Antibiotic Resistance and Virulence Genes of Vibrio alginolyticus from Asian Seabass in the East Coast of Peninsular Malaysia
Mat Zin Ain-Auzureen1, Maizan Mohamed1, Tan Li Peng1, Mohd Faizal Ghazali2, Choong Siew Shean1, Kamaruddin Mardhiah3, Najiah Musa4, Nora Faten Afifah Mohamad5, Chai Min Hian2 and Ruhil Hayati Hamdan1*
1Faculty of Veterinary Medicine, Universiti Malaysia Kelantan, Pengkalan Chepa, Kelantan; 2School of Animal Science, Aquatic Science and Environment, Faculty of Bioresources and Food Industry, Universiti Sultan Zainal Abidin, Besut, Terengganu; 3Faculty of Entrepreneurship and Business, Universiti Malaysia Kelantan, Taman Bendahara, Pengkalan Chepa, Kelantan; 4Fakulti Perikanan dan Sains Makanan (FPSM), Universiti Malaysia Terengganu, Kuala Nerus, Terengganu; 5Faculty of Agricultural and Forestry, Universiti Putra Malaysia Bintulu Campus, Nyabau Road, Bintulu, Sarawak.
Abstract | Vibrio alginolyticus caused vibriosis and contributed to a major problem in seabass farming. This study aims to determine the antibiotic resistance and virulence genes of V. alginolyticus isolates from Asian seabass in the East Coast of Peninsular Malaysia. A total of 180 Asian seabass was dissected and a loopful of kidney and liver samples were inoculated on thiosulphate-citrate bile-salt sucrose (TCBS) agar and CHROMagarTM Vibrio. Polymerase chain reaction (PCR) was used to identify the isolates and detect the twelve virulence genes associated with V. alginolyticus. Antibiotic resistance tests were conducted using 17 antibiotics. The difference in index scores between locations was tested using one-way ANOVA, while the index scores between (multidrug resistance index) MARi and multi-virulence gene indexes (MVGi) were compared using the Mann-Whitney test. Total of 26 (7.2%) isolates out of 360 organ samples were determined as V. alginolyticus. The observation of external lesions was haemorrhagic eyes, pale skin, detachable scales, pale liver and enlarged spleen. Twenty-six isolates of V. alginolyticus were containing chiA (100%) and 96% of colA genes. None of the isolates possess hlyA, toxRVH, toxRVC, and trh-tdh genes. MVGi were varying from 0.16 to 0.33. In addition, 18 antibiotic resistance patterns were identified, and the MARi ranged from 0.05 to 1. It is alarming that seven out of 12 isolates from Sungai Besut, Terengganu were resistant to all antibiotics tested. The statistical analysis revealed that the mean MARi in Besut, Terengganu was significantly higher than in other locations (P=0.032). Additionally, the index score between MARi and MVGi was found to be significantly different (P=0.013), indicating a possible relationship between the two variables. The outcome of this study may be helpful in elucidating V. alginolyticus pathogenicity and evaluating antibiotics misuse for the development of sustainable disease control methods.
Received | February 21, 2024; Accepted | October 17, 2024; Published | November 11, 2024
*Correspondence | Ruhil Hayati Hamdan, Faculty of Veterinary Medicine, Universiti Malaysia Kelantan, Pengkalan Chepa, Kelantan; Email: [email protected]
Citation | Auzureen, M.Z.A., M. Mohamed, T.L. Peng, M.F. Ghazali, C.S. Shean, K. Mardhiah, N. Musa, N.F.A. Mohamad, C.M. Hian and R.H. Hamdan. 2024. Antibiotic resistance and virulence genes of Vibrio alginolyticus from Asian Seabass in the East Coast of Peninsular Malaysia. Sarhad Journal of Agriculture, 40(Special issue 1): 235-248.
DOI | https://dx.doi.org/10.17582/journal.sja/2024/40/s1.235.248
Keywords | Antibiotic resistance, Malaysia, MAR index value, Multi-virulence gene indexes, Vibrio alginolyticus, Virulence genes
Copyright: 2024 by the authors. Licensee ResearchersLinks Ltd, England, UK.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Introduction
The Asian seabass (Lates calcarifer, Bloch) also known as barramundi has been widely growing in Southeast Asia, and Australia, and has been in Malaysian since the 1970s and essentially cultured for its hardy, fast-growing, and high salinity tolerant (Idris et al., 2022). In the early 1920s, aquaculture in Malaysia has become an important sector in increasing food in local production including in brackish, freshwater, and marine water aquaculture (FAO, 2020). Mohd-Yazid et al. (2021) estimated the economic loss caused by Vibriosis in Asian seabass from the east coast of peninsular Malaysia was at $0.19 per tail per kilogram equal to 7.06% of the total production cost of Asian seabass per kilogram. In recent years, the challenges in maintaining great systems seabass farm were discussed by Ong et al. (2016) such as farmers letting the dead fish in the cages instead of using proper disposal, bacterial disease and protozoan infection, sudden climate changes, and bottom of laguna covered with silt.
Vibriosis has been commonly reported as a marine pathogen that can infect a variety of aquatic animals, specifically Vibrio alginolyticus capable of carrying pathogenic genes that can cause serious septicaemia (Mustapha et al., 2013). Vibrio alginolyticus, a Gram-negative rod bacterium, was considered a harmful infection and pathogenic to humans and aquatic animals (Dong et al., 2020). Many mortalities cases of aquatic animals associated were revealed, including Pacific oyster, sea cage cultured cobia, cultured hybrid grouper, Asian seabass, and cultured European seabass (Krupesha et al., 2012; Korun et al., 2013; Mao et al., 2021; Mohamad et al., 2019; Rameshkumar et al., 2017). In addition, the evolution of V. alginolyticus was associated with human infections, leading to fatal food poisoning, necrotizing soft-tissue, bacteraemia, septic shock, and organ failures (Fu et al., 2016).
The aquaculture sector has become the main economy contributing to farmers and rapidly increasing to fulfill the protein demands around the world. WHO described that antimicrobial resistance (AMR) was caused by the misuse and overuse of antimicrobials in the development of drug-resistance pathogens, lack of clean water and sanitization, and inadequate infection prevention (WHO, 2021). The misuse and abuse of antibiotic drugs among fish farmers in Malaysia are one of the factors contributing to the increasing cases of antimicrobial resistance particularly in aquaculture sectors. The challenging factor arising in aquaculture was fish healthcare like disease control, outbreak infection and antibiotics still being the main tools to prevent the presence of bacteria using multiple types of antibiotics (Kathleen et al., 2016). The expansion of antimicrobial resistance may spread to humans from one ecological niche and result in an increasing number of failures in treatment and life-threatening diseases (Aich et al., 2018). The same authors added that the residual antimicrobial may contribute to human health leading to allergy, toxicity, intestinal flora variation, and health hazards.
Common antibiotic that was resistant was beta-lactam antibiotics like ampicillin, penicillin G, and penicillin (Hernández-Robles et al., 2016; Nurliyana et al., 2019; Zavala-Norzagaray et al., 2015). Thus, bacteria were allowed to exchange their genetic materials to adapt to antibiotic attacks by horizontal gene transfer and gene mutations (Sun et al., 2019). The resistance mechanism of beta-lactams in Gram-negative bacteria was achieved by modifications of their target site, the penicillin-binding protein (PBPs) (Munita and Arias, 2015). Haemolysis, hemagglutination, protease production, polar and lateral flagella, and outer membrane protein A are known to contribute to the virulence of Vibrio (Mao et al., 2021; Zanetti et al., 2000). Vibrio alginolyticus carries a few virulence genes such as collagenase, ompK, toxR in Malaysia (Nor Najwa et al., 2015), toxR, tlh, aspA, clg, flaB, fur, ompW (Yang et al., 2021).
Table 1 was showing the previous studies that have found a high prevalence of V. alginolyticus in aquatic life in Malaysia. Elhadi et al. (2004) mentioned that the seafood markets in Malaysia potentially infected with pathogenic Vibrio species nevertheless the changing season and need for capable consumer measures. For instance, Lee and Wee (2012) reported the correlation between antibiogram of V. alginolyticus bacteria with heavy metal resistance genes were developed after being exposed to heavy metal residues for ambiguous period. Vibriosis has been reported in various fundamental knowledge including history, taxonomy, and epidemiological aspects and control measures of vibriosis (Amalina et al., 2019). The extensive and misuses usage of antibiotic in aquaculture as prevention options in controlling the spread of disease has become the big issues to emergence of antibiotic drug resistance in V. parahaemolyticus (Tan et al., 2020).
Table 1: List of the previous studies that stated the high prevalence of Vibrio infection in aquatic animal in Malaysia.
|
Disease |
Type of aquatic animal |
Location |
References |
|
V. alginolyticus |
Shrimp, squid, crab, cockles, and mussels |
Selangor, Negeri Sembilan, Pulau Pinang, Sarawak (Malaysia) |
Elhadi et al., 2004 |
|
V. alginolyticus |
White leg shrimp (Litopenaeus vannamei) |
Farms at Selangor, Malaysia |
Lee and Wee, 2012 |
|
Vibrio spp. |
Cultured groupers (Epinephelus spp.) |
Peninsular Malaysia |
Amalina et al., 2019 |
|
Vibrio parahaemolyticus |
Blood clams, shrimps, surf clams, and squids |
Wet markets in Selangor, Malaysia |
Tan et al., 2020 |
|
Vibrio alginolyticus |
Cockles (Anadora granosa) |
Seri Kembangan, Seremban, Kuala Terengganu (Malaysia) |
Shahimi et al., 2021 |
In other way to identify the presence of V. alginolyticus strain in cockles, the authors using four antibiotic resistance genes such as penicillin (pbp2a), ampicillin (blaOXA), erythromycin (ermB) and vancomycin (vanB) and the results showed the low percentage due to the V. alginolyticus isolates were not exposed to high-risk sources of antibiotic contamination where antibiotic were often used (Shahimi et al., 2021).
The presence of pathogenic Vibrio infection in varying organisms in Malaysia is a sign of the need for continuous monitoring for food safety and public health. The occurrence of V. alginolyticus infection carrying several virulence genes was crucial globally. V. alginolyticus may cause different clinical symptoms such as septicemia, ophthalmia, corneal opaqueness, melanosis, white spot syndrome on Penaeus vannamei, necrosis and mortality. Hence, this study aimed to identify the drug resistance profile and determine the distribution of virulence genes in Vibrio alginolyticus that was potentially pathogenic and isolated from the Asian seabass in the East Coast of Peninsular Malaysia. Our results may guide local antibiotic use and regulations of disease infection for sustaining a healthy aquaculture environment.
Materials and Methods
Study sites of sampling
Hundred and eighty (180) samples of Asian seabass were randomly collected from six locations in the East Coast region of Peninsular Malaysia. Two commercial farms located in Kelantan are Laguna Semerak (5.86405, 102.497) and Laguna Tumpat (6.21358, 102.13032). Three selected farms in Terengganu are Kuala Setiu (5.64338, 102.75405), Kuala Ibai (5.27562, 103.16258) and Sungai Besut (5.81430, 102.55669). Only one farm in Kuala Pahang, Pahang (3.52887, 103.45147). Samples weighing approximately 300-500g were transferred into an ice box in sterile condition and transported immediately to the Aquatic Animal Health Laboratory, Faculty of Veterinary Medicine, Universiti Malaysia Kelantan.
Isolation of Vibrio alginolyticus
The Vibrio species were isolated by streaking the loopful of liver and kidney (n = 360) of Asian seabass onto TCBS (Oxoid, UK) and CHROMagarTM Vibrio (CHROMagar, France) agar. The plates were incubated at 35°C for 24 to 48 hours. The isolates were preserved in TSB with 50% of glycerol and kept at -80°C for further use. Single presumptive V. alginolyticus colonies were picked for Gram staining, catalase, and oxidase tests.
DNA extraction
The bacterial DNA was extracted using a boiling method by Ahmed and Dablool (2017). Briefly, 1 ml of bacterial culture was centrifuged at 12, 000 rpm for 5 min and discarded the supernatant. The pellet was resuspended with 500 μl of sterile distilled water and vortexed vigorously. Then, the suspension was boiled in a 95°C water bath for 15 min. After that, it was immediately cooled in ice for 15 min. The suspension was centrifuged at 12,000 rpm for 5 min and transferred the supernatant into a new 1.5 ml microcentrifuge tube. The supernatant was stored at -20°C until further use. The DNA was quantified using a nanophotometer P360 class (IMPLEN, Germany).
Bacterial identification using pyrH and designated species-specific primers
The genus identity confirmation of presumptive Vibrio isolates was based on the pyrH gene (Byers et al., 1998; Nurliyana et al., 2019). Then, species-specific primers were used to classify the isolates into V. alginolyticus as shown in Table 2.
Table 2: Primers for the confirmation of Vibrio genus and species.
|
Primers |
Sequences (5’ - 3’) |
Amplicon size (bp) |
Tm |
References |
|
pyrH |
F: GATCGTATGGCTCAAGAAG R: TAGGCATTTTGTGGTCACG |
440 |
59 |
Nurliyana et al. (2019) |
|
Vibrio alginolyticus specific |
F: TCCGTGGTGCAGGCCTTGCT R: TCAACTTTCGTCGCTTTTAGT |
324 |
60 |
In this study |
Tm: Melting temperature, F: Forward, R: Reverse, bp: base pair
Antimicrobial resistance test and multiple antibiotic resistance index (MARi)
Antimicrobial resistance assay was performed with the disk diffusion method according to Clinical and Laboratory Standards Institute guidelines (CLSI, 2015). A total of 17 antibiotic agents (Oxoid, UK) were used such as ampicillin (AMP; 10 μg), cefotaxime (CTX; 30 μg), cefotetan (CTT; 30 μg), chloramphenicol (C; 30 μg), ciprofloxacin (CIP; 5 μg), erythromycin (E; 15 μg), cefepime (FEP; 30 μg), gentamicin (CN; 10 μg), kanamycin (K; 30 μg), cephalothin (KF; 30 μg), nalidixic acid (NA; 30 μg), rifampicin (RD; 5 μg), streptomycin (S; 10 μg), tetracycline (TE; 30 μg), oxytetracycline (OT; 30 μg) trimethoprim/sulfamethoxazole (SXT; 1.25 μg and 23.75 μg ), vancomycin (VA; 30 μg). Briefly, the bacterial culture was suspended in a sterile 0.85 % sodium chloride solution and then coated on Mueller Hinton agar plates. Different antibiotic discs were placed onto the plates and incubated at 35°C for at least 24 hours. The diameter of the inhibition zone was measured, and the results were interpreted according to the Clinical and Laboratory Standards Institute guidelines (CLSI, 2015).
The multiple antibiotic resistance index (MARi) was according to Krumperman (1983), when applied to single isolate was defined A/B, where A represent the number of antibiotics to resistant isolates and B represent the total number of antibiotics tested which the exposed to isolate. MAR indexing of 0.200 was to differentiate between low and high risk of contamination inconsistent. The indices were in a range of ambiguity and careful inspection. MAR value equals or less than 0.2 were determine that the antibiotic seldom or never used on treatment purpose while, MAR index higher than 0.2 stated the animals in high risk of exposure of these antibiotics.
Detection of virulence genes and multiple virulence gene index (MVGi)
Twelve virulence genes were used to evaluate the distribution of virulence genes in V. alginolyticus. The virulence genes used in this study were chitinase (chiA), collagenase (colA), transcriptional regulator (luxR), thermostable direct hemolysin (tdh), thermolabile hemolysin (tlh), trh–tdh related hemolysin, E. coli α-hemolysin (hylA), virulence-correlated gene (vcgEP2 and vcgCP1), recombinant V. vulnificus cytolysin (vvhA), and toxin transcriptional activator; toxRVc and toxRVh (Table 3). The multiple virulence gene indexes by Deng et al. (2020), MVGIs = the number of virulence genes detected in one strain/total number of detected virulence genes).
The PCR was performed in 25 μl per reaction containing 12.5 μl of Master Mix (Promega, USA), 1.0 μl of each primer (10 μM), 2.0 μl of DNA template, and 8.5 μl of nucleus-free water. The amplification was performed using a thermal cycler (BioRad, USA), and the PCR products were assessed with 1.5% agarose gel electrophoresis.
Data analysis
To test for differences in the index scores between multiple locations, one-way ANOVA was performed, while the Mann-Whitney test was used to compare the index scores between two variables, namely MARi and MVGi. Normality and equal variance assumptions were checked using the graphical histogram and Levene’s test, respectively. The mean and standard deviation were calculated for the normally distributed data while the mean rank was calculated for the skewed distribution data. Error bars plot was used to visualise the variability of the data according to the locations. The data was analysed using IBM SPSS version 27 with a statistical significance level set as 0.05.
Results and Discussion
Isolation and identification of V. alginolyticus from Asian seabass
In this study, Vibrio species were isolated from farmed Asian seabass in three regions such as Kelantan, Terengganu, and Pahang in the East Coast of
Table 3: Primers were used for the identification of virulence factors of Vibrio species in this study.
|
Primer sequences (5’ - 3’) |
Amplicon size (bp) |
Tm |
References |
|
|
tdh |
F: GTAAAGGTCTCTGACTTTTGGAC R: TGGAATAGAACCTTCATCTTCACC |
269 |
58 |
Nurliyana et al. 2019 |
|
tlh |
F: AAAGCGGATTATGCAGAAGCACTG R: GCTACTTTCTAGCATTTTCTCTGC |
448 |
58 |
|
|
trh-tdh |
F: TTGGCTTCGATATTTTCAGTATCT R: CATAACAAACATATGCCCATTTCCG |
500 |
46 |
|
|
hlyA |
F: GGCAAACAGCGAAACAAATACC R: CTCAGCGGGCTAATACGGTTTA |
738 |
55 |
|
|
vcgEP2 |
F: CTCAATTGACAATGATCT R: CGCTTAGGATGATCGGTG |
278 |
47 |
Fri et al. 2017 |
|
vcgCP1 |
F: AGCTGCCGATAGCGATCT R: CGCTTAGGATGATCGGTG |
278 |
56 |
|
|
chiA |
F: CTCAAGGTGTTTGGGAAGATG R: GTTGATGCCAGTGTTGTTCG |
83 |
55 |
Deng et al. 2020 |
|
luxR |
F: GTGGTTCGTCAATTCTCGAAC R: CGAATAGTGGCCACACTTC |
178 |
55 |
|
|
toxRVC |
F: ATGTTCGGATTAGGACAC R: TACTCACACACTTTGATGGC |
883 |
53 |
|
|
toxRVH |
F: GAAGCAGCACTCACCGAT R: GGTGAAGACTCATCAGCA |
382 |
55 |
|
|
colA |
F: CGAGTACAGTCACTTGAAAGCC R: CACAACAGAACTCGCGTTACC |
737 |
55 |
Di Pinto et al. 2006 |
|
vvhA |
F: TTCCAACTTCAAACCGAACTATGAC R: ATTCCAGTCGATGC-GAATACGTTG |
205 |
60 |
Bonny et al. 2018 |
Tm: Melting temperature, F: Forward, R: Reverse, bp: base pair.
Peninsular Malaysia, performed antibiotic resistance tests, and the presence of the virulence genes. Besides that, V. alginolyticus is a natural disease in environment that could causes clinical symptoms such as septicemia, haemorrhaging, dark skin, and ulcers on the skin surface Balebona et al. (1998). A total of 26 (7.2%) isolates from 360 organ samples such as the liver and kidney of Asian seabass were determined as V. alginolyticus. Most of the pathogen of V. alginolyticus was isolated from skin ulcers, and internal organs of diseased or freshly died fish (Emam et al., 2019). Vibrio alginolyticus caused mortality rate were high in the egg-rearing and larval stages, symptoms of anorexia, low vitality, epidermal bleeding, ulcerated tail shaft into the muscles, swollen spleens, are able to trigger the immune system (Yanuhar et al., 2022).
Generally, V. alginolyticus is a halophilic organism and categorised as biotype 2 of V. parahaemolyticus (Citil et al., 2015). It is widely found in seafood, seawater, and undercooked foods that may cause serious diseases including acute gastrointestinal malfunctions. Malaysia has a tropical climate of 28°C, has the most Vibriosis outbreaks recorded and V. alginolyticus was one of the most frequently isolated (Deng et al., 2020). The fish sampling was conducted randomly for each farm thus, clinical signs were observed only on diseased or unhealthy fish. The external lesions observed included haemorrhagic eyes, pale skin, detachable scales, pale liver, and enlarged spleen (Figure 1).
These bacteria are transmitted through water contamination or direct contact and cause exophthalmia, wounds, septicemia, opaque eyes, and fatal disease (Yanuhar et al., 2022). In this study, these bacterial species were evaluated from TCBS and CHROMagarTM Vibrio agar which showed yellow and whitish colonies (Figure 2). PCR with specific primers targeting the housekeeping gene pyrH was used to detect the Vibrio spp., with a focus on the selected species V. alginolyticus. Ahmed et al. (2015) mentioned the differences of markers that were suitable in the detection of Vibrio spp. are groEL, and heat shock protein gene. The sequences of the pyrH gene act as a degree of relatedness and detect the possible transmission routes in Vibrio spp. isolates (Nurliyana et al., 2019). pyrH genes were common markers used
in PCR and multi-locus sequence analysis (MLSA) in determining the taxonomy diversity of Vibrio spp. (Amalina et al., 2019). Among the strains of V. alginolyticus, 11 samples were isolated from Laguna Semerak while 3 were isolated from Kuala Ibai and 12 from Sungai Besut (Table 5). Previous study showed that many cases of V. alginolyticus infection in marine and aquaculture developed from various organisms including farmed seahorse in China (Xie et al., 2020), Pacific oyster in China (Yang et al., 2021), Oreochromis niloticus in Egypt (El-Sayed et al., 2019) seabass in Malaysia (Auzureen et al., 2022) and Penaeus monodon in Bangladesh (Hannan et al., 2019). Letchumanan et al. (2019) added that the food safety in seafood and environmental samples has been declining since the increasing cases involving the detection of antibiotic resistance strains in Malaysia.
Antimicrobial susceptibility profile of V. alginolyticus
Seventeen types of antibiotics were used to regulate the antibiotic resistance profiles. The results showed high resistance of more than 50% to vancomycin (88.4%), ampicillin (84.6%), cephalothin (65.3%), streptomycin (61.5%) and cefotaxime (53.8%); moderate resistance (10-50%) were all the remaining,
Table 4: Antimicrobial profiles of V. alginolyticus towards difsferent classes of antibiotics.
|
Antibiotic class |
Antimicrobials |
Antimicrobial profiles (N) |
Resistance (%) |
||
|
Resistant |
Intermediate |
Sensitive |
|||
|
Penicillin |
Ampicillin (AMP) |
22 |
0 |
4 |
84.6 |
|
Phenicols |
Chloramphenicol (C) |
7 |
1 |
18 |
26 |
|
Fluoroquinolones |
Ciprofloxacin (CIP) |
8 |
3 |
15 |
30.7 |
|
Aminoglycoside |
Gentamicin (CN) |
11 |
3 |
12 |
42.3 |
|
Kanamycin (K) |
9 |
4 |
13 |
34.6 |
|
|
Streptomycin (S) |
16 |
5 |
5 |
61.5 |
|
|
Cephalosporins |
Cefotetan (CTT) |
7 |
2 |
17 |
26 |
|
Cefotaxime (CTX) |
14 |
6 |
6 |
53.8 |
|
|
Cefepime (FEP) |
9 |
10 |
7 |
34.6 |
|
|
Cephalothin (KF) |
17 |
2 |
7 |
65.3 |
|
|
Macrolide |
Erythromycin (E) |
11 |
12 |
3 |
42.3 |
|
Quinolone |
Nalidixic acid (NA) |
8 |
2 |
16 |
30.7 |
|
Antimycobacterials |
Rifampicin (RD) |
10 |
10 |
6 |
38.4 |
|
Tetracyclines |
Tetracycline (TE) |
7 |
1 |
18 |
26 |
|
Oxytetracycline (OT) |
8 |
1 |
17 |
30.7 |
|
|
Sulfonamide |
Trimethoprim/sulfamethoxazole (SXT) |
8 |
1 |
17 |
30.7 |
|
Glycopeptide |
Vancomycin (VA) |
23 |
1 |
2 |
88.4 |
N: Total isolates of antimicrobial profile, %: Percentage.
Table 5: Resistance phenotype with multiple antibiotic resistance (MAR) index, presence of virulence genes and multiple virulence gene (MVG) index in V. alginolyticus isolated from the East Coast of Peninsular Malaysia.
|
No |
ID |
Location |
Resistance phenotype |
MARi |
Virulence gene |
MVGi |
|
1. |
VAK1 |
Laguna Semerak, Kelantan |
AMP-KF-S-VA |
0.23 |
chiA-colA-vcgEP2-vvhA |
0.33 |
|
2. |
VAK2 |
AMP-CTX-KF-VA |
0.23 |
chiA-tdh |
0.16 |
|
|
3. |
VAK3 |
AMP-CN-CTX-KF-S-VA |
0.35 |
chiA-colA-vcgCP1- tlh |
0.33 |
|
|
4. |
VAK4 |
AMP-CN-CTX-E-FEP-K-RD-S-VA |
0.52 |
chiA- colA- tdh- tlh |
0.33 |
|
|
5. |
VAK5 |
AMP- KF-VA |
0.17 |
chiA- colA- tlh |
0.25 |
|
|
6. |
VAK6 |
AMP-S-VA |
0.17 |
chiA- colA |
0.16 |
|
|
7. |
VAK7 |
AMP-CN-CTX-E-KF-VA |
0.35 |
chiA- colA |
0.16 |
|
|
8. |
VAK8 |
AMP-CN-CIP-KF-S-VA |
0.35 |
chiA-colA-vcgEP2- tlh |
0.33 |
|
|
9. |
VAK9 |
AMP-K-KF-VA |
0.23 |
chiA- colA |
0.16 |
|
|
10. |
VAK10 |
AMP-CTX-E-FEP-KF-S-VA |
0.41 |
chiA- colA |
0.16 |
|
|
11. |
VAK11 |
AMP-S-VA |
0.17 |
chiA-colA-vcgEP2- tlh |
0.33 |
|
|
12. |
VAT12 |
Kuala Ibai, Terengganu |
CTX-S-SXT |
0.17 |
chiA- colA |
0.16 |
|
13. |
VAT13 |
AMP-E-NA-RD-VA |
0.29 |
chiA- colA- tlh |
0.25 |
|
|
14. |
VAT14 |
CTX-FEP |
0.12 |
chiA- colA |
0.16 |
|
|
15. |
VAT15 |
Besut, Terengganu |
AMP-C-CN-CIP-CTT-CTX-E-FEP-K-KF-NA-OT-RD-S- SXT-TE-VA |
1 |
chiA- colA |
0.16 |
|
16. |
VAT16 |
AMP-C-CN-CIP-CTT-CTX-E-FEP-K-KF-NA-OT-RD-S-SXT- TE-VA |
1 |
chiA- colA |
0.16 |
|
|
17. |
VAT17 |
AMP-C-CN-CIP-CTT-CTX-E-FEP-K-KF-NA-OT-RD-S-SXT-TE-VA |
1 |
chiA-colA-luxR-vcgEP2 |
0.33 |
|
|
18. |
VAT18 |
AMP-C-CN-CIP-CTT-CTX-E-FEP-K-KF-NA-OT-RD-S-SXT- TE-VA |
1 |
chiA- colA-luxR |
0.25 |
|
|
19. |
VAT19 |
NA-VA |
0.12 |
chiA- colA- luxR |
0.25 |
|
|
20. |
VAT20 |
AMP-KF-VA |
0.17 |
chiA- colA |
0.16 |
|
|
21. |
VAT21 |
AMP-VA |
0.12 |
chiA- colA |
0.16 |
|
|
22. |
VAT22 |
OT |
0.05 |
chiA- vcgCP1 |
0.16 |
|
|
23. |
VAT23 |
AMP-KF-RD-S-VA |
0.29 |
chiA- colA- tlh |
0.25 |
|
|
24. |
VAT24 |
AMP-C-CN-CIP-CTT-CTX-E-FEP-K-KF-NA-OT-RD-S-SXT-TE-VA |
1 |
chiA- colA |
0.16 |
|
|
25. |
VAT25 |
AMP-C-CN-CIP-CTT-CTX-E-FEP-K-KF-NA-OT-RD-S-SXT-TE-VA |
1 |
chiA- colA |
0.16 |
|
|
26. |
VAT26 |
AMP-C-CN-CIP-CTT-CTX-E-FEP-K-KF-NA-OT-RD-S-SXT-TE-VA |
1 |
chiA- colA |
0.16 |
42.3% (erythromycin and gentamicin), 38.4% (rifampicin), 34.6% (cefepime and kanamycin), 30.7% (ciprofloxacin, oxytetracycline, trimethoprim/sulfamethoxazole, and nalidixic acid), and 26.9% (tetracycline, cefotetan, and chloramphenicol). Even though V. alginolyticus infection is still sensitive to most antibiotics, it is highly resistant to penicillin, erythromycin, vancomycin, ampicillin, sulfisoxazole, and sulphonamides antibiotics (Cai et al., 2022). Our result agreed with Kang et al. (2016) and Cai et al. (2022) that stated V. alginolyticus is highly resistant to ampicillin and vancomycin. In other study by Sun et al. (2024) revealed that V. alginolyticus has similar outcome for high level of ampicillin resistance with 93.75% from 128 samples included seafood and freshwater products that was collected across China. In addition, more than 80% of Vibrio spp. isolates including V. alginolyticus were susceptible to tetracycline and streptomycin (Amalina et al., 2019).
Seventeen different antibiotic resistance profile patterns were observed (Table 5). In this present study, the MAR indexes ranged between 0.05 to 1, and the MAR index of more than 0.2 was considered as exposure to high-risk infection sources like humans, commercial poultry farms, swine, and dairy cattle (Noorlis et al., 2011). Srinivasan and Ramasamy (2009) suggested that the high resistance percentage in the penicillin group, 97% in aquaculture of Vibrio spp. may be due to the continuous use of medicated feeds which may lead to the dissemination of virulent and resistant pathogens into the environment and can affect the antibiotic resistance patterns of other microorganism. The excessive use of antibiotics on microorganisms in aquatic environments may cause the drugs to remain in natural environments through bioaccumulation and have a gradual deposition in sediments or aquatic surfaces (Caroline et al., 2021). Different with Shahimi et al. (2021) had a low percentage of antibiotic resistance in V. alginolyticus due to the lack of information from animal sources or aquaculture in their study area.
Regarding the antibiotic sensitivity test of V. alginolyticus, it was observed for chloramphenicol and tetracycline with 69.2% and this result was in accordance with the finding of Korun et al. (2013). This study indicated that chloramphenicol and tetracycline antibiotics were still effective in counteracting this infectious disease (Yuidiati et al., 2021) but chloramphenicol was banned in Malaysia. Table 4 of the MAR index value showed seven isolates have a full resistance to antibiotics. Antibiotic resistance characterization analysis indicated that 65.3% of the total isolates had a MAR index of more than 0.2. Yu et al. (2023) showed that a similar 63.5% of Vibrio isolates showed a MAR index of more than 0.2 under the shrimp (P. vannamei) breeding system in China.
Antibiotic resistance was emerging mechanism happened worldwide, it occurred when there are changes of bacteria that antibiotic have no ability to destroy nor stop the infection growth. Thus, it is becoming extremely harder to treat. The study by Colavecchio et al. (2017) stated that the viability of phage-mediated transduction by bacteriophages was found to be a contributor to the propagation of antibiotic-resistance genes as well as environmental factors in foodborne pathogens.
Distribution of virulence genes in V. alginolyticus isolates
Vibrio spp. disease infection was arising and caused the losses and economic impact thus it is important to study the virulence factors and pathogenic mechanism of the bacteria since there are no effective methods of controlling the infection and these factors allows bacteria to infect and damage hosts (Deng et al., 2020). The pathogenicity characters of bacteria was essential and were fixed on the identification of virulence factors. The releases microbiological product that can enter the host cell and use their mechanisms to contribute to the acquisition of infection (Yu et al., 2023). The previous study done by Yu et al. (2023) detected chiA and luxR genes in V. alginolyticus which agree with our study.
From this study, eight virulence genes were detected among V. alginolyticus isolates out of 12 (Table 5) that showed a risk potential of infection in Asian seabass. Yu et al. (2023) had a high detection rate between 11.4 and 100% of Vibrio spp. in P. vannamei breeding system in China that had a potential of carrying and transmitting virulence genes. chiA, luxR, toxR and vhh of virulence genes were widely found among pathogenic V. harveyi (Ruwandeepika et al., 2010). Meanwhile, chiA2 were found in V. cholerae mainly on the chitinous surface of copepods and utilise chitin as the sole carbon and nitrogen source to survive in intestines and in pathogenesis (Mondal et al., 2014). All isolates of V. alginolyticus possess of chiA, while 92% isolates have detected colA among virulence genes tested (Figure 3). Chitinase are chitin-degrading enzymes, it was produced by numerous bacterial species synthesize chitinases to decompose ambient chitin for nutritional purposes (Devlin and Behnsen, 2023). The coexistence of chitinase production (virulence genes) and antibiotic resistance in bacteria especially like in Vibrio played a significant role in ecological and pathogenicity. Simultaneously, these bacteria may possess antibiotic resistance genes, which grant a survival advantage in environments where antibiotics are present (Thompson et al., 2001). Similarly, Gobarah et al. (2022) mentioned that 100% of V. alginolyticus isolates from different types of fish carried the collagenase gene. Collagenase were utilized as biomarker in identification of V. alginolyticus in molecular specifically, and enable to degrading the conjunctive tissue, the basal epithelial membrane could lead to pathological of intestinal and blood stream of dissemination. The high detection of colA virulence genes could be due to pathogenic Vibrio species that was able to accelerate the bacterial dissemination and facilitate the diffusion of other toxins through hydrolysis of collagenous components (Galvis et al., 2021).
This study showed that tlh were distributed among V. alginolyticus with seven isolates (26.9%), five from Semerak and one from both Kuala Ibai and Sungai Besut. The tlh gene encodes thermostable direct hemolysin, while the tdh gene is thermostable direct haemolysin that has the virulence factors in V. parahaemolyticus (Hasrimi et al., 2018). Vibrio alginolyticus was formerly regarded as biotype 2 of V. parahaemolyticus and both infections are known as increasing pathogenic aquatic vibrio disease including V. vulnificus (Xu et al., 2017). Four isolates (15.3%) were detected to carry vcgEP2, three isolates detected on luxR, two isolates (7.69%) carried tdh and one sample isolates was detected in vcgCP1 and vvhA. The remaining virulence genes (hlyA, trh-tdh, toxRVc and toxRVh) were not detected from all isolates. Up to four virulence genes were detected in six isolates, with the MVG index ranging from 0.16 to 0.33 (Table 5). Virulence factors found on mobile genetic components can transform harmless bacteria into dangerous pathogens by horizontal gene transfer (Deng et al., 2020). High detection rate of virulence genes showed that V. alginolyticus can be seen carrying virulence genes and may be widespread specifically in aquatic animal and environment, this should be taken seriously from all perspective.
Statistical analysis
Comparison of multiple antibiotic resistance (MAR) indexes and presence of virulence genes and multiple virulence genes (MVG) index based on locations.
A total of 11, 3, and 12 resistance phenotypes were found in Laguna Semerak, Kuala Ibai, and Besut, respectively. It was shown that the mean of MARi was statistically higher in Besut, Terengganu (Mean = 0.65, SD = 0.44) compared to the mean of MARi in Laguna Semerak, Kelantan (Mean=0.29, SD=0.11), with P = 0.032. There was no statistically significant difference in MVGi based on locations (P > 0.05) (Figure 4). Statistical analysis showed that the host species which is V. alginolyticus and sampling location showed negative correlation between the presence of virulence gene detected and antibiotic resistance profiles.
Table 6: Comparison of index score between MARi and MVGi (n= 52).
|
Group |
Mean rank |
z-statistics |
P-valueb |
|
MARi |
31.65 |
-2.490 |
0.013 |
|
MVGi |
21.35 |
bMann-whitney test sapplied; normality assumption not fulfilled.
Comparison of multiple antibiotic resistance (MAR) index and presence multiple virulence genes (MVG) index seen in V. alginolyticus isolates in East Coast of Peninsular Malaysia
There was a statistically significant difference in an index score of three locations and antibiotic resistance between MARi and MVGi (P<0.05) on Table 6. The result indicated that the mean of MARi was higher compared to MVGi, with 31.65 and 21.35, respectively. The significantly higher mean of MARi suggested that the Vibrio alginolyticus bacteria being analyzed possess a considerable level of antibiotic resistance compared to their virulence capacity as indicated by MVGi. This could have several implications such as clinical implications and environmental factors. High antibiotic resistance challenged for treatment purposes that could be difficult to manage the survival of antibiotic therapies thus, the continuing monitor and other approaches of treatment were highlighted. The extensive use of antibiotics in aquaculture may lead to a predominance of resistant strains, while the relatively lower MVGi indicates that these strains might not have a high capacity for virulence (Bobate et al., 2023).
Conclusions and Recommendations
The distribution, antimicrobial resistance profile and virulence genes of V. alginolyticus isolated from the Asian seabass cultured in the East Coast of Peninsular Malaysia were documented. Vibrio alginolyticus was detected in a high number of pathogenic infections and had a potential risk of carrying and transmitting virulence genes. The highest antimicrobial resistance were vancomycin and ampicillin, this could be the future global threat of antibiotic usage and must be taken into consideration. These findings highlight the importance of sustainable and responsible practices in aquaculture for food safety and public health.
Acknowledgments
This work was supported by Fundamental Research Grant Scheme (FRGS): FRGS/1/2019/WAB01/UMK/03/1 from The Ministry of Higher Education (MOHE), Malaysia. This research is under Aquatic Animal Medicine Cluster, Faculty of Veterinary Medicine, Universiti Malaysia Kelantan.
Novelty Statement
The novelty of the research resides in the contribution of Vibrio alginolyticus in the Asian seabass from the East Coast of Peninsular Malaysia. This study also focused on antibiotic resistance distribution and the variance of detected virulence genes of V. alginolyticus.
Author’s Contribution
Mat Zin Ain-Auzureen, Kamaruddin Mardhiah and Ruhil Hayati Hamdan: Writing the manuscript.
Mat Zin Ain-Auzureen, Nora Faten Afifah Mohamad, Ruhil Hayati Hamdan and Maizan Mohamed: Planned and conducted the experiment.
Mohd Faizal Ghazali, Chai Min Hian, Choong Siew Shean, Najiah Musa and Tan Li Peng: Data interpretation.
Choong Siew Shean, Najiah Musa and Tan Li Peng: Review of literature.
Kamaruddin Mardhiah: Statistical analysis.
Nora Faten Afifah Mohamad and Ruhil Hayati Hamdan: Supervision.
Ethics statement
This research was conducted under the ethical evaluation of the Animal Care and Use Committee of the Faculty of Veterinary Medicine, Universiti Malaysia Kelantan. The ethical code number is UMK/FPV/ACUE/PG/4/2021.
Conflict of interest
The authors have declared no conflict of interest.
References
Ahmed, O.B. and A.S. Dablool. 2017. Quality improvement of the DNA extracted by boiling method in Gram negative bacteria. Int. J. Bioass., 6(4): 5347–5349. https://doi.org/10.21746/ijbio.2017.04.004
Ahmed, R., S.M. Rafiquzaman, M.T. Hossain, J.M. Lee and I.S. Kong. 2015. Species-specific detection of Vibrio alginolyticus in shellfish and shrimp by real-time PCR using the groEL gene. Aquacult. Int., 24(1): 157–170. https://doi.org/10.1007/s10499-015-9916-5
Aich, N., N. Ahmed and A. Paul. 2018. Issues of antibiotic resistance in aquaculture industry and its way forward. Int. J. Curr. Microbiol. Appl. Sci., 7(8): 26–41. https://doi.org/10.20546/ijcmas.2018.708.004
Amalina, N.Z., S. Santha, D. Zulperi, M.N.A. Amal, M.T. Yusof, M. Zamri-Saad and M.Y. Ina-Salwany. 2019. Prevalence, antimicrobial susceptibility and plasmid profiling of Vibrio spp. isolated from cultured groupers in Peninsular Malaysia. BMC Microbiol., 19(251): 1–15. https://doi.org/10.1186/s12866-019-1624-2
Auzureen, A.M.Z., M.S. Michael, M. Mohamed, T.L. Peng, F. Fauzi, N.F.A. Mohamad, N.S. Ahmad, C.W. Salma and H.H. Ruhil. 2022. Detection of pathogenic Vibrio species and antibiogram activity in Asian Seabass (Lates calcarifer) in Tumpat, Kelantan. Trop. Biomed., 39(4): 569-574. https://doi.org/10.47665/tb.39.4.013
Balebona, M.C., M.J. Andreu, M.A. Bordas, I. Zorrilla, M.A. Moriñigo and J.J. Borrego. 1998. Pathogenicity of Vibrio alginolyticus for cultured gilt-head sea bream (Sparus aurata L.). Appl. Environ. Microbiol., 64(11): 4269–4275. https://doi.org/10.1128/AEM.64.11.4269-4275.1998
Bobate, S., S. Mahalle, N.A. Dafale and A. Bajaj. 2023. Emergence of environmental antibiotic resistance: Mechanism, monitoring and management. Environ. Adv., 13: 100409. https://doi.org/10.1016/j.envadv.2023.100409
Bonny, S.Q., M.A.M. Hossain, T.K. Lin and M.E. Ali. 2018. Multiplex MPN-PCR for the enumeration of three major Vibrio in raw fishes in Malaysia. Fd. Contr., 90: 459–465. https://doi.org/10.1016/j.foodcont.2018.02.034
Byers, H.K., E. Stackebrandt, C. Hayward and L.L. Blackall. 1998. Molecular investigation of a microbial mat associated with the great artesian basin. FEMS Microbiol. Ecol., 25(4): 391–403. https://doi.org/10.1111/j.1574-6941.1998.tb00491.x
Cai, H., J. Yu, Q. Li, Y. Zhang and L. Huang. 2022. Research progress on virulence factors of Vibrio alginolyticus: A key pathogenic bacteria of sepsis. IntechOpen.
Caroline, A.A.L., S.M. Silva, R.A.Q. Cavalcanti de Sá, A.V.A. Lima, A.V. Barbosa, J.S. Silva and M.B.M. Oliveira. 2021. Effects of antibiotics on impacted aquatic environment microorganisms. IntechOpen.
Citil, B.E., S. Derin, F. Sankur, M. Sahan and M.U. Citil. 2015. Vibrio alginolyticus associated chronic myringitis acquired in Mediterranean Waters of Turkey. Case reports in infectious diseases: pp. 187212. https://doi.org/10.1155/2015/187212
Colavecchio, A., B. Cadieux A. Lo and L.G. Goodridge. 2017. Bacteriophages contribute to the spread of antibiotic resistance genes among foodborne pathogens of the Enterobacteriaceae family. A review. Front. Microbiol., 8: 1–13. https://doi.org/10.3389/fmicb.2017.01108
CLSI, 2015. Performance standards for antimicrobial susceptibility testing; Twenty-Second Informational Supplement Clinical and Laboratory Standards Institute. In CLSI document M100-S16CLSI, Wayne, PA.
Deng, Y., L. Xu, H. Chen, S. Liu, Z. Guo, C. Cheng, H. Ma and J. Feng. 2020. Prevalence, virulence genes, and antimicrobial resistance of Vibrio species isolated from diseased marine fish in South China. Sci. Rep., 10(14329): 1–8. https://doi.org/10.1038/s41598-020-71288-0
Devlin, J.R. and J. Behnsen. 2023. Bacterial chitinases and their role in human infection. Infect. Immun., 91(7). https://doi.org/10.1128/iai.00549-22
Di Pinto, A., G. Ciccarese, M. Fontanarosa, V. Terio and G. Tantillo. 2006. Detection of Vibrio alginolyticus and Vibrio parahaemolyticus in shellfish samples using collagenase-targeted multiplex-PCR. J. Food Saf., 26(2): 150–159. https://doi.org/10.1111/j.1745-4565.2006.00039.x
Dong, Y., P. Zhao, L. Chen, H. Wu, X. Si, X. Shen, H. Shen, Y. Qiao, S. Zhu, Q. Chen, W. Jia, J. Dong, J. Li and S. Gao. 2020. Fast, simple and highly specific molecular detection of Vibrio alginolyticus pathogenic strains using a visualized isothermal amplification method. BMC Vet. Res., 16(76): 1–12. https://doi.org/10.1186/s12917-020-02297-4
Elhadi, N., S. Radu, C.H. Chen and M. Nishibuchi. 2004. Prevalence of potentially pathogenic Vibrio species in the seafood marketed in Malaysia. J. Food Prot., 67(7): 1469–1475. https://doi.org/10.4315/0362-028X-67.7.1469
El-Sayed, M.E., A.M. Algammal, M.E. Abouel-Atta, M. Mabrok and A.M. Emam. 2019. Pathogenicity, genetic typing, and antibiotic sensitivity of Vibrio alginolyticus isolated from Oreochromis niloticus and Tilapia zillii. Rev. Med. Vet., 170(4–6): 80–86.
Emam, A.M., M. Hashem, A.O. Gadallah and M. Haridy. 2019. An outbreak of Vibrio alginolyticus infection in aquarium-maintained dark-spotted (Himantura uarnak) and Tahitian stingrays. Egypt. J. Aquat. Res., 45(2): 153-158. https://doi.org/10.1016/j.ejar.2019.05.003
FAO, 2020. Malaysia national aquaculture sector overview. FAO Fisheries Division [Online], pp. 1–16. http://www.fao.org/fishery/countrysector/naso_malaysia/en
Fu, K., J. Li, Y. Wang, J. Liu, H. Yan, L. Shi and L. Zhou. 2016. An innovative method for rapid identification and detection of Vibrio alginolyticus in different infection models. Front. Microbiol., 7: 1–10. https://doi.org/10.3389/fmicb.2016.00651
Fri, J., R.N. Ndip, H.A. Njom and A.M. Clarke. 2017. Occurrence of virulence genes associated with human pathogenic Vibrios isolated from two commercial Dusky Kob (Argyrosmus japonicus) farms and Kareiga Estuary in the Eastern Cape Province, South Africa. Int. J. Environ. Res. Publ. Health, 14(10): 1111. https://doi.org/10.3390/ijerph14101111
Hannan, M.A., M. Rahman, N. Mondal, S.C. Deb, G. Chowdhury and T. Islam. 2019. Molecular identification of Vibrio alginolyticus causing Vibriosis in shrimp and its herbal remedy. Pol. J. Microbiol., 68(4): 429–438. https://doi.org/10.33073/pjm-2019-042
Galvis, F., J.L. Barja, M.L. Lemos and M. Balado. 2021. The vibriolysin-like protease vnpA and the collagenase colA are required for full virulence of the bivalve mollusks pathogen Vibrio neptunius. Antibiotics, 10(4): 391. https://doi.org/10.3390/antibiotics10040391
Gobarah, D.E.A., S.M. Helmy, N.B. Mahfouz, H.A. Fahmy and M. Zeid. 2022. Virulence genes and antibiotic resistance profile of Vibrio species isolated from fish in Egypt. Vet. Res. Forum, 13(3): 315–321.
Hasrimi, A.N., A. Budiharjo and S.N. Jannah. 2018. Detection of tlh and tdh genes in Vibrio parahaemolyticus inhabiting farmed water ecosystem used for L. vannamei aquaculture. J. Phys. Conf. Ser., 1025(1). https://doi.org/10.1088/1742-6596/1025/1/012058
Hernández-Robles, M.F., A.K. Álvarez-Contreras, P. Juárez-García, I. Natividad-Bonifacio, E. Curiel-Quesada, C. Vázquez-Salinas and E.I. Quiñones-Ramírez. 2016. Virulence factors and antimicrobial resistance in environmental strains of Vibrio alginolyticus. Int. Microbiol., 19(4): 191–198.
Idris, S.M., W.N.M. Noordin, F.O. Manah and A. Hamzah. 2022. Toward systematic breeding of Asian sea bass, Lates calcarifer (Bloch, 1790), in Malaysia: Status, challenges and prospects for future development. Asian Fish. Sci., 35(1): 1–12. https://doi.org/10.33997/j.afs.2022.35.1.001
Kang, C.H., Y. Shin, S. Jang, Y. Jung, and J.S. So. 2016. Antimicrobial susceptibility of Vibrio alginolyticus isolated from oyster in Korea. Environ. Sci. Pollut. Res. Int., 23(20): 21106–21112. https://doi.org/10.1007/s11356-016-7426-2
Kathleen, M.M., L. Samuel, C. Felecia, E.L. Reagan, A. Kasing, M. Lesley and S.C. Toh. 2016. Antibiotic resistance of diverse bacteria from aquaculture in Borneo. Int. J. Microbiol., (Vol): 2164761. https://doi.org/10.1155/2016/2164761
Korun, J., A.G. Ince and M. Karaca. 2013. Antibiotic resistance and plasmid profile of Vibrio alginolyticus Strains isolated from cultured European sea bass (Dicentrarchus Labrax L.). Bull. Vet. Inst. Pulawy, 57(2): 173–177. https://doi.org/10.2478/bvip-2013-0032
Krumperman, P.H., 1983. Multiple antibiotic resistance indexing of Escherichia coli to identify high-risk sources of faecal contamination of foods. Appl. Environ. Microbiol., 46(1): 163–170. https://doi.org/10.1128/aem.46.1.165-170.1983
Krupesha, S.S.R., G. Rathore, D.K. Verma, N. Sadhu and K.K. Philipose. 2012. Vibrio alginolyticus infection in Asian seabass (Lates calcarifer, Bloch) reared in open sea floating cages in India. Aquacult. Res., 44(1): 86–92. https://doi.org/10.1111/j.1365-2109.2011.03013.x
Lee, S.W. and W. Wee. 2012. Characterization of Vibrio alginolyticus isolated from white leg shrimp (Litopenaeus vannamei) with emphasis on its antibiogram and heavy metal resistance pattern. Vet. Arhiv., 82(2): 221–227.
Mao, F., K. Liu, N.K. Wong, X. Zhang, W. Yi, Z. Xiang, S. Xiao, Z. Yu and Y. Zhang. 2021. Virulence of Vibrio alginolyticus accentuates apoptosis and immune rigor in the oyster Crassostrea hongkongensis. Front. Immunol., 12: 1–16. https://doi.org/10.3389/fimmu.2021.746017
Mohamad, N., M.N.A. Amal, I.S.M. Yasin, M.Z. Saad, N.S. Nasruddin, N. Al-saari, S. Mino and T. Sawabe. 2019. Vibriosis in cultured marine fishes: A review. Aquaculture, 512(734289): 1–17. https://doi.org/10.1016/j.aquaculture.2019.734289
Mohamad, N., M.N.A. Amal, M.Z. Saad, I.S. Yasin, N.A. Zulkiply, M. Mustafa and N.S. Nasruddin. 2019. Virulence-associated genes and antibiotic resistance patterns of Vibrio spp. isolated from cultured marine fishes in Malaysia. BMC Vet. Res., 15(176): 1–13. https://doi.org/10.1186/s12917-019-1907-8
Mohd-Yazid, S.H., H.M. Daud, M.N.A. Azmai, N. Mohamad and N.M. Nor. 2021. Estimating the economic loss due to Vibriosis in Net-Cage Cultured Asian Seabass (Lates calcarifer): Evidence from the East Coast of Peninsular Malaysia. Front. Vet. Sci., 8: 1–11. https://doi.org/10.3389/fvets.2021.644009
Mondal, M., D. Nag, H. Koley, D.R. Saha and N.S. Chatterjee. 2014. The Vibrio cholerae extracellular chitinase chiA2 is important for survival and pathogenesis in the host intestine. PLoS One, 9(9). https://doi.org/10.1371/journal.pone.0103119
Munita, J.M. and C.A. Arias. 2016. Mechanisms of antibiotic resistance. Microbiol. Spect., 4(2): 10.1128. https://doi.org/10.1128/microbiolspec.VMBF-0016-2015
Mustapha, S., E.M.M.M. Mustapha and C. Nozha. 2013. Vibrio alginolyticus: An emerging pathogen of foodborne diseases. Maejo Int. J. Sci. Technol., 2(4): 302–309.
Nor Najwa, M., A.M.D. Daniel, K.A.M. Amin and A.W.M. Effendy. 2015. Detection of virulence genes in Vibrio alginolyticus isolated from green mussel, Perna viridis. J. Teknol., 77(25): 19–23. https://doi.org/10.11113/jt.v77.6731
Noorlis, A., F.M. Ghazali, Y.K. Cheah, T.C. Tuan Zainazor, W.C. Wong, R. Tunung, C.F. Pui, M. Nishibuchi, Y. Nakaguchi and R. Son. 2011. Antibiotic resistance and biosafety of Vibrio cholerae and Vibrio parahaemolyticus from freshwater fish at retail level. Int. Food Res. J., 18(4): 1523-1530.
Nurliyana, M., M.N.A. Amal, Saad, I.S. Yasin, N.A. Zulkiply, M. Mustafa and N.S. Nasruddin. 2019. Virulence-associated genes and antibiotic resistance patterns of Vibrio spp. isolated from cultured marine fishes in Malaysia. BMC Vet. Res., 15(176): 1–13. https://doi.org/10.1186/s12917-019-1907-8
Ong, B.L., T.L. Peng, R.H. Hamdan, S. Suhana and Y.C. Mamat. 2016. Management of knowledge transfer programme on good aquaculture practices to seabass cage culture farmers in Tumpat, Kelantan. 3rd National Conference on Knowledge Transfer, pp. 427–430. http://umkeprints.umk.edu.my/8885/1/Conference.pdf
Letchumanan, V., K.Y. Loo, J.W.F. Law, S.H. Wong, B.H. Goh, N.S. Ab-Mutalib and L.H. Lee. 2019. Progress in microbes and molecular biology Vibrio parahaemolyticus: The protagonist causing foodborne diseases. Prog. Microb. Mol. Biol., 2(1): 1–8. https://doi.org/10.36877/pmmb.a0000029
Rameshkumar, P., A.K.A. Nazar, M.A. Pradeep, C. Kalidas, R. Jayakumar, G. Tamilmani, M. Sakthivel, A.K. Samal, S. Sirajudeen, V. Venkatesan and B.M. Nazeera. 2017. Isolation and characterization of pathogenic Vibrio alginolyticus from sea cage cultured cobia (Rachycentron canadum (Linnaeus 1766) in India. Lett. Appl. Microbiol., 65(5): 423–430. https://doi.org/10.1111/lam.12800
Ruwandeepika, H.A.D., T. Defoirdt, P.P. Bhowmick, M. Shekar, P. Bossier and I. Karunasagar. 2010. Presence of typical and atypical virulence genes in Vibrio isolates belonging to the Harveyi clade. J. Appl. Microbiol., 109(3): 888–899. https://doi.org/10.1111/j.1365-2672.2010.04715.x
Shahimi, S., A. Elias, S.A. Mutalib, M. Salami, F. Fauzi, N.A. Nurul, M.A. Ghani and A. Azuhairi. 2021. Antibiotic resistance and determination of resistant genes among cockle (Anadara granosa) isolates of Vibrio alginolyticus. Environ. Sci. Pollut. Res., 28(32): 44002–44013. https://doi.org/10.1007/s11356-021-13665-4
Srinivasan, P. and P. Ramasamy. 2017. Morphological characterization and biocontrol effects of Vibrio vulnificus phages against Vibriosis in the shrimp aquaculture environment. Microb. Pathog., 111: 472–480. https://doi.org/10.1016/j.micpath.2017.09.024
Sun, D., K. Jeannot, Y. Xiao and C.W. Knapp. 2019. Editorial: Horizontal gene transfer mediated bacterial antibiotic resistance. Front. Microbiol., 10(1933): 1–3. https://doi.org/10.3389/fmicb.2019.01933
Sun, Y., Y. Shaofei, L. Fengqin, L. Ying, Y. Lin, Y. Dajin, P. Zixin, Y. Baowei, S. Jiali, X. Jin, D. Yinping, B. Yao. 2024. Prevalence, antibiotic susceptibility, and genomic analysis of Vibrio alginolyticus isolated from seafood and freshwater products in China. Front. Microbiol., 15. https://doi.org/10.3389/fmicb.2024.1381457
Tan, C.W., Y. Rukayadi, H. Hasan, T.Y. Thung, E. Lee, W.D. Rollon, H. Hara, A.Y. Kayali, M. Nishibuchi and S. Radu. 2020. Prevalence and antibiotic resistance patterns of Vibrio parahaemolyticus isolated from different types of seafood in Selangor, Malaysia. Saudi J. Biol. Sci., 27(6): 1602-1608. https://doi.org/10.1016/j.sjbs.2020.01.002
Thompson, S.E., M. Smith, M.C. Wilkinson and K. Peek. 2001. Identification and characterization of a chitinase antigen from pseudomonas aeruginosa strain 385. Appl. Environ. Microbiol., 67(9). https://doi.org/10.1128/AEM.67.9.4001-4008.2001
WHO, 2021. Antimicrobial resistance. World Health Organization. https://www.who.int/news-room/fact-sheets/detail/antimicrobial-resistance
Xu, Y.G., L.M. Sun, Y.S. Wang, P.P. Chen, Z.M. Liu, Y.J. Li and L.J. Tang. 2017. Simultaneous detection of Vibrio cholerae, Vibrio alginolyticus, Vibrio parahaemolyticus and Vibrio vulnificus in seafood using dual priming oligonucleotide (DPO) system-based multiplex PCR assay. Food Contr., 71: 64–70. https://doi.org/10.1016/j.foodcont.2016.06.024
Xie, J., L. Bu, S. Jin, X. Wang, Q. Zhao, S. Zhou and Y. Xu. 2020. Outbreak of Vibriosis caused by Vibrio harveyi and Vibrio alginolyticus in farmed seahorse Hippocampus kuda in China. Aquaculture, 523: 735168. https://doi.org/10.1016/j.aquaculture.2020.735168
Yanuhar, U., H. Nurcahyo, L. Widiyanti, N.S. Junirahma, N.R. Caesar and S. Sukoso. 2022. In vivo test of Vibrio alginolyticus and Vibrio harveyi infection in the humpback grouper (Cromileptes altivelis) from East Java Indonesia. Vet. World, 15(5): 1269–1282. https://doi.org/10.14202/vetworld.2022.1269-1282
Yang, B., S. Zhai, X. Li, J. Tian, Q. Li, H. Shan and S. Liu. 2021. Identification of Vibrio alginolyticus as a causative pathogen associated with mass summer mortality of the Pacific Oyster (Crassostrea gigas) in China. Aquaculture, 535: 736363. https://doi.org/10.1016/j.aquaculture.2021.736363
Yu, Y., M. Tang, Y. Wang, M. Liao, C. Wang, X. Rong, B. Li, J. Ge, Y. Gao, X. Dong and Z. Zhang. 2023. Virulence and antimicrobial resistance characteristics assessment of Vibrio isolated from shrimp (Penaeus vannamei) breeding system in South China. Ecotoxicol. Environ. Saf., 252: 114615. https://doi.org/10.1016/j.ecoenv.2023.114615
Yudiati, E., Subagiyo and N. Azhar. 2021. Antimicrobial susceptibility and minimum inhibition concentration of Vibrio parahaemolyticus, Vibrio vulnificus and Vibrio harveyi isolated from a white shrimp (Litopenaeus vannamei) pond. IOP Conf. Ser. Earth Environ. Sci., 763(1): 012025. https://doi.org/10.1088/1755-1315/763/1/012025
Zanetti, S., A. Deriu, L. Volterra, M.P. Falchi, P. Molicotti, G. Fadda and L. Sechi. 2000. Virulence factors in Vibrio alginolyticus strains isolated from aquatic environments. Annali Di Igiene: Med. Prevent. Di Comunita, 12(6): 487–491.
Zavala-Norzagaray, K.A., A.A. Aguirre, J. Velazquez-Roman, H. Flores-Villaseñor, N. León-Sicairos, C.P. Ley-Quiñonez, L.D. H.D. Jesús and A. Canizalez-Roman. 2015. Isolation, characterization, and antibiotic resistance of Vibrio spp. in sea turtles from Northwestern Mexico. Front. Microbiol., 6(635). https://doi.org/10.3389/fmicb.2015.00635