMENDATIONS

For the first time, Bee venom showed that has a beneficial effect against hepatotoxicity, nephrotoxicity, and neurotoxicity induced by Cd exposure. As a possible mechanism, Bee venom could ameliorate Cd hepatotoxicity, nephrotoxicity, and neurotoxicity owing to its antioxidant, anti-inflammatory, and antiapoptotic properties.

NOVELTY STATEMENT

This study provide novel insights into the combined effects of bee venom and cadmium on key biochemical ,oxidative ,and inflammatory markers in rats, focusing on the unique potential of BV to mitigate cad-induced toxicity ,while previous studies have examined the effects of either BV or Cd individually.

AUTHOR’S CONTRIBUTIONS

Prof. Rania Helmi Abdou and Prof. Kawthar Abdelwahed contributed to the experiment design and revision of the manuscript,Dr Mary Ayad sargious handled the molecular part of experiment (RT-PCR) and wrote it.Dr.Omnia Mohammed khattab contributed to manuscript`s writing,editing and revising. Dr. Mariam Ismail Ali contributed to the performing of the experiment ,writing ,editing,and revising the manuscript.

Conflict of Interest

All authors have no conflict of interest to disclose.

REFERENCE

Abd El-Hameed, A.M., Abuelsaad, A.S., and Khalil, A. Bee venom acupuncture therapy ameliorates neuroinflammatory alterations in a pilocarpine-induced epilepticus model. Metabolic Brain Disease, 2021; 36(7), 2047-2058. https://doi.org/10.1007/s11011-021-00766-9

Abdulmalek, S.A., Mostafa, N., Gomaa, M., El-Kersh, M.A., Elkady, A I., and Balbaa, M. Bee venom-loaded EGFR-targeting peptide-coupled chitosan nanoparticles for effective therapy of hepatocellular carcinoma by inhibiting EGFR-mediated MEK/ERK pathway. PLoS One, 2022; 17, 8: e0272776. https://doi.org/10.1371/journal.pone.0272776

Abu-Zeid, E.H., Khalifa, B.A., Elewa, Y.H., Arisha, A.H., Ismail, T.A., Hendam, BM., and El Abdel-Hamid, S.. Bee venom Apis mellifera lamarckii rescues blood brain barrier damage and neurobehavioral changes induced by methyl mercury via regulating tight junction proteins expression in rat cerebellum. Food and Chemical Toxicology, 2021; 154, 112309. https://doi.org/10.1016/j.fct.2021.112309

Agmon, E., Solon, J., Bassereau, P., and Stockwell, B.R. Modeling the effects of lipid peroxidation during ferroptosis on membrane properties. Scientific Reports, 2018; 8(1), 5155. https://doi.org/10.1038/s41598-018-23408-0

Alian, N.S., Khodarahmi, P., and Naseh, V. The effect of cadmium on apoptotic genes mRNA expression of Bax and Bcl-2 in small intestine of rats. Iranian Journal of Pathology, 2018; 13(4), 408.

Almeer, R.S., AlBasher, G.I., Alarifi, S., Alkahtani, S., Ali, D., and Abdel Moneim, A.E. Royal jelly attenuates cadmium-induced nephrotoxicity in male mice. Scientific Reports, 2019; 9(1), 5825. https://doi.org/10.1038/s41598-019-42368-7

Aly, E.K., Mahmoud, H.S., Alkhalifah, D.H.M., Shehab, G.M., Abuelsaad, A.S., Abdel-Rehiem, E. S. and Abdul-Hamid, M. Bee venom ameliorates oxidative stress and histopathological changes of hippocampus, liver and testis during status epileptics. Neuropeptides, 2023; 101, 102368. https://doi.org/10.1016/j.npep.2023.102368

Amin, A.R., Attur, M., and Abramson, S.B. Nitric oxide synthase and cyclooxygenases: distribution, regulation, and intervention in arthritis. Current Opinion in Rheumatology, 1999;11(3), 202-209. https://doi.org/10.1097/00002281-199905000-00009

Amin, M.A., and Abdel-Raheem, I.T. Accelerated wound healing and anti-inflammatory effects of physically cross linked polyvinyl alcohol–chitosan hydrogel containing honey bee venom in diabetic rats. Archives of Pharmacal Research, 2014; 37, 1016-1031. https://doi.org/10.1007/s12272-013-0308-y

An, H.J., Kim, K.H., Lee, W.R., Kim, J.Y., Lee, S.J., Pak, S.C. and Park, K.K. Anti-fibrotic effect of natural toxin bee venom on animal model of unilateral ureteral obstruction. Toxins, 2015; 7(6), 1917-1928. https://doi.org/10.3390/toxins7061917

Arab-Nozari, M., Ahangar, N., Mohammadi, E., Lorigooini, Z., Shokrzadeh, M., Amiri, F.T., and Shaki, F. Ginkgo biloba attenuated hepatotoxicity induced by combined exposure to cadmium and fluoride via modulating the redox imbalance, Bax/Bcl-2 and NF-kB signaling pathways in male rats. Molecular Biology Reports, 2020; 47, 6961-6972. https://doi.org/10.1007/s11033-020-05755-2

Baker, M.A., Cerniglia, G. J., and Zaman, A. Microtiter plate assay for the measurement of glutathione and glutathione disulfide in large numbers of biological samples. Analytical biochemistry, 1990;190(2), 360-365. https://doi.org/10.1016/0003-2697(90)90208-Q

Bancroft, J.D., Layton, C. and Suvarna, S.K. 2013: Bancroft’s Theory and Practice of Histological Techniques. Amsterdam, the Netherlands: Elsevier.

Bartels, H., Böhmer, M., and Heierli, C. Serum creatinine determination without protein precipitation. International Journal of Clinical Chemistry, 1972; 37, 193-197. https://doi.org/10.1016/0009-8981(72)90432-9

Bergmeyer, H. U., Hørder, M. and Rej, R.International Federation of Clinical Chemistry (IFCC) Scientific Committee, Analytical Section: approved recommendation (1985) on IFCC methods for the measurement of catalytic concentration of enzymes. Part 3. IFCC method for alanine aminotransferase (L-alanine: 2-oxoglutarate aminotransferase, EC 2.6.1.2). J Clin Chem Clin Biochem,1986; 24, 481-95.

Bernard, A. Cadmium and its adverse effects on human health. Indian journal of medical research, 2008;128(4), 557-564.

Beutler, B., Greenwald, D., Hulmes, J.D., Chang, M., Pan, Y.C., Mathison, J. and Cerami, A. Identity of tumour necrosis factor and the macrophage-secreted factor cachectin. Nature, 1985; 316: 552-554. https://doi.org/10.1038/316552a0

Botsoglou, N.A., Fletouris, D.J., Papageorgiou, G.E., Vassilopoulos, V. N., Mantis, A.J., and Trakatellis, A.G. Rapid, sensitive, and specific thiobarbituric acid method for measuring lipid peroxidation in animal tissue, food, and feedstuff samples. Journal of Agricultural and Food Chemistry, 1994 ; 42(9), 1931-1937. https://doi.org/10.1021/jf00045a019

Cernanec, J., Guilak, F., Weinberg, J. B., Pisetsky, D.S., and Fermor, B. Influence of hypoxia and reoxygenation on cytokine‐induced production of proinflammatory mediators in articular cartilage. Arthritis and Rheumatism: Official Journal of the American College of Rheumatology, 2002; 46(4), 968-975. https://doi.org/10.1002/art.10213

Chang, Y.H., and Bliven, M.L. Anti-arthritic effect of bee venom. Agents and actions, 1979; 9, 205-211. https://doi.org/10.1007/BF02024736

Cho, H.-J., Jeong, Y.-J., Park, K.-K., Park, Y.-Y., Chung, I.-K., Lee, K.-G., Yeo, J.-H., Han, S.-M., Bae, Y.-S. and Chang, Y.-C. Bee venom suppresses PMA-mediated MMP-9 gene activation via JNK/p38 and NF-κB-dependent mechanisms. Journal of ethnopharmacology, 2010;127, 662-668. https://doi.org/10.1016/j.jep.2009.12.007

Chung, H. J., Lee, J., Shin, J. S., Kim, M. R., Koh, W., Kim, M. J., ... and Ha, I. H. (2016). In vitro and in vivo anti-allergic and anti-inflammatory effects of eBV, a newly developed derivative of bee venom, through modulation of IRF3 signaling pathway in a carrageenan-induced edema model. Plos one, 11(12), e0168120. https://doi.org/10.1371/journal.pone.0168120

Clark, C.C. 1999:Encyclopedia of Complementary Health Practice P, Springer Publishing Company.

Dasgupta, S., Ghosh, S., & Das, K. K. Transaminase activities in some metabolically active tissues of nickel treated rats under protein restricted condition. Indian Journal of Physiology and Allied Sciences, 1996; 50, 27-33.

Deng, J., Kohda, Y., Chiao, H., Wang, Y., Hu, X., Hewitt, S. M., Miyaji, T., Mcleroy, P., Nibhanupudy, B. and Li, S. Interleukin-10 inhibits ischemic and cisplatin-induced acute renal injury. Kidney international,2001; 60, 2118-2128. https://doi.org/10.1046/j.1523-1755.2001.00043.x

Dennis, E. A., Cao, J., Hsu, Y. H., Magrioti, V., and Kokotos, G. Phospholipase A2 enzymes: physical structure, biological function, disease implication, chemical inhibition, and therapeutic intervention. Chemical reviews, 2011; 111(10), 6130-6185. https://doi.org/10.1021/cr200085w

Durum, S.K., Schmidt, J.A., and Oppenheim, J.J. Interleukin 1: an immunological perspective. Annual Review of Immunology, 1985; 3(1), 263-287. https://doi.org/10.1146/annurev.iy.03.040185.001403

El-Habit, O. H. and Abdel Moneim, A. E. Testing the genotoxicity, cytotoxicity, and oxidative stress of cadmium and nickel and their additive effect in male mice. Biological trace element research, 2014; 159, 364-372. https://doi.org/10.1007/s12011-014-0016-6

Erboga, M., Kanter, M., Aktas, C., Sener, U., Fidanol Erboga, Z., Bozdemir Donmez, Y., and Gurel, AThymoquinone ameliorates cadmium-induced nephrotoxicity, apoptosis, and oxidative stress in rats is based on its anti-apoptotic and anti-oxidant properties. Biological trace element research, 2016; 170, 165-172. https://doi.org/10.1007/s12011-015-0453-x

Espinosa-Diez, C., Miguel, V., Mennerich, D., Kietzmann, T., Sánchez-Pérez, P., Cadenas, S., and Lamas, S. Antioxidant responses and cellular adjustments to oxidative stress. Redox biology, 2015; 6, 183-197. https://doi.org/10.1016/j.redox.2015.07.008

Fichtlscherer, S., Breuer, S., Heeschen, C., Dimmeler, S., and Zeiher, A. M. Interleukin-10 serum levels and systemic endothelial vasoreactivity in patients with coronary artery disease. Journal of the American College of Cardiology, 2004; 44(1), 44-49. https://doi.org/10.1016/j.jacc.2004.02.054

Florescu, C.A.G., Stanciulescu, E.C., Berbecaru-Iovan, A., Balasoiu, R.M., and Pisoschi, C.G. In Vitro Assessment of Free Radical Scavenging Effect and Thermal Protein Denaturation Inhibition of Bee Venom for an Anti-Inflammatory Use;2024 PubMed 50 (1), 81–86.

Fujiwara, Y., Lee, J. Y., Tokumoto, M., and Satoh, M. Cadmium renal toxicity via apoptotic pathways. Biological and pharmaceutical bulletin, 2012; 35(11), 1892-1897. https://doi.org/10.1248/bpb.b212014

Gajski, G., and Garaj-Vrhovac, V. Radioprotective effects of honeybee venom (Apis mellifera) against 915-mhz microwave radiation–induced DNA damage in wistar rat lymphocytes: In vitro study. International journal of toxicology, 2009; 28(2), 88-98. https://doi.org/10.1177/1091581809335051

Gawad, S. A., Fikry, H., Amin, M. M., Elmahdi, A. R., and Elaziz, D. A. Effect of apitherapy on the pancreas and liver of streptozotacin induced diabetic rats: a biochemical and histological study. European Journal of Pharmaceutical and Medical Research, 2016;3(7), 555-565.

Genchi, G., Sinicropi, M. S., Lauria, G., Carocci, A., and Catalano, A. The effects of cadmium toxicity. International journal of environmental research and public health, 2020; 17(11), 3782. https://doi.org/10.3390/ijerph17113782

Ghajari, H., Hosseini, S. A., and Farsi, S. The effect of endurance training along with cadmium consumption on Bcl-2 and bax gene expressions in heart tissue of rats. Annals of Military and Health Sciences Research, 2019; 17(1). https://doi.org/10.5812/amh.86795

Han, S. M., Lee, K. G., Yeo, J. H., Oh, B. Y., Kim, B. S., Lee, W., and Pak, S. C. Effects of honeybee venom supplementation in drinking water on growth performance of broiler chickens. Poultry science, 2010;89(11), 2396-2400.. https://doi.org/10.3382/ps.2010-00915

Hassan, A. K., El-kotby, D. A., Tawfik, M. M., Badr, R. E., and Bahgat, I. M. Antidiabetic effect of the Egyptian honey bee (Apis mellifera) venom in alloxan-induced diabetic rats. The Journal of Basic and Applied Zoology, 2019; 80, 1-9. https://doi.org/10.1186/s41936-019-0127-x

Hyunseong, K.; Gihyun, L.; Soojin, P.; Hwan-Suck, Ch.; Hyojung, L.; Jong-Yoon, K.; Sangsoo, N.; Sun Kwang, K. and Hyunsu, B. 2013: Bee Venom Mitigates CisplatinInduced Nephrotoxicity by Regulating CD4(+) CD25(+) Foxp3(+) Regulatory T Cells in Mice. Evid Based Complement Alternat Med., 1-10. https://doi.org/10.1155/2013/879845

Ibrahim, M. A., Almaeen, A. H., Abd El Moneim, M., Tammam, H. G., Khalifa, A. M., and Nasibe, M. N. Cadmium-Induced Hematological, Renal, and Hepatic Toxicity: The Amelioration by: Spirulina platensis. The Saudi Journal of Forensic Medicine and Sciences, 2018; 1(1), 5-13. https://doi.org/10.4103/sjfms.sjfms_7_17

Ilstrup, K., Hanson, G., Shapiro, W. and Keshaviah, P. Examining the foundations of urea kinetics. ASAIO Journal,1985; 31, 164-168.

Imed, M., Fatima, H., and Abdelhamid, K. Protective effects of selenium (Se) and zinc (Zn) on cadmium (Cd) toxicity in the liver and kidney of the rat: histology and Cd accumulation. Food and chemical toxicology, 2008; 46(11), 3522-3527. https://doi.org/10.1016/j.fct.2008.08.037

Ince, C., Mayeux, P. R., Nguyen, T., Gomez, H., Kellum, J. A., Ospina-Tascón, G. A., and De Backer, D. The endothelium in sepsis. Shock,2016;45(3), 259-270. https://doi.org/10.1097/SHK.0000000000000473

Janik, J. E., Wania-Galicia, L., & Kalauokalani, D. Bee stings—A remedy for postherpetic neuralgia? A case report. Regional Anesthesia and Pain Medicine, 2007;32(6), 533-535.

Jang, H. S., Kim, S. K., Han, J. B., Ahn, H. J., Bae, H., & Min, B. I. Effects of bee venom on the pro-inflammatory responses in RAW264. 7 macrophage cell line. Journal of ethnopharmacology, 2005; 99(1), 157-160.

Kaplan, O., Yildirim, N. C., Yildirim, N. and Cimen, M. 2011: Toxic elements in animal products and environmental health. https://doi.org/10.3923/ajava.2011.228.232

Karimzadeh, L., Nabiuni, M., Kouchesfehani, H. M., Adham, H., Bagheri, A., & Sheikholeslami, A. Effect of bee venom on IL-6, COX-2 and VEGF levels in polycystic ovarian syndrome induced in Wistar rats by estradiol valerate. Journal of Venomous Animals and Toxins including Tropical Diseases, 2013;19(00), 1-8.

Kasuya, M., Teranishi, H., Aoshima, K., Katoh, T., Horiguchi, H., Morikawa, Y., ... and Iwata, K. Water pollution by cadmium and the onset of Itai-itai disease. Water Science and Technology, 1992; 25(11), 149-156. https://doi.org/10.2166/wst.1992.0286

Kayama, F., Yoshida, T., Elwell, M. R., and Luster, M. I. Role of tumor necrosis factor-α in cadmium-induced hepatotoxicity. Toxicology and applied pharmacology,1995; 131(2), 224-234. https://doi.org/10.1006/taap.1995.1065

Kim, H., Hong, J. Y., Jeon, W. J., Baek, S. H., and Ha, I. H. Bee venom melittin protects against cisplatin-induced acute kidney injury in mice via the regulation of M2 macrophage activation. Toxins, 2020;12(9), 574. https://doi.org/10.3390/toxins12090574

Kim, H., Lee, H., Lee, G., Jang, H., Kim, S.-S., Yoon, H., Kang, G.-H., Hwang, D.-S., Kim, S. K. and Chung, H.-S. Phospholipase A2 inhibits cisplatin-induced acute kidney injury by modulating regulatory T cells by the CD206 mannose receptor. Kidney international,2015;88, 550-559. https://doi.org/10.1038/ki.2015.147

Kim, S. J., Park, J. H., Kim, K. H., Lee, W. R., Chang, Y. C., Park, K. K., ... and Pak, S. C. Bee venom inhibits hepatic fibrosis through suppression of pro-fibrogenic cytokine expression. The American Journal of Chinese Medicine,2010; 38(05), 921-935. https://doi.org/10.1142/S0192415X10008354

Lala, V., Zubair, M. and Minter, D. A. : 2024. Liver Function Tests. StatPearls. Treasure Island (FL): StatPearls Publishing

Lee, G., and Bae, H. Anti-inflammatory applications of melittin, a major component of bee venom: detailed mechanism of action and adverse effects. Molecules,2016; 21(5), 616. https://doi.org/10.3390/molecules21050616

Lee, J. D., Park, H. J., Chae, Y., and Lim, S. An overview of bee venom acupuncture in the treatment of arthritis. Evidence‐Based Complementary and Alternative Medicine,2005; 2(1), 79-84. https://doi.org/10.1093/ecam/neh070

Lee, W. R., Pak, S. C., and Park, K. K. The protective effect of bee venom on fibrosis causing inflammatory diseases. Toxins, 2015; 7(11), 4758-4772. https://doi.org/10.3390/toxins7114758

Lee, W. R., Park, J. H., Kim, K. H., Park, Y. Y., Han, S. M., and Park, K. K. Protective effects of melittin on transforming growth factor-β1 injury to hepatocytes via anti-apoptotic mechanism. Toxicology and applied pharmacology,2011;256(2), 209-215. https://doi.org/10.1016/j.taap.2011.08.012

Mahdavi, S., Khodarahmi, P., and Roodbari, N. H. Effects of cadmium on Bcl-2/Bax expression ratio in rat cortex brain and hippocampus. Human and experimental toxicology,2018; 37(3), 321-328. https://doi.org/10.1177/0960327117703687

Maodaa, S. N., Allam, A. A., Ajarem, J., Abdel-Maksoud, M. A., Al-Basher, G. I., and Wang, Z. Y. Effect of parsley (Petroselinum crispum, Apiaceae) juice against cadmium neurotoxicity in albino mice (Mus musculus). Behavioral and Brain Functions, 2016; 12, 1-16 https://doi.org/10.1186/s12993-016-0090-3

Mccord, J. M., Keele JR, B. B. and Friedrich, I. An enzyme-based theory of obligate anaerobiosis: the physiological function of superoxide dismutase. Proceedings of the National Academy of Sciences,1971;68, 1024-1027. https://doi.org/10.1073/pnas.68.5.1024

Mijit, M.; Caracciolo, V.; Melillo, A.; Amicarelli, F.; Giordano, A. Role of p53 in the regulation of cellular senescence. Biomolecules 2020, 10, 420. [Google Scholar] [CrossRef] [PubMed] https://doi.org/10.3390/biom10030420

Mohammadi, E., Vatanpour, H., & Shirazi, F. H.Immunomodulatory effects of bee venom in human synovial fibroblast cell line. Iranian Journal of Pharmaceutical Research: IJPR,2015;14(1), 313.

Murakami, M., Nakatani, Y., Atsumi, G. I., Inoue, K., and Kudo, I. Regulatory functions of phospholipase A 2. Critical Reviews™ in Immunology, 2017; 37(2-6). https://doi.org/10.1615/CritRevImmunol.v37.i2-6.20

Nam, K. W., Je, K. H., Lee, J. H., Han, H. J., Lee, H. J., Kang, S. K., & Mar, W. Inhibition of COX-2 activity and proinflammatory cytokines (TNF-α and IL-1β) production by water-soluble sub-fractionated parts from bee (Apis mellifera) venom. Archives of Pharmacal Research, 2003;26, 383-388.

Nazima, B., Manoharan, V. and Miltonprabu, S.Grape seed proanthocyanidins ameliorates cadmium-induced renal injury and oxidative stress in experimental rats through the up-regulation of nuclear related factor 2 and antioxidant responsive elements. Biochemistry and Cell Biology,2015; 93, 210-226. https://doi.org/10.1139/bcb-2014-0114

Nishikimi, M., Rao, N. A., and Yagi, K. The occurrence of superoxide anion in the reaction of reduced phenazine methosulfate and molecular oxygen. Biochemical and biophysical research communications, 1972; 46(2), 849- 854.. https://doi.org/10.1016/S0006-291X(72)80218-3

Ojo, O. A., Rotimi, D. E., Ojo, A. B., Ogunlakin, A. D., and Ajiboye, B. O. Gallic acid abates cadmium chloride toxicity via alteration of neurotransmitters and modulation of inflammatory markers in Wistar rats. Scientific Reports,2023; 13(1), 1577. https://doi.org/10.1038/s41598-023-28893-6

Pari, L., and Murugavel, P. Role of diallyl tetrasulfide in ameliorating the cadmium induced biochemical changes in rats. Environmental toxicology and pharmacology,2005;20(3), 493-500. https://doi.org/10.1016/j.etap.2005.05.009

Park, H. J., Lee, S. H., Son, D. J., Oh, K. W., Kim, K. H., Song, H. S., Kim, G. J., Oh, G. T., Yoon, D. Y. and Hong, J. T. Antiarthritic effect of bee venom: Inhibition of inflammation mediator generation by suppression of NF‐κB through interaction with the p50 subunit. Arthritis and rheumatism,2004; 50, 3504-3515. https://doi.org/10.1002/art.20626

Park, H. J., Son, D. J., Lee, C. W., Choi, M. S., Lee, U. S., Song, H. S., and Hong, J. T. Melittin inhibits inflammatory target gene expression and mediator generation via interaction with IκB kinase. Biochemical pharmacology, 2007; 73(2), 237-247. https://doi.org/10.1016/j.bcp.2006.09.023

Park, J. H., Kim, K. H., Kim, S. J., Lee, W. R., Lee, K. G., and Park, K. K. Bee venom protects hepatocytes from tumor necrosis factor-α and actinomycin D. Archives of Pharmacal Research, 2010; 33, 215-223. https://doi.org/10.1007/s12272-010-0205-6

Park, J. H., Kim, K. H., Lee, W. R., Han, S. M., and Park, K. K. Protective effect of melittin on inflammation and apoptosis in acute liver failure. Apoptosis, 2012; 17, 61-69. https://doi.org/10.1007/s10495-011-0659-0

Park, J.-H., Lee, W.-R., Kim, H.-S., Han, S.-M., Chang, Y.-C. and Park, K.-K. Protective effects of melittin on tumor necrosis factor-α induced hepatic damage through suppression of apoptotic pathway and nuclear factor-kappa B activation. Experimental Biology and Medicine,2014; 239, 1705-1714. https://doi.org/10.1177/1535370214533880

Pelletier, J. P., Jovanovic, D., Fernandes, J. C., Manning, P., Connor, J. R., Currie, M. G., ... and Martel‐Pelletier, J. Reduced progression of experimental osteoarthritis in vivo by selective inhibition of inducible nitric oxide synthase. Arthritis and Rheumatism, 1998;41(7), 1275-1286. https://doi.org/10.1002/1529-0131(199807)41:7<1275::AID-ART19>3.0.CO;2-T

Poli V, Madduru R, Aparna Y, Kandukuri V, Motireddy SR. Amelioration of Cadmium-Induced Oxidative Damage in Wistar Rats by Vitamin C, Zinc and N-Acetylcysteine. Med Sci (Basel) ;2022 Jan 26;10(1):7. doi: 10.3390/medsci10010007. PMID: 35225941; PMCID: PMC8883914. https://doi.org/10.3390/medsci10010007

Qu F, Zheng W. Cadmium Exposure: Mechanisms and Pathways of Toxicity and Implications for Human Health. Toxics. 2024; 12(6):388. https://doi.org/10.3390/toxics12060388 https://doi.org/10.3390/toxics12060388

Rekka, E., Kourounakis, L., and Kourounakis, P. Antioxidant activity of and interleukin production affected by honey bee venom. Arzneimittel-forschung,1990; 40(8), 912-913..

Renugadevi, J., and Prabu, S. M.Cadmium-induced hepatotoxicity in rats and the protective effect of naringenin. Experimental and Toxicologic Pathology, 2010; 62(2), 171-181. https://doi.org/10.1016/j.etp.2009.03.010

Singh, C., Singh, R., Shekhar, A. (2024). Oxidative Stress in Cadmium Toxicity in Animals and Its Amelioration. In: Jha, A.K., Kumar, N. (eds) Cadmium Toxicity Mitigation. Springer, Cham. https://doi.org/10.1007/978-3-031-47390-6_15

Sinuani, I., Beberashvili, I., Averbukh, Z. and Sandbank, J. Role of IL-10 in the progression of kidney disease. World journal of transplantation,2013; 3, 91. https://doi.org/10.5500/wjt.v3.i4.91

Sivaprakasam, C., and Nachiappan, V.Modulatory effect of cadmium on the expression of phospholipase A2 and proinflammatory genes in rat testis. Environmental Toxicology, 2016;31(10), 1176-1184. https://doi.org/10.1002/tox.22124

Snyder, L. M., Fortier, N. L., Trainor, J., Jacobs, J., Leb, L., Lubin, B. and Mohandas, N. Effect of hydrogen peroxide exposure on normal human erythrocyte deformability, morphology, surface characteristics, and spectrin-hemoglobin cross-linking. The Journal of Clinical Investigation,1985;76(5), 1971-1977. https://doi.org/10.1172/JCI112196

Song, Y., Zhang, R., Wang, H., Yan, Y., and Ming, G.Protective effect of Agaricus blazei polysaccharide against cadmium-induced damage on the testis of chicken. Biological Trace Element Research, 2018;184, 491-500 https://doi.org/10.1007/s12011-017-1196-7

Suh, S. J., Kim, K. S., Kim, M. J., Chang, Y. C., Lee, S. D., Kim, M. S., ... and Kim, C. H. Effects of bee venom on protease activities and free radical damages in synovial fluid from type II collagen-induced rheumatoid arthritis rats. Toxicology in vitro,2006;20(8), 1465-1471. https://doi.org/10.1016/j.tiv.2006.06.016

Tzirogiannis, K. N., Panoutsopoulos, G. I., Demonakou, M. D., Hereti, R. I., Alexandropoulou, K. N., Basayannis, A. C. and Mykoniatis, M. G. Time-course of cadmium-induced acute hepatotoxicity in the rat liver: the role of apoptosis. Archives of Toxicology,2003; 77, 694-701. https://doi.org/10.1007/s00204-003-0499-y

Vagvala, S. H. and O’Connor, S. D. 2018. Imaging of abnormal liver function tests. Clinical liver disease, 11, 128-134. https://doi.org/10.1002/cld.704

Wehbe, R., Frangieh, J., Rima, M., El Obeid, D., Sabatier, J. M., and Fajloun, Z. Bee venom: Overview of main compounds and bioactivities for therapeutic interests;2019 Molecules, 24(16), 2997. https://doi.org/10.3390/molecules24162997

Williamson, E. M., Okpako, D. T., & Evans, F. J. 1996: Selection, Preparation and Pharmacological Evaluation of Plant Material, Volume 1 (Vol. 1). John Wiley & Sons.

Yamano, T., DeCicco, L. A., and Rikans, L. E. Attenuation of cadmium-induced liver injury in senescent male fischer 344 rats: role of Kupffer cells and inflammatory cytokines. Toxicology and applied pharmacology, 2000; 162(1), 68-75. https://doi.org/10.1006/taap.1999.8833

Yang, H., and Shu, Y. Cadmium transporters in the kidney and cadmium-induced nephrotoxicity. International journal of molecular sciences, 2015;16(1), 1484-1494. https://doi.org/10.3390/ijms16011484

Yang, Y., Hutchinson, P., and Morand, E. F. Inhibitory effect of annexin I on synovial inflammation in rat adjuvant arthritis. Arthritis and Rheumatism: Official Journal of the American College of Rheumatology, 1999; 42(7), 1538-1544. https://doi.org/10.1002/1529-0131(199907)42:7<1538::AID-ANR29>3.0.CO;2-3

Yun HS, Oh J, Lim JS, Kim HJ, Kim J-S. Anti-Inflammatory Effect of Wasp Venom in BV-2 Microglial Cells in Comparison with Bee Venom. Insects. 2021; 12(4):297. https://doi.org/10.3390/insects12040297 https://doi.org/10.3390/insects12040297

Zhang, S., Liu, Y., Ye, Y., Wang, X.-R., Lin, L.-T., Xiao, L.-Y., Zhou, P., Shi, G.-X. and Liu, C.-Z. Bee venom therapy: Potential mechanisms and therapeutic applications. Toxicon;2018,148, 64-73. https://doi.org/10.1016/j.toxicon.2018.04.012

Zhuang, J., Nie, G., Yang, F., Dai, X., Cao, H., Xing, C., ... and Zhang, C. Cadmium induces cytotoxicity through oxidative stress-mediated apoptosis pathway in duck renal tubular epithelial cells. Toxicology in Vitro, 2019; 61, 104625. https://doi.org/10.1016/j.tiv.2019.104625