In-Vitro and In-Vivo Antimicrobial Activity of Five Medicinal Plants against Virulent Escherichia coli O157:H7 Strain Harboring Shiga Toxin Gene
Asfand Yar Khan1, Syed Saleem Ahmad1*, Muhammad Avais1 and Kamran Ashraf2
1Department of Veterinary Medicine, University of Veterinary and Animal Sciences, Lahore 54000, Pakistan
2Department of Parasitology, University of Veterinary and Animal Sciences, Lahore 54000, Pakistan
ABSTRACT
This study aimed to determine the anti-bacterial efficacy of 5 different medicinal plant extracts against Shiga toxin (E. coli O157:H7) based on the in-vitro and in-vivo trial. A total of twenty-one (n=21) PCR-confirmed isolates were selected for detection of virulent genes in-vitro trial (zone of inhibition). For in-vivo trial, forty-two (n=42) day-old chicks were divided into seven equal groups randomly (n=6 birds/group), and were classified as: G1 (Azadirachta indica @ 18.25 mg/ml), G2 (Melia azedarach @ 15.75 mg/ml), G3 (Withania coagulans @ 25 mg/ml), G4 (Nigela sativa @ 30 mg/ml), and G5 (Calotropis procera @ 10 mg/ml) were taken as treatment groups, while G6 as a negative control, and G7 as a positive control. The results showed that 47.6% serovars were positive for the virulent gene (Stx-1). Moreover, the highest zone of inhibition was observed in G5 (17.1 ± 0.60 mm, P<0.05) as compared to other groups, which indicated high anti-bacterial efficacy on in-vitro basis. The survival rate and weight gain of chicks were significantly higher (P<0.05) in G5 compared with all other groups. However, none of the medicinal plant extracts affect liver function and blood parameters. Finally, in conclusion, C. procera was found to be highly effective to protect birds against E. coli O157:H7 infection.
Article Information
Received 09 October 2022
Revised 28 November 2022
Accepted 25 December 2022
Available online 09 June 2023
(early access)
Published 07 October 2024
Authors’ Contribution
Conception: AY, SS. Methodological approach: AY, MA. Critical examination: AY, SS, MA, and KA. Writing initial draft preparation: AY, SS. Writing, assessment, and proofreading, AY, SS, and MA.
Key words
E. coli O157:H7, Shiga toxin-1, Antimicrobial activity, Medicinal plants, Calotropis procera
DOI: https://dx.doi.org/10.17582/journal.pjz/20221009171005
* Corresponding author: [email protected]
0030-9923/2024/0006-2919 $ 9.00/00
Copyright 2024 by the authors. Licensee Zoological Society of Pakistan.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
INTRODUCTION
Diarrhoea is one of the most frequent conditions in dogs (Ramos et al., 2021), and is caused by various infectious agents such as viruses, protozoa (Gülersoy et al., 2022) and bacteria (Candellone et al., 2020). Escherichia coli is the major causative agent in causing diarrhoea in puppies (Algammal et al., 2022), which is divided into intra-intestinal and extra-intestinal pathogenic serotypes (Sadeq et al., 2018). The most common is enterohaemorrhagic serotype, subdivided into shigatoxigenic and verotoxigenic (Kiranmayi et al., 2010). The most important serovar is E. coli O157:H7 (Abdulrazzaq et al., 2021). It causes fatal diseases in dogs, including hemorrhagic colitis (HC) and haemolytic uremic syndrome (HUS) (Kwon and Cho, 2015; Boland et al., 2013). Therefore, the accurate diagnosis of this serovar of E. coli is mandatory.
Medicinal plants are mainly used for human health. It had been used for the treatment of various diseases due to the presence of their phytochemical constituents (Fullerton et al., 2011). According to WHO, 80% of communities in developing countries are using traditional medicines (Lee et al., 2019). The wide use of medicinal plants as an alternative to conventional drugs is due to low anti-microbial resistance as compared to conventional drugs (Owolabi et al., 2017). Plant-based therapeutics are biodegradable and harmless to the environment (Munir et al., 2017). Experimentally it has been proven that products obtained from medicinal plants are the most economical and active natural antibiotics (Qureshi et al., 2019).
Various plants have been used as antibacterial agents including Azadirachta indica (Parihar and Balekar, 2016), Melia azedarach (Khan et al., 2022), Nigela sativa, Withania coagulans (Nwokafor et al., 2020), and Calotropis procera (Kamruzzaman et al., 2013). These herbal extracts interfere with the functions of the cell wall, cell membrane, and protein synthesis and lead to leakage in cytoplasmic bacteria, and finally inhibit the growth of bacteria (Dutta et al., 2015). Despite the beneficial effects of these plant extracts, no study is reported against E. coli O157:H7 infection particularly in canines. Therefore, this study was designed to assess the antimicrobial activities of the cold aqueous extracts of A. indica, M. azedarach, N. sativa, W. coagulans, and C. procera by using various in-vitro and in-vivo methods.
MATERIALS AND METHODS
Ampilification of E. coli O157:H7 virulent genes
A total of 21 PCR-confirmed E. coli O157:H7 isolates were selected for the molecular detection of virulent genes (Shiga-toxins; Stx-1 and Stx-2) through PCR by using the following primers:
Stx-1(140 bp fragment)
F: ACCCTGTAACGAAGTTTGCG
R: ATCTCATGCGACTACTTGAC) and
Stx-2 (346 bp fragment)
F: TTAACCACACCCACGGCAGT
R: GCTCTGGATGCATCTCTGGT.
The DNA was extracted by using a commercial DNA extraction Kit (Gene JET Genomic DNA Purification Kit; Thermo Scientific, USA). PCR was conducted as per the protocols already described (Khan et al., 2022).
Table I. Names of the plants and their parts used in the this study.
|
Name of plants (Common name) |
Voucher No. |
|
Leaves of Azadirachta indica (Neem) |
GC. Herb. Bot. 3668 |
|
Leaves of Melia azedarach (Bakain) |
GC. Herb. Bot. 3669 |
|
Leaves of Calotropis procera (Aak) |
GC. Herb. Bot. 3672 |
|
Seeds of Nigela sativa (Kalonji) |
GC. Herb. Bot. 3670 |
|
Seeds of Withania coagulans (Paneer bootie) |
GC. Herb. Bot. 3671 |
Medicinal plants extracts
The experimental medicinal plants (A. indica, M. azedarach, C. procera, N. sativa, and W. coagulans) were procured from the local market of district Lahore, Pakistan, and were identified and authenticated by the Department of Botany in the Government College University, Lahore, Pakistan (Table I). The leaves of plants were dried for fifteen days and were grinded in an electric blender to form powder. Approximately 100 g/750 ml of solvent (double-distilled water) was extracted for 72 h on a vortex shaker (dathan scientific). A rotary evaporator was used to evaporate the filtrate at 37oC under reduced pressure. The pure yield was determined and stored at 4oC until further use.
Bacterial strain and culture medium
In this study, ten PCR-confirmed Shiga toxin-producing E. coli O157:H7 isolates were used. The strain was cultivated at 37°C in Luria broth (LB) and was preserved at -80ᵒC in LB containing 15 % glycerol. The bacterial culture was prepared by inoculating bacteria into a tube containing LB and then kept overnight at 37°C before further use.
Well diffusion assay
Different dilutions of extracts such as 400 mg/ml, 300 mg/ml, 200 mg/ml, and 100 mg/ml (Torkan et al., 2016) were prepared in distulled water. Ciprofloxacin 5µg was added as a positive control and 5 % DMSO was used as a negative control (20 ml). Mueller Hinton agar was poured in petri-plates and allowed to solidify. Plates were dried and 50 µl of bacterial suspension containing 9×109 cells/ml was poured into each plate and spread uniformly. The plates were allowed to dry for 5 min under sterile conditions. 30 μl of the extract was infused into one of the 8 mm diameter wells on each plate’s agar surface. The plates were then incubated for 24 h at 37 °C, and the zone of inhibition was measured in mm.
Determination of minimum inhibitory concentration (MIC)
The broth microdilution method was used for MIC. In brief, 50 µl of Muller Hinton broth was filled from 1st well to 12 well of the microtitration plate. Then E. coli O157:H7 with the standard dilution of McFarland 9 × 109 cells/ml was filled from well 1 to 11. In the last, 100 mg/ml of cold aqueous extracts of the above plants were poured from well 1 to 10 of the microtitration plate and incubated at 37 °C for 24 h before and after the incubation the optical density (OD) values were taken. The wells 11 and 12 were used as the negative and positive control, respectively. The microtitration plate was then incubated for 24 h at 37ºC. Turbidity in the negative control well was used to measure bacterial growth. The MIC values were estimated by comparing the wells with no bacterial turbidity to the negative control well.
Determination of minimum bactericidal concentration (MBC)
MBCs were determined by plating 100 µl of samples from each MIC assay tube with growth inhibition on freshly prepared sterile Muller Hinton agar plates and aerobically incubating them at 37 °C for 24 h. During the incubation period, the MBC values were recorded as the lowest concentration of extract that did not allow any visible bacterial colony growth on the agar plates. These tests were repeated thrice (Bilal et al., 2020).
Experimental design
Growth of E. coli O157:H7 containing Stx-1 gene (A field strain that was previously isolated and identified by PCR) was grown overnight at 37 oC in LB broth medium. Broth culture was then diluted with normal saline to obtain a concentration of 9×109 cells/ml (ID50 dose). A total of 42 (un-vaccinated) day-old broiler chicks were purchased from a reputable hatchery and were used to determine the protective dosage of Azaderachta indica, Melia azedarach, Withania coagulans, Nigella sativa, and Calotropis procera. The birds were fed balanced commercial starter and growing rations (21% and 18%, respectively) and provided clean water, without using any antibacterial agent until the end of the experimental period. Birds were reared under open housing system under strict hygienic conditions. The chicks were divided into seven groups; Groups 1 to 5 were the treatment groups, groups 6 and 7 served as a negative and positive control, respectively. The infected groups (G1, G2, G3, G4, G5, G7) were kept in one room while the birds of G6 (Uninfected) were reared at a distance in another room with the similar housing and environmental conditions. Every chick (except the negative control group) was challenged with 1 ml of the inoculum orally after seven days of age. Group 7 (infected but untreated chicken) received no treatment during the experiment. G6 (negative control) received placebo only. G1 was treated with A. indica @ 18.25 mg/ml, G2 with M. azedarach @ 15.75 mg/ml, and G3 with W. coagulans @ 25 mg/ml, G4 was treated with N. sativa @ 30 mg/ml. while G5 was treated with C. procera @ 10 mg/ml. The groups (1-5) received treatments for five consecutive days (approx. 1ml orally of above said doses each day) after 24 h of the infection with E. coli O157:H7 containing Stx-1. All the chicks were kept under daily observation up to 10 days for clinical signs, mortalities, haemato-biochemical alterations, histopathological changes, and growth performance was also measured up to the 22nd day till the end of the experiment.
Haemato-biochemical parameters
Serum biochemical parameters alanine transaminase (ALT), alkaline phosphatase (ALP), and aspartate transaminase (AST) were assessed using commercial kits. While for hematological parameters like red blood cells (RBCs), Natt and Herrick method (Natt et al., 1952) was used, and for hemoglobin estimation, Drabkins method (Balasubramaniam et al., 1992) was practiced.
Histopathological examination
Histopathology was performed to observe the anti-microbial effects of medicinal plants against E. coli O157:H7 contained Shiga toxin in broiler birds and compared with an infected group. At the end of the experiment, all the remaining birds were slaughtered from each group, and organs (liver, heart, spleen, and intestine) were collected in a jar having 10% buffered formalin and left for a week for hardening. Then processed for histopathological examination by using standard protocol.
Statistical analysis
Data were statistically analyzed through SPSS version 22. The data on the percentage of presence of virulent genes and survival percentages analyzed by using the chi-square (χ2) test. However, the data of MIC, MBC, bird growth performance, liver function, and blood parameters were analyzed by using a two-way analysis of variance (ANOVA).
RESULTS
The results revealed that a total of 10 (47.6 %) isolates (Table II) were positive for the Stx-1 gene and none of the isolates was positive for the Stx-2 gene. However, there were 11 (52.3%) isolates were negative for both virulent genes.
Table II. Virulent genes found in E. coli O157:H7 isolated from canine diarrheic pups.
|
No. of genes |
Genes |
No. of E. coli O157:H7 harboring genes |
% |
|
One gene |
Stx-1a |
10 |
47.6**++ |
|
Stx-2b |
0 |
0 |
|
|
Two genes |
Stx-1+Stx-2 |
0 |
0 |
|
None of the two genes |
- |
11 |
52.3 |
aStx-1, Shiga toxin 1 gene, bStx-2, Shiga toxin 2 gene, (** P<0.0001; X2=16.51) significance between Stx-1 and Stx-2. ++ shows significance between one and two genes (++ P<0.0001; X2=14.82).
The results of antibacterial activity (zones of inhibition) are shown in Figure 1 The result showed that the zone of inhibition was significantly (P<0.05) higher in the control group (20.1±1.10 mm) compared to the treatment groups. The zone of inhibition was significantly increased as the dose of treatment groups increased, so that the zone of inhibition was highest at 400 mg/well in all the treatment groups. However, the C. procera showed higher efficacy against E. coli irrespective of treatment dose. The results indicated that the antimicrobial efficacy of the extracts was concentration-dependent.
The results of MIC and MBC assays are presented in Table III. The results showed that there was a significant difference in MIC and MBC values between C. procera (10 and 75.75, respectively; P<0.01) and all other treatment extracts. These findings indicated that C. procera is a potent antibacterial agent than other herbs
Table III. Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of cold a quans extracts of different plant extracts against E. coli O157:H7. Common letters show significant differences at p < 0.05.
|
Plants |
MIC (mg/ml) |
MBC (mg/100 µl) |
|
A. indica |
18.25 |
125.50a |
|
M. azedarach |
15.75 |
92.75a |
|
W. coagulans |
25 |
>150a |
|
N. sativa |
30 |
275a |
|
C. procera |
10 |
75.75a |
Feed intake, body weight, weight gain, and feed conversion ratio of broiler birds treated with medicinal compounds are shown in Table IV. The results showed that a significant difference (P ≤ 0.05) was observed in feed intake among birds of experimental groups. The highest feed intake was observed in G 6 (887.21 g) during the experimental trial as compared to other treatment groups. However, the lowest feed intake was observed in G 7 group. The findings with respect to final body weight revealed that the birds from the G1, G2, and G5 gained significantly (P<0.05) more weight than G3, G4, G6, and G7.
The survival rates of birds post-infection after treatment with herbal extracts are depicted in Figure 2. The results showed that there was a significantly higher survival rate in G6 and G5 (100%; P<0.01) than control and treatment groups (G1-4). In G7 (control positive), 100 % of the birds died after 18 h of incubation (oral administration of E. coli O157:H7). The herbs had no impact on various liver function and blood parameters (ALP, AST and ALT, RBCs, HB, Table V).
During the histopathological evaluation of G6 birds, all the organs were observed normal and didn’t exhibit any change. In G7, the birds showed blunting, thickening and abnormal elongation of villi with heavy infiltration of inflammatory cells, and disruption in the apical surface of the intestine, eighteen h post-infection. Moreover, infiltration of lymphocytes, degeneration of myocytes, and extensive presence of inflammatory cells were observed in the heart, along with severe pathological lesions in the liver of the infected birds. In G1, 2, and G5, mucus attachment in the epithelium of the intestine, congestion of blood vessels, necrosis, infiltration of the inflammatory cells, and abnormal elongation of glands along with disruption in some parts of the caecum were observed. In G3, disruption of villi, elongation of glands, and lymphocytic proliferation of caecum along with severe necrosis, haemorrhages, and inflammation were noticed. While in G4, superficial sloughing of epithelial mucosa of the intestine, proliferation of monocytes, and lymphocytes were observed in the caecum. All the groups were observed with normal hearts. In the liver examination, mild degeneration of hepatocytes with an increased population of lymphocytes and macrophages was observed in G1. In G2 and 3, necrosis of hepatocytes and severe degeneration were noticed. In G4, severe degeneration in lymphocytes and pre-dominant lymphoblast were observed. While G5 tissues were found normal.
Table IV. Growth performance of broiler birds treated with medicinal compounds.
|
Initial body weight (n=6) |
Final body weight (n=6) |
Weight gain (n=6) |
Feed intake (n=6) |
FCR (n=6) |
|
|
Group 1 |
36.10 ± 1.70 |
548.89±0.90ab |
542.30±0.87b |
850.10±51.45a |
1.56±0.12ab |
|
Group 2 |
36.33 ± 0.94 |
574.30±0.87b |
518.80±0.81b |
851.10±63.51a |
1.64±0.11ac |
|
Group 3 |
35.47 ± 0.40 |
521.10±1.23ac |
484.20±1.12c |
855.65±52.30a |
1.76±0.05a |
|
Group 4 |
35.52 ± 0.42 |
480.50±2.80c |
453.60±1.097c |
846.20±138.50b |
1.86±0.02a |
|
Group 5 |
36.12 ± 0.52 |
615.00±0.78a |
575.62±0.77a |
860.31±56.27a |
1.49±0. 01b |
|
Group 6 |
36.95 ± 0.93 |
541.11±2.65c |
434.20±1.01c |
840.21±47.24b |
1.93±0.06a |
|
Group 7 |
35.00 ± 0.10 |
219.21±1.35a |
190.15±0.07a |
90.01±22.01a |
0.47±0.02b |
|
p-value |
0.5414 |
<0.0001 |
<0.0001 |
0.0121 |
0.0223 |
All the values are expressed in mean ± standard error, Common letters show non-significant differences at p > 0.05 whereas Different letters a-c within a column show significant differences when p ≤ 0.05. FCR is feed conversion ratio. Group 1, Azaderachta indica treated group; Group 2, Melia azaderach treated group; Group 3, Withania coagulans treated group; Group 4, Nigella sativa treated group; and Group 5, Calotropis procera treated group; Group 6, negative control; Group 7, Positive control.
Table V. Blood and liver function profile of birds treated with medicinal plants.
|
G1 |
G2 |
G3 |
G4 |
G5 |
G6 |
G7 |
p value |
|
|
RBCs |
4.59 ± .05 |
4.90 ± .50 |
3.71 ± 1.50 |
3.58 ± .80 |
4.90 ± .01 |
4.12 ± 5.1 |
2.76 ± 3.2 |
0.2 |
|
Hb |
10.10 ± 1.21 |
12.10 ± 4.57 |
8.70 ± 1.21 |
8.30 ± 2.81 |
13.50 ± 2.50 |
9.89 ± 1.31 |
6.42 ± 1.05 |
0.08 |
|
ALP |
15.50 ± .01 |
17.75 ± .61 |
14.15 ± .35 |
14.0 ± .75 |
18.22 ± 1.70 |
18.80± 3.67 |
11.75±2.10 |
0.3 |
|
AST |
11.12 ± 1.10 |
13.21 ± 1.40 |
9 .70 ± 3.30 |
10.65± 0.90 |
12.7 ± 1.22 |
13.12 ± 1.97 |
6.10 ± 1.10 |
0.1 |
|
ALT |
58.0 ± 9.0 |
67.19 ± 12.0 |
51.50 ± 10.1 |
65.10± 12.0 |
59.48 ± 54.3 |
62.05 ± 32 |
45.20±9.05 |
0.6 |
For statistical details and details of groups, see Table IV. RBC, red blood cell; Hb, hemoglobin; ALP, alkaline phosphatase; AST, asparate aminotransferase; ALT, alamine aminotransferase.
Discussion
In the present study, the PCR revealed that the Stx-1 gene is the most predominant virulent gene associated with E. coli O157:H7 isolated from diarrhoeic dogs. The pathogenicity of E. coli O157:H7 is directly attributed to its virulence factors (Stx-1 and Stx-2 genes) resulting destruction of eukaryote ribosome and inhibiting protein biosynthesis of the host (Algammal et al., 2022). These findings agreed with Rahman et al. (2021) who reported that most of the E. coli O157:H7 isolates herboard Stx-1 genes. In the present study, the prevalence of Shiga toxin-1 gene (47.6 %) is almost similar to that reported by the previous study (43.7 %) of Okwu et al. (2020). Moreover a lower prevalence of Shiga toxin-1 gene (33.3 %) was documented by Dhanki et al. (2018). The possible reason for variation in the prevalence of Shiga toxin-1 gene might be attributed to the different exposure of the dogs to the organism.
The present study confirmed the inhibitory effect of cold aqueous extract of leaf of C. procera through agar well diffusion method against E. coli O157:H7. In previous reports, the absence of inhibitory effect of sequentially extracted hot (water bath), methanolic extracts of C. procera leaf against disc diffusion method was shown (Hossain et al., 2021). The contradiction between previous and current studies results might be due to differences in extraction method, antibacterial activity method, or both. The past studies stated that some of the active biomolecules may escape from the extract as a result of the high-temperature treatment during the water bath extraction (Kayath et al., 2022). As the free hydroxyl groups present in the disc may prevent the diffusion of cationic polar molecules, the agar well diffusion method might be superior to the disc diffusion method. The results of the current study proved that M. azedarach had the antibacterial inhibitory activity. A few earlier studies (Tavakkoli et al., 2021), also documented that M. Azaderach contains antibacterial substances. Our study is inconsistent with the findings of Haq et al. (2020) and Singh and Kumar (2018) who stated that the leaves of M. azaderach are more effective against Gram-negative strains of bacteria than Gram-positive. The earlier studies suggested that W. coagulans exhibited moderate activity against E. coli (Bilal et al., 2020) which support our study. The current study showed resistance for E. coli O157:H7 to cold aqueous extracts of N. sativa. Several investigators (Sharma and Kharel, 2019) had also reported that methanolic extracts of N. Sativa were ineffective against E. coli, whereas few researchers (Yang and Rothman, 2004; Carvalho et al., 2016; Subramaniam et al., 2020; Fullerton et al., 2011) found the antimicrobial activity of N. sativa. This discrepancy might be possibly due to difference in the characteristics of bacterial strains and difference in solvent extraction.
The encircled area in A (positive control) shows necrosis with empty spaces along with karyorrhexis and diffused congestion in the liver. The encircle area in B shows the diffused congestion in the liver. C Shows extensive presence of inflammatory cells in the myocarditis. D shows disrupted villi (arrows) while the stars in E indicated elongation of the glands of the cecum and lymphocytic proliferation (arrows) in cecum of W. coagulans group Photomicrographs of broiler intestine and spleen group 4. F showes abnormal elongation of the villi of intestine of Nigella sativa treated group encircled area in G showed the infiltration of inflammatory cells, lymphocytes and neutrophils in spleen.
MIC refers to the lowest concentration of an antimicrobial agent that prevents the growth of the pathogen. High values of MIC are an indication of limited antibacterial efficacy. Current results are in agreement with the reports of various researchers, that the MIC of plants has been an important tool in determining the antimicrobial potential of plants (Abdulrazzaq et al., 2021). The findings of the current study showed a significantly low (10 mg/ml) MIC value for C. procera against E. coli O157:H7. Similar findings were observed by Bilal et al. (2020) for E. coli. The plausible reason may be the similar dose rates or constituents in the extract of herbs. 28 mg/ml MIC of aqueous extract of C. procera against E. coli was documented in a previous study (Kishor et al., 2020), which was slightly higher than our findings. The findings of the current study showed that the MIC activity of M. azedarach against E. coli O157: H7 was 15.75 mg/ml concentration. The results of the present study are incompatible with the past study of Kwon and Chao (2015) who reported 47.8 mg/ml MIC for aqueous extract of M. azaderach against E. coli. The findings of this study for MIC of A. indica extract against E. coli O157:H7 was 18.25 mg/ml, which are in agreement with Parihar and Balekar (2016). Our results for MIC for W. coagulans are supported by Sharma and Kharel (2019) and Zahid et al. (2020).
The feeding behaviour of our study showed that birds were significantly affected by herbs, C. procera treated group had the highest final weight and total weight gain. The increase in weight gain may be due to the highest amount of carbohydrate, ash, and protein found in C. procera (Rahman et al., 2021; Okwu et al., 2020). The results of our findings for M. azaderach disagreed with Tavakkoli et al. (2021) who reported that aqueous extract of M. azaderach significantly decreased body weight, final weight gain, and relative growth rate in birds. The incongruity in results may be due to difference in dose rate, extract consistency, and environmental condition. The performance of birds in our study by feeding A. indica showed significantly better performance as compared to the control healthy group. These results coincide with those of Owolabi et al. (2017), Qureshi et al. (2019) and Parihar and Balekar (2016). On the other hand, the present study opposed the findings of Munir et al. (2017).
Severe pathological lesions were reported in the current study in the liver of infected birds. Our findings in terms of infected liver birds are in accordance with those of Torkan et al. (2016) and Samuel and Sudi (2020) who concluded that the liver had the potential to absorb a large concentration of Shiga toxin travelled through the hepatic portal system.
In the present study, the results of histopathological evaluation agreed with those of Khan et al. (2022) who demonstrated that inflammatory reaction in the intestine is due to the strain that survives in the gastrointestinal environment and colonize in the intestinal tissues. In heart, infiltration by the increasing number of lymphocytes, degeneration of myocytes, and extensive presence of inflammatory cells observed in the present study are corroborated by Zahid et al. (2020) who reported that E. coli O157:H7 produces pathological lesions in cardiac muscle fibers.
The results of the present study revealed that the birds treated with C. procera showed no significant difference (p>0.05) for ALT, ALP, AST, RBCs, and Hb. The present study disagrees with Derbal and Diar (2019) who stated that leaves of C. procera showed harmful effects on albino rats. Our research is consistent with the findings that A. indica leaf meal in the diet of broilers had no adverse effects on liver function parameters (Kiranmayi and Krishnaiah, 2010) and in contrast with Fullerton et al. (2011) who observed a significant difference (P<0.05) in blood profile of chickens. In the current study, the performance of birds by treating A. indica showed significantly better performance as compared to the control healthy group which coincides with the findings of Okwu et al. (2020) and Kayath et al. (2022) and opposes the findings of Owolabi et al. (2017), Viera et al. (2020) and Ali et al. (2021) who had observed no positive effects of the A. indica supplementation on the bird’s performance. Our findings in terms of W. coagulans are in agreement with those of Kwon and Cho (2015) who concluded that W. coagulans serves as a potent alternative to synthetic compounds to improve broiler performance. Our findings in terms effect of N. sativa treatment on blood parameters is encouraged by Bilal et al. (2020). The liver function enzymes remained unaffected (P>0.05) by N. sativa as documented by Hossain et al. (2021) who stated that N. sativa had no adverse effect on (SGPT, SGOT, and ALP) and may be used as an alternative to antibiotics and as a growth promoter in broiler chickens.
CONCLUSION
The canine diarrhoeic puppies harbour Shiga toxins producing E. coli O157:H7. The higher prevalence of Stx-1 showed pathogenic potential of this strain. Aqueous extract of C. procera exhibited promising antibacterial activity against Shiga toxins producing E. coli O157:H7 among the medicinal plants used (A. indica, M. azedarach, W. coagulans, N. sativa) and may be a potential candidate in drug development for the treatment of Shiga toxins producing E. coli O157:H7 infection. In future, the detailed investigations may be carried out to explore the mode of action, side effects of these medicinal plants, and their safety index, before development and application of plant based drugs to counteract Shiga toxins producing E. coli O157:H7 infection.
ACKNOWLEDGMENTS
The authors acknowledge Miss Sajida Mushtaq (Head of Diagnostics) and Dr. Saba Rafique (Head of Research and Development) at SB Poultry Diagnostic Lab, Rawalpindi for helping in the optimization of PCR. The authors would like to thank the owner of the Dogs for their assistance during sample collection. The authors are also grateful to the Department of Veterinary Medicine staff.
Funding
This study was financially supported by the Higher Education Commission (HEC) of Pakistan for funding us through the National Research Programme for Universities (NRPU) project # (9719/NRPU/R & D/HEC)
IRB approval
The research trial of the study was approved by the Institutional Review Board of UVAS, Lahore, Pakistan. (Letter No. 7522/date: 18-07-2019) .
Ethical statement
The experimental design and protocols of this study were ethically approved by the Institutional Ethical Committee, UVAS Lahore, Pakistan (Letter No. 949/date: 19-09-2019).
Statement of conflict of interest
The authors have declared no conflict of interest.
References
Abdulrazzaq, K.M., Owain, M.S., Majeed, H.M. and Al-Hyani, O.H., 2021. Molecular detection of rfbO157, shiga toxins and hemolysin genes for Escherichia coli O157:H7 from canine feces in Tikrit and Mosul cities. Iraqi J. Vet. Sci., 5: 325-329. https://doi.org/10.33899/ijvs.2020.126831.1392
Algammal, M., Mabrok, M., Ezzat, M., Alfifi, J., Esawy, M., Elmasry, N. and El-Tarabili, M., 2022. Prevalence, antimicrobial resistance (AMR) pattern, virulence determinant and AMR genes of emerging multi-drug resistant Edwardsiella tarda in Nile tilapia and African catfish. Aquaculture, 548: 737-643. https://doi.org/10.1016/j.aquaculture.2021.737643
Ali, E., Islam, M.S., Hossen, M.I., Khatun, M.M. and Islam, M.A., 2021. Extract of neem (Azadirachta indica) leaf exhibits bactericidal effect against multidrug resistant pathogenic bacteria of poultry. Vet. Med. Sci., 7: 1921-1927. https://doi.org/10.1002/vms3.511
Balasubramaniam, P. and Malathi, A., 1992. Comparative study of hemoglobin estimated by Drabkin’s and Sahli’s methods. J. Postgrad. Med., 38: 8. https://doi.org/10.4103/1858-5000.157502
Bien, J., Sokolova, O. and Bozko, P., 2012. Role of uropathogenic Escherichia coli virulence factors in development of urinary tract infection and kidney damage. Prev. Vet. Med., 2012: 681473. https://doi.org/10.1155/2012/681473
Bilal, H., Ali, I., Uddin, S., Khan, I., Said, A., Rahman, M.U., Khan, A.M., Shah, A.B. and Ali, A., 2020. Biological evaluation of antimicrobial activity of Calotropis procera against a range of bacteria. J. Pharmacogn. Phytochem., 9: 31-35.
Boland, K.G., Hayles, A.N., Miller, C.B., Kerr, T., Brown, W.C. and Lahmers, K.K., 2013. Regional immune response to immunization with Escherichia coli O157: H7-derived intimin in cattle. Clin. Vaccine Immunol., 20: 562-571. https://doi.org/10.1128/CVI.00743-12
Candellone, A., Cerquetella, M., Girolami, F., Badino, P. and Odore, R., 2020. Acute diarrhea in dogs: Current management and potential role of dietary polyphenols supplementation. Antioxidants, 9: 7-25. https://doi.org/10.3390/antiox9080725
Carvalho, A.C., Barbosa, A.V., Arais, L.R., Ribeiro, P.F., Carneiro, V.C. and Cerqueira A.M.F., 2016. Resistance patterns, ESBL genes, and genetic relatedness of Escherichia coli from dogs and owners. Braz. J. Microbial., 47: 150–158. https://doi.org/10.1016/j.bjm.2015.11.005
Conrad, C.C., Stanford, K., McAllister, T.A., Thomas, J. and Reuter, T., 2014. Further development of sample preparation and detection methods for O157 and the top 6 non-O157 STEC serogroups in cattle feces. J. Microbial. Methods, 105: 22–30. https://doi.org/10.1016/j.mimet.2014.06.020
Derbal, S. and Niar, A., 2019. Antibacterial activity of honey and Nigella sativa L. seed extracts against animal wound bacteria. Int. J. Vet. Sci., 5: 30-34.
Dhanki, Z.T.M., Al-Enzy, A.F.M. and Al-Hamdani, A.A.Y., 2018. Effect of aqueous extract of Melia azedarach L, Anastatica hierochuntic and enrofloxacin antibiotic on live broiler performance. Eurasia Proc. Sci. Technol. Eng. Math., 3: 110-115.
Dutta, P., Borah, M., Gangil, R. and Singathia, R., 2015. Gross/Histopathological impact of Salmonella gallinarum isolated from layer chickens in Jaipur and their antibiogram assay. Int. J. Adv. Vet. Sci. Tech., 4: 153-159. https://doi.org/10.23953/cloud.ijavst.179
Fullerton, M., Khatiwada, J., Johnson, J.U., Davis, S. and Williams, L.L., 2011. Determination of antimicrobial activity of sorrel (Hibiscus sabdariffa) on Esherichia coli O157: H7 isolated from food, veterinary, and clinical samples. J. Med. Fd., 14: 950-956. https://doi.org/10.1089/jmf.2010.0200
Gülersoy, E., Maden, M., Parlak, T.M. and Sayin, Z., 2022. Comparative evaluation of selected serum and urine biomarkers in cats with interstitial and bacterial cystitis. Vet. Clin. Pathol., pages Pages 1-9. https://doi.org/10.1111/vcp.13174
Hammermuller, J., Kruth, S., Prescott, J. and Gyles, C., 1995. Detection of toxin genes in Escherichia coli isolated from normal dogs and dogs with diarrhea. Can. J. Vet. Res., 59: 265-270.
Haq, I., Hafeez, A. and Khan, R.U., 2020. Protective effect of Nigella sativa and Saccharomyces cerevisiae on zootechnical characteristics, fecal Escherichia coli and hematopoietic potential in broiler infected with experimental colibacillosis. Livest. Sci., 239: 104119. https://doi.org/10.1016/j.livsci.2020.104119
Hasan, M.S., Yousif, A.A. and Alwan, M.J., 2016. Detection of virulent genes in E. coli O157: H7 isolated from puppies and adult dogs by polymerase chain reaction. Res. J. Vet. Pract., 4: 1-6. https://doi.org/10.14737/journal.rjvp/2016/4.1.1.6
Hossain, M.E., Siddiqua, M.T. and Hossain. M.M., 2021. Dietary inclusion of neem leaf powder on growth performance, blood biochemical parameters and profitability of broilers. Bangladesh J. Vet. Anim. Sci., 50: 114-122. https://doi.org/10.3329/bjas.v50i2.58140
Hossain, M.S., Faruk, M.A.Z., Das, D. and Das, S., 2021. Effects of Neem (Azadirachta indica) and Tulsi (Ocimum sanctum) extract in the growth performance of broiler with economics of production. J. Vet. Med. Anim. Sci.,4: 10-66.
Kamruzzaman, M., Bari, S.N. and Faruque, S.M., 2013. In vitro and in vivo bactericidal activity of Vitex negundo leaf extract against diverse multidrug resistant enteric bacterial pathogens. Asian Pac. J. Trop. Med., 6: 352-359. https://doi.org/10.1016/S1995-7645(13)60038-3
Kayath, P., Datt, M., Kumar, L., Chopra, G. and Tetarwal, J.M., 2022. Effect of neem (Azadirachta indica) supplementation on hematological parameter of Kuroiler chicks. Pharma. Innov.,11: 1825-1829.
Khafaji, M.N., Shlash, E.Y., Nayef, A.I. and Shaker, N.S., 2019. Protective effect of aqueous–methanol extract of Melia azedarach against paracetamol–induced hepatitis in rabbits. Diyala J. Pl. Sci., 15: 49-63. https://doi.org/10.24237/djps.15.04.500D
Khan, A.Y., Ahmad, S.S., Avais, M. and Ashraf, K., 2022. Molecular prevalence with associated risk factors and haemato-serum electrolyte analysis of E. coli O157: H7 in Canine pups with diarrhoea. Pak. Vet. J., 42: 2074-7764.
King, T., Lucchini, S., Hinton, J.C. and Gobius, K., 2010. Transcriptomic analysis of Escherichia coli O157: H7 and K-12 cultures exposed to inorganic and organic acids in stationary phase reveals acidulant-and strain-specific acid tolerance responses. Appl. environ. Microbial., 76: 6514-6528. https://doi.org/10.1128/AEM.02392-09
Kiranmayi, C. and Krishnaiah, N., 2010. Detection of Escherichia coli O157:H7 prevalence in foods of animal origin by cultural methods and PCR technique. Vet. World, 3: 13. https://doi.org/10.5455/vetworld.2010.13-16
Kishor, K., Sahni, Y.P., Bhardwaj, J.K., Gautam, V. and Sawarkar, A., 2020. Effect of different fortifications of Panchgavya with Nigella sativa and Asparagus racemosus on growth performance parameters in poultry. J. Pharmacogn. Phytochem., 9: 1821-1825. https://doi.org/10.20546/ijcmas.2020.910.254
Kwon, T. and Cho, S.H., 2015. Draft genome sequence of enterohemorrhagic Escherichia coli O157 NCCP15739, isolated in the Republic of Korea. Genome. Announc., 3: 15. https://doi.org/10.1128/genomeA.00522-15
Lee, C., Kim, S.Y., Eum, S., Paik, J.H., Bach, T.T., Darshetkar, A.M., Choudhary, R.K., Quang, B.H., Thanh, N.T. and Choi, S., 2019. Ethnobotanical study on medicinal plants used by local Van Kieu ethnic people of Bac Huong Hoa nature reserve, Vietnam. J. Ethnopharm.,231: 283-294. https://doi.org/10.1016/j.jep.2018.11.006
Majhool, A.B. and Zenad, K.H., 2021. Histopathological changes associated with infection of mice with shiga toxin producing Escherichia coli (STEC) O157: H7. Annls Rom. Soc. Cell. Biol., 25: 17486-17492.
Melton-Celsa, A.R., 2014. Shiga toxin (Stx) classification, structure, and function. Micro-biol. Spectr., 2: 2–42. https://doi.org/10.1128/microbiolspec.EHEC-0024-2013
Miko, A., Rivas, M., Bentancor, A., Delannoy, S., Fach, P. and Beutin, L., 2014. Emerging types of Shiga toxin-producing E. coli (STEC) O178 present in cattle, deer, and humans from Argentina and Germany. Front. Cell. Infect. Microbial., 4: 78. https://doi.org/10.3389/fcimb.2014.00078
Munir, T., Mohyuddin, A., Khan, Z. and Haq, R., 2017. Exploration of antibacterial potential of Melia azedarach L. Sci. Inquiry Rev., 1: 19-26. https://doi.org/10.29145/sir/11/010103
Natt, M.P. and Herrick, C.A., 1952. A new blood diluent for counting erythrocytes and leucocytes of the chicken. Poul. Sci., 31: 735-738. https://doi.org/10.3382/ps.0310735
Nwokafor, C.V., Udensi, C.G., Ogbonna, H.N., Udekwu, C.E., Nwankpa, U.D., Amanze, E.K., Chibuzor, W.N. and Okeke, K.C., 2020. Antimicrobial activities of moringa, neem and ginger plant extracts against bacteria associated with the spoilage of fruit juice. South Asian J. Res. Microbial., 7: 21-30. https://doi.org/10.9734/sajrm/2020/v7i430179
Okwu, M.U., Imade, O.S., Akpoka, O.A., Olley, M., Izevbuwa, O.E. and Usman, N.A., 2020. Comparative evaluation of the antibacterial effects of Moringa oleifera and Nigella sativa on some clinical bacterial isolates obtained from Igbinedion University, Okada, Nigeria. Biyoloji Bilimleri Araştırma Dergisi, 13: 20-27.
Owolabi, A.O., Abah, K.A. and Oranusi, S.U., 2017. In vitro antimicrobial and antioxidant activity of Carica papaya and Azadirachta indica leaf and stem bark extracts on selected clinical isolates. Ind. J. Sci. Technol., 6: 209-220.
Parihar, G. and Balekar, N., 2016. Calotropis procera: A phytochemical and pharmacological review. Thai J. Pharm. Sci., 40:115-131.
Pitout, J., 2012. Extra-intestinal pathogenic Escherichia coli: A combination of virulence with antibiotic resistance. Front. Microbiol., 3: 9. https://doi.org/10.3389/fmicb.2012.00009
Puño-Sarmiento, J., Medeiros, L., Chiconi, C., Martins, F., Pelayo, J., Rocha, S. and Nakazato, G., 2013. Detection of diarrheagenic Escherichia coli strains isolated from dogs and cats in Brazil. Vet. Microbiol., 166: 676-680. https://doi.org/10.1016/j.vetmic.2013.07.007
Qureshi, S.A., Jahan, M., Lateef, T., Ahmed, D., Rais, S. and Azmi, M.B., 2019. Presence of gallic acid and rutin improve the hepatoprotective strength of Withaniacoagulans. Pak. J. Pharm. Sci., 32:301-308.
Rahman, M., Rahaman, M., Islam, M., Hossain, M., Mannan, M., Ahmed, M., Saldías, M., Akkol, E.K. and Sobarzo-Sánchez, E., 2021. Multifunctional therapeutic potential of phytocomplexes and natural extracts for antimicrobial properties. Antibiotics, 10: 1076. https://doi.org/10.3390/antibiotics10091076
Ramos, C.P., Diniz, A.N., Ribeiro, M.G., Paula, C.L., Costa, É.A., Sonne, L., Pereira, S.T., Lopes, C.E.B., Rennó, M.C., and Silva, R.O.S., 2021. Enteric organisms detected in feces of dogs with bloody diarrhea: 45 cases. Top. Compan. Anim. Med., pp. 100549-100549. https://doi.org/10.1016/j.tcam.2021.100549
Sadek, M., Saad, A.M., Nordmann, P. and Poirel, L., 2022. Genomic characterization of an extensively drug-resistant extra-intestinal pathogenic (ExPEC) Escherichia coli clinical isolate co-producing two carbapenemases and a 16S rRNA Methylase. Antibiotics, 11: 1479. https://doi.org/10.3390/antibiotics11111479
Sadeq, J.N., Al-Mohamed, S.A. and Salim, R.M., 2018. Molecular identification of E. coli virulence factors genes, bfp and elt, in feces of diarrheic chickens. Al-Qadisiyah J. Pure. Sci., 23: 17-29. https://doi.org/10.29350/jops.2018.23.2.734
Samuel, K., and Sudi, Y.I., 2020. Effects of Calotropis procera latex on biochemical and hematological parameters in albino rats. Niger. J. Biotechnol., 37: 94-100. https://doi.org/10.4314/njb.v37i1.10
Sharma, K.R. and Kharel, R., 2019. Antibacterial, antidiabetic and brine shrimp lethality activities of some selected medicinal plants from Kavrepalanchok District of Nepal. J. Inst. Sci. Technol., 24: 57-62. https://doi.org/10.3126/jist.v24i1.24629
Singh, P.K. and Kumar, A., 2018. Effect of dietary black cumin (Nigella sativa) on the growth performance, nutrient utilization, blood biochemical profile and carcass traits in broiler chickens. Anim. Nutr. Feed. Technol., 18: 409-419. https://doi.org/10.5958/0974-181X.2018.00038.0
Subramaniam, G., Sivasamugham, L.A. and Yew, X.Y., 2020. Antibacterial activity of Cymbopogon citratus against clinically important bacteria. S. Afr. J. Chem. Eng., 34: 26-30. https://doi.org/10.1016/j.sajce.2020.05.010
Tavakkoli, A., Mirakzehi, M.T., Saleh, H. and Yousefi, M., 2021. The effects of supplementation of Withania coagulans and α-tocopherol acetate in diets containing oxidised oil on growth performance, immune response and antioxidant indices in broiler chickens. Arch. Anim. Nutr.,75: 278-293. https://doi.org/10.1080/1745039X.2021.1942765
Torkan, S., Bahadoranian, M.A., Khamesipour, F. and Anyanwu, M.U., 2016. Detection of virulence and antimicrobial resistance genes in Escherichia coli isolates from diarrhoiec dogs in Iran. Arch. Med. Vet., 48: 181-190. https://doi.org/10.4067/S0301-732X2016000200008
Vieira, Y.C., Silva, D.A., Marques, A.D.S., Santana, A.P., Murata, L.S. and Perecmanis, S., 2020. Detection of enterotoxin and adhesin genes of Escherichia coli strains isolated from feces of healthy dogs. Acta Vet. Brasil., 14: 1. https://doi.org/10.21708/avb.2020.14.1.8921
Yang, S. and Rothman, R.E., 2004. PCR-based diagnostics for infectious diseases: Uses, limitations, and future applications in acute-care settings. Lancet Infect. Dis., 4: 337-348. https://doi.org/10.1016/S1473-3099(04)01044-8
Zahid, R., Khan, J., Khuram, M. and Khan, M.A., 2020. Local medicinal plants of Pakistan in the fight against gastro-intestinal tract pathogenic bacteria. Pak. J. Biotech.,17: 173-182.