Special Issue:
Veterinary Medicine between Sustainable Development and Public Health to Confront Global Changes
Synergistic Effect of Some Plant Extracts with Selected Antibiotics Against Enteric Pathogens of Turkey Poults
Mohamed E. Enany1, Ahmed M. Hamouda2, Reem M. Khashaba3*
1Department of Bacteriology, Immunology and Mycology, Faculty of Veterinary Medicine, Suez Canal University, Ismailia, Egypt; 2Department of microbiology, Animal Health Research Institute Zagazig Branch, Egypt; 3Department of Microbiology, Animal Health Research Institute, Ismailia Branch, Egypt.
Abstract | Antibiotic resistance has been considered a major problem for both human health and poultry production. Therefore, this study was conducted to improve the antibiotics activity by combination with natural plant extracts. Turkey poults were assayed for the presence of Enterobacteriaceae species with prevalence 40% (40/100) of the tested samples. Escherichia coli has the highest prevalence rate with 77.5% followed by klebsiella spp and Salmonella spp. with7.5%and 5% respectively.Resistance of the collected Enterobacteriaceae strains was determined by the Kirby-Bauer disk diffusion test against a panel of antibiotics.. The isolates were highly resistance for Amoxicillin clavulanic acid with 71.05% of tested isolates followed by Erythromycin, Chloramphenicol and Doxycycline with 73.68%, 63.16% and 34.21% respectively. In contrast, the isolates demonstrated significant sensitivity to Colistin, with a sensitivity rate of 94.73% while were 60.52% and 52.63% for Gentamicin and Trimethoprim-sulfamethoxazole . the antimicrobial activity of five methanolic plant extracts (garlic, cloves, rosemary, Ficus sycomorus and Ziziphus spina-christi,) were examined toward intermediate resistant strains of Escherichia coli, Salmonella typhimurium and Klebsiella pneumoniae. Among the plant extracts used, cloves showed a broad antimicrobial spectrum three examined strains with inhibition zones between 17-19 mm followed by garlic with inhibition zones between 16-18 mm and rosemary with 8-13mm. Meanwhile Ficus sycomorus and Ziziphus spina-christi have no effect against the three tested strains. Combinations of these extracts and antibiotics (amoxicillin, doxycycline and florophenicol) were applied with Decimal Assay for Additivity method with three ratios of antibiotic: plant extract (9:1,8:2and 7:3) to determine synergistic effects between them and the enhancement of antibiotic activity. The mean zones of inhibition and the minimum inhibitory concentration of plant extracts and of antibiotics and combination between them was determined. Cloves extract display significant antibacterial activity (MIC 64 μg/ml), but it modulated the activity of amoxicillin and doxycycline and florophenicol with MIC 32 μg/ml,32 μg/ml and 16 μg/ml in order, i.e. in combination with amoxicillin, 2fold (8 μg/ml) reduction in the MIC value at the ratios 9:1,8:2and 7:3 of combination against E. coli and 1fold with Salmonella typhimurium and Klebsiella pneumoniae was observed at same ratios. While rosemary deacreased MIC with 2 fold in combination with amoxicillin and doxycycline against E. coli and Salmonella typhimurium but was less effective against Klebsiella pneumoniae. Antimicrobial compounds from medicinal plants had many advantages such as fewer side effects, better patient tolerance, less expensive, acceptance due to long history of use, being renewable in nature and also higher plants represent a potentiall source of novel antibiotic prototypes.
Keywords: Decimal assay for additivity, Antimicrobial, Amoxicillin, Doxycycline, Turkey poults
Received | September 11, 2024; Accepted | October 19, 2024; Published | November 13, 2024
*Correspondence | Reem M. Khashaba, Department of Microbiology, Animal Health Research Institute, Ismailia Branch, Egypt; Email: [email protected]
Citation | Enany ME, Hamouda AM, Khashaba RM (2024). Synergistic effect of some plant extracts with selected antibiotics against enteric pathogens of turkey poults. Adv. Anim. Vet. Sci. 12(s1): 458-477.
DOI | https://dx.doi.org/10.17582/journal.aavs/2024/12.s1.458.477
ISSN (Online) | 2307-8316; ISSN (Print) | 2309-3331
Copyright: 2024 by the authors. Licensee ResearchersLinks Ltd, England, UK.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
INTRODUCTION
Antimicrobial resistance is increasing in several species of Enterobacteriaceae (Karlowsky et al., 2003) and this has been a major concern with both clinical and commensal bacteria (Kilonzo-Nthenge et al., 2013). Enterobacteriaceae is distributed widely in nature and in the gastrointestinal tract of humans, other mammals, and birds approved by previous studies (Barham et al., 2002; Fluckey et al., 2007; Mainali et al., 2009).
Turkey farming had several challenges including potential outbreaks of infectious and non-infectious diseases. (Asaduzzaman et al., 2017). Infections caused by Escherichia coli and Salmonella spp. have negative impacts on turkey farming as they lower egg production, reduce hatchability, and increase mortality rates (Kar et al., 2017). Avian colibacillosis caused by E. coli is responsible for turkey cellulitis, colisepticemia, swollen head syndrome, synovitis, salpingitis, coligranuloma, osteomyelitis, omphalitis, peritonitis, panophthalmitis, and is often deadly for turkeys (De Oliveira et al., 2020). Salmonella spp. can cause salmonellosis (especially pullorum disease and fowl typhoid) inturkeys (Abdukhalilova et al., 2016; Aury et al., 2010). Salmonella infections reduce hatchability, fertility, growth, and increase mortality rates in poultry (Andino and Hanning, 2015). Additionally, Klebsiella species, though naturally present in the digestive mucosa, have been implicated in various infections affecting the excretory and respiratory systems (Martin and Bachman, 2018), with some strains showing increasing virulence in poultry (Hamza et al., 2016).
During the last decades, several veterinary antibiotics have been used globally as growth promoters and therapeutic agents in livestock production because of their positive effects (Arikan et al., 2007). In Egypt, excessive and incorrect use of antimicrobials in veterinary medicine plays a key role in the spread of antibiotic-resistant bacteria, especially enteric pathogens (Escherichia coli and Salmonella species), that increasingly hinders the successful treatment of infectious diseases (Andersson, 2003) It is now well-established that antimicrobial resistant bacteria isolated from humans often originate from food animals (Aarestrup, 2000).The transmission of resistance can occur through various mechanisms, with bacteria acquiring antibiotic resistance either through mutations or horizontal gene transfer (Normark and Normark, 2002). The latter has been identified as the primary mechanism for acquired antibiotic resistance in Enterobacteriaceae, primarily mediated through conjugation (Barlow, 2009).
This lead to search for alternative antimicrobial agents. Plant-derived antimicrobials present a promising avenue, as they typically do not carry the side effects associated with synthetic drugs and possess significant therapeutic potential against various infectious diseases (Chanda et al., 2010; Habbal et al., 2011).These natural compounds often exhibit multiple mechanisms of action, making the development of resistance less likely (Cushnie and Lamb, 2011).
Cloves had antibacterial activity against a large number of bacteria such as Escherichia coli, Listeria monocytogenes, Salmonella enterica(Friedman et al., 2002), Campylobacter jejuni, Salmonella enteritidis, Escherichia coli and Staphylococcus aureus (Beuchat, 2007; Cressy et al., 2003; Kalemba and Kunicka, 2003). The major component of clove oil is usually considered to be eugenol, with β-caryophyllene and lesser amounts of other components such as benzyl alcohol. Bai et al. (2023) confirmed that eugenol was the main component of cloves which showed obviously antibacterial activities against S. aureus and E. coli. The antibacterial mechanism of eugenol against S. aureus and E.coli was probably related to the damage of cell wall and membrane, the inhibition on biofilm formation, the oxidative stress-mediated apoptosis and the disruption of DNA synthesis.
Rosemary is used as a spice and a medicinal supplement (El-Demerdash et al., 2021a). The major contents are rosmarinic acid, cafeic acid, chlorogenic acid, carnosic acid, luteolin, camphor, riesemanol, carnousol, rosemary-diphenol, rosemary quinone, ureolic acid, glucocytic acid, rosemarcin, borneol, sinwell, alfopinene, and comfan (Barakat et al., 2016). Fu et al. (2007) found that essential oil of rosemary attached to the surface of bacterial body at lower concentrations. At higher concentrations, essential oil entered the cell wall leading cell wall desquamation and shape distortion. Subsequently, essential oils invaded and damaged the cell membrane, so that the intracellular contents burst from the bacterial body.
Garlic is a bulb-forming herb of the family Alliaceae, cultivated some thousands of years for use as a flavoring agent as well as a medicinal herb (Lewis and Elvin-Lewis, 2003). Several studies, including those of Kim et al. (2004) and Lacombe et al. (2010) had previously demonstrated the antibacterial potency of EGE against enteropathogens such as Vibrio parahaemolyticus, E. coli, Klebsiella spp., Proteus spp., and S. aureus. Garlic principal phytochemicals that exhibit antibacterial activity are oil-soluble organosulfur compounds that include allicin, ajoenes, and allyl sulfides. The reactive organosulfur compounds form disulfide bonds with free sulfhydryl groups of enzymes and compromise the integrity of the bacterial membrane (Bhatwalkar et al., 2021). changes observed in membrane permeability, protein leakage and by scanning electron microscopy suggested that the antimicrobial activity of garlic extracts may be due to destruction of the structural integrity of cell membranes, leading to cell death (Chen et al., 2018).
A particularly innovative approach is combination therapy, which explores potential synergism between conventional antibiotics and bioactive plant extracts. This strategy offers multiple advantages, including: expanded antimicrobial spectrum, reduced likelihood of resistant mutant emergence, minimized toxicity and potentially enhanced antimicrobial activity compared to individual treatments (Rakholiya and Chanda, 2012). However, the molecular mechanisms underlying these synergistic interactions remain incompletely understood and warrant further investigation.
Therefore, this study aims to evaluate the interactions between selected plant extracts and antibiotics against E. coli, Salmonella and Klebsiella isolated from turkey poults, determination of minimum inhibitory concentration for both antibiotics and plant extracts using agar well diffusion method and assess the effects of antibiotic-plant extract combinations. This research aim to develop of more effective and sustainable approaches to managing bacterial infections in poultry production, with potential implications for both animal health and food safety.
MATERIALS AND METHODS
Bacterial Strains
During the period 2023 to 2024, a total of 100 diseased turkey poults were randomly collected from 5 turkey farms in Sharkia governorate, Egypt four hunderad samples (from each bird 4 visceral organ) were collected from the 100 poults for culture and isolation. From these samples, 40 bacterial isolates were obtained and identified, as following: 31 Escherichia coli strains, 2 Salmonella typhimurium strains, 2 Proteus mirabilis strains and 3 Klebsiella pneumoniae strains. Three intermediate resistant strains were selected for further testing: E. coli O78, Salmonella typhimurium, Klebsiella pneumoniae spp. pneumonae because most isolates were highly resistant for the tested antibiotics.
Sample Collection and Bacterial Isolation and Identification
Sample size was calculated by sample size calculator according to Survey monkey (https://www.surveymonkey.com). Samples were collected from visceral organ (liver, cecal tonsils, spleen, and gall bladder) of diseased day old to30 days age old poults.
Routine bacteriological examination applied to collected samples for Enterobactreace isolation. Using enrichment broth media for cultivation of samples before plating. The plates incubated for 24 hours at 37°C in aerobic conditions. After incubation, growing colonies were subjected to Gram staining and catalase and oxidase tests to ascertain fermenting Gram-negative bacilli. The oxidase-negative Gram-negative bacilli were subcultured on MacConkey agar for purification and further identification to the species level standard biochemical tests as described by Finegold and Baron (1986) and GnA+B-ID System (Microgen Bioproducts, Ltd,AdmiraltWay, Camberley, SurreyGU15 3DT,U.K.) according to the manufacturer’s instructions. Serological typing of E. coli isolates by using slide agglutination tests according to Edwards and Ewing (1972) and Salmonella serotyping followed the Kauffmann-White Scheme (Kauffmann, 1974).
Antimicrobial Susceptibility Testing
Bacterial isolates were tested in vitro for their susceptibility to 7 antimicrobial agents (Oxoid, Hampshire, UK). This was performed through use of a Kirby–Bauer disc diffusion assay, according to the standards and interpretive criteria described by the Clinical and Laboratory Standards Institute (CLSI, 2011). The following antimicrobial agents were tested: amoxicillin–clavulanic acid, 30 µg; chloramphenicol, 30 µg;; gentamicin ,10 µg; sulfamethoxazole–trimethoprim , 25 µg; erythromycin, 15 µg, colistin, 10 µg and doxycycline, 30 µg. Susceptibility of the isolates to antimicrobial agents was categorized (as susceptible, intermediate or resistant) by measurement of the inhibition zone, according to interpretive criteria that adhered to the CLSI guidelines. The isolates that displayed resistance to ≥ two different antimicrobial classes were categorized as multidrug resistance.
DNA Extraction and Screening of Antimicrobial Resistance Genes
Genomic DNA of bacterial isolates was extracted according to QIAamp DNA mini kit instructions. Selected isolates were tested more than once for the presence of genes that were resistant to; erythromycin (mphA), amoxicillin–clavulanic acid (blaTEM), chloramphenicol (floR) and doxycycline (TetA(A). Primer sequences, target genes and polymerase chain reaction (PCR) products are summarised in Table 1.
Table 1: Oligonucleotide primers sequences.
|
Reference |
Length of amplified product |
Primer sequence (5'-3') |
Gene |
|
Nguyen et al., 2009 |
403 bp |
GTGAGGAGGAGCTTCGCGAG |
mphA |
|
TGCCGCAGGACTCGGAGGTC |
|||
|
Colom et al., 2003 |
516 bp |
ATCAGCAATAAACCAGC |
bla TEM |
|
CCCCGAAGAACGTTTTC |
|||
|
Randall et al. 2004 |
570 bp |
GGTTCACTCGAACGACGTCA |
tetA (A) |
|
CTGTCCGACAAGTTGCATGA |
|||
|
Doublet et al., 2003 |
494 bp |
TTTGGWCCGCTMTCRGAC |
floR |
|
SGAGAARAAGACGAAGAAG |
Source: Metabion (Germany).
Several PCR protocols were used to detect the target genes of the isolates Table 2. The PCR products were loaded onto 1.0% agarose gel (Sigma-Aldrich Co., St. Louis, MO, USA) that was stained with 0.5 µg/mL ethidium bromide (Sigma-Aldrich Co., St. Louis, MO, USA). The amplified DNAs were electrophoresed at 100 V for 60 min on a mini, horizontal electrophoresis unit (Bio-Rad, Hercules, CA, USA). The gel was then visualised and photographed under an ultraviolet transilluminator.
Table 2: Cycling conditions of the different primers during cPCR.
|
Gene |
Primary denaturation |
Secondary denaturation |
Annealing |
Extension |
No. of cycles |
Final extension |
|
mphA |
94˚C 5 min. |
94˚C 30 sec. |
58˚C 40 sec. |
72˚C 40 sec. |
35 |
72˚C 10 min. |
|
blaTEM |
94˚C 5 min. |
94˚C 30 sec. |
54˚C 40 sec |
72˚C 45 sec |
35 |
72˚C 10 min. |
|
TetA (A) |
94˚C 5 min. |
94˚C 30 sec. |
50˚C 40 sec |
72˚C 45 sec |
35 |
72˚C 10 min. |
|
floR |
94˚C 5 min. |
94˚C 30 sec. |
54˚C 40 sec |
72˚C 45 sec |
35 |
72˚C 10 min. |
Plant Materials and Extraction
Plant material: Five plant materials obtained from the Faculty of Agriculture, Zagazig University, Egypt:Garlic (Allium sativum L.) bulbs, Rosemary (Rosmarinus officinalis) leaves, Clove (Syzygium aromaticum) buds, Ziziphus spina-christi leaves and Ficus sycomorus leaves.
Preparation of the plant extract: Plant samples (Garlic, Rosemary, Clove, Ziziphus spina-christi and Ficus sycomorus) were cleaned out of other contaminated plants and the fresh plant was collected, air dried away from sunlight then they dried in an oven at 40°C and ground to a fine powder in a mill. Ten grams of the ground material were extracted using 100 mL methanol (80%) by ultrasonic at power 140 watt (40 KHz) at 40°C for 30 min Combined filtrate was evaporated in a rotatory evaporator below 40°C. The residue was freeze-dried. The dried extract was stored at -20°C until further use (Soaad and Ramesa, 2012).
Minimal inhibitory concentration (MIC): The isolated strain matches the 0.5 McFarland standards (1.5×108 CFU µg/ml) and results of antimicrobial agents and herbal extracts showed no visible bacterial growth considered as MIC and interpreted with recommendations of the Clinical Laboratory standards 2018.
Determination of MIC of herbal extract by tube dilution method (Awoyinka et al., 2007):Herbal extracts of Garlic, Rosemary, Clove which identified by using serially diluted (2-fold) plant extracts that showed no visible bacterial growth were considered as MIC and interpreted with recommendations of the National Committee for Clinical Laboratory standards (Adams et al., 1998; Dorman and Deans, 2000; Lorian, 2005).
Determination of antimicrobial activity of the prepared extract by Agar well diffusion methode: Agar well diffusion method is widely used to evaluate the antimicrobial activity of plants or microbial extracts (Magaldi et al., 2004; Valgas et al., 2007). Plates were seeded with a 24 h old culture of the bacterial strains which adjusted by saline to be equivalent to McFarland standard 0.5. About 500 micron of each culture spread on Mueller Hinton agar Plates. All culture allow to dry for 3-5 minute. Then, a hole with a diameter of 6 to 8 mm is punched aseptically with a sterile cork borer or a tip on Mueller Hinton agar, and a volume (20–100 mL) of the the five tested natural extract at desired concentration were added for wells antimicrobial extract. The plates were incubated at 4˚ C for two hrs to allow diffusion of the active compounds in the medium. The standard colistin 10mg (Oxoid, UK) was used as positive control and negative controls were prepared using the same solvent employed to dissolve the plant extract methanol 80%. The inoculated plates were incubated at 37 °C for 24 h. The diameter of the inhibition zones were measured for each plate for each antibacterial species were calculated (Balouiri et al., 2016).
Evaluation of the combined activity of antibiotics and extracts using Decimal Assay for Additivity (DAA): Stock solutions of both antimicrobial agents and herbal extract were prepared, each contained 1024 µg/ml. These stocksmixture contained 9 parts of antimicrobial agents and 1part ofherbal extract, 8 parts of antimicrobial agents and 2 parts ofherbal extract and 7 parts of antimicrobial and 3 parts of herbalextract. Double fold serial dilutions for each combination were prepared to detect MIC against the isolated strain. The obtainedconcentrations were ranged from 0.5 to 1024 µg/ml Sanders et al., (1993). This method defined as synergism when interactions were greater than additivity such as decreasing MIC of the antibiotic with 1or 2fold comparing in case of antibiotic alone. The antagonism when interactions between them lead to increasing of MIC antibiotic than the antibiotic without adding plant extract (Jackson and Esimone, 2010).
RESULTS AND DISCUSSION
Prevalence of Enterobactereceae Species Isolated from Turkey Poults
The prevalence of Enterobacteriaceae species in 100 turkey poults samples collected from various turkey farms was found to be 40% (40/100). The distribution of isolates revealed that E. coli had the highest prevalence with 77.5%, followed by Klebsiella pneumoniae at 7.5%, Salmonella and Proteus at 5%. Additionally, Citrobacter and Yersinia species each accounted for 2.5% of the isolates, as summarized in Table 3. The most frequently identified strains were E. coli O78 and E. coli O1, which constituted 19.36% of E. coli isolates (Table 4). Furthermore, both Salmonella isolates were confirmed as Salmonella typhimurium, representing 100% of the Salmonella cases identified. As shown in (Figures 1, 2, 3, 4 and 5).
Table 3: Percent of Enterobactreace species among turkey poults age.
|
Species/ Age |
E.coli |
Salmonella |
Klepsiella |
Proteus |
Citrobacter |
Yersinia |
Total |
|
1-10 days |
11 |
1 |
2 |
1 |
1 |
16(40%) |
|
|
11-20 days |
5 |
1 |
1 |
1 |
8 (20%) |
||
|
21-30 days |
15 |
1 |
40% |
||||
|
Total(40) |
31 (77.5%) |
2 (5%) |
3 (7.5%) |
2 (5%) |
1 (2.5%) |
1 (2.5%) |
40 |
Table 4: Different serotypes of selected E. coli isolates and their percentage.
|
E. coli serotype |
n. serotype |
percentage |
|
O78 |
6/31 |
19.36% |
|
O1 |
6/31 |
19.36% |
|
O18 |
3/31 |
9.68% |
|
O113 |
3 /31 |
9.68% |
|
O119 |
3/31 |
9.68% |
|
O103 |
2/31 |
6.45% |
|
O111 |
2/31 |
6.45% |
|
O25 |
2/31 |
6.45% |
|
O26 |
2/31 |
6.45% |
|
O104 |
2/31 |
6.45% |
Antimicrobial Susceptibility of Isolates
Antimicrobial susceptibility testing indicated that the highest level of resistance was observed for Amoxicillin clavulanic acid, which exhibited a resistance rate of 71.05%. This was closely followed by Erythromycin at 73.68%, Chloramphenicol at 63.16% and Doxycycline at 34.21%. In contrast, the isolates demonstrated significant sensitivity to Colistin, with a sensitivity rate of 94.73%, Gentamicin at 60.52%, and Trimethoprim-sulfamethoxazole at 52.63%. Intermediate resistance were noted for Amoxicillin clavulanic acid, Doxycycline, and Gentamicin, with rates of 26.31%, 23.68% and 21.05% respectively. The antibiogram analysis of 31 E. coli isolates revealed that 74.19% exhibited high resistance to both Amoxicillin clavulanic acid and Chloramphenicol, while 70.97% were resistant to Erythromycin and 32.25% to Doxycycline. Conversely, the isolates showed high sensitivity to Colistin at 96.77%, Gentamicin at 67.74% and Trimethoprim-sulfamethoxazole at 61.29%, as detailed in Table 5 and (Figures 6 and 7).
Table 5: Antibiogram of 31 E. coli isolated from turkey.
|
Antibiogram Phenotypic Pattern |
||||||
|
Resistance |
Sensitive |
|||||
|
Resistant |
Intermediate |
Total |
%* |
No |
%* |
|
|
Amoxicillin |
23 |
1 |
24 |
77.41 |
7 |
22.58 |
|
Doxycycline |
10 |
6 |
16 |
51.61 |
15 |
48.38 |
|
Erythromycin |
22 |
1 |
23 |
74.19 |
8 |
25.8 |
|
Chloramphenicol |
23 |
2 |
25 |
80.65 |
6 |
19.35 |
|
Trimethoprim Sulphamethazole |
11 |
1 |
12 |
38.7 |
19 |
61.29 |
|
Gentamycin |
2 |
8 |
10 |
32.25 |
21 |
67.74 |
|
Colistin |
0 |
1 |
1 |
3.22 |
30 |
96.77 |
Additionally, two Salmonella typhimurium strains were evaluated for their susceptibility to various antimicrobial agents. The antibiogram for Salmonella typhimurium demonstrated complete resistance to Amoxicillin combined with clavulanic acid, Doxycycline, and Erythromycin, with a resistance rate of 100%, while showing full sensitivity to Colistin, also at 100%, as presented in Table 6 and Figure 8. Furthermore, three isolates of Klebsiella pneumoniae subspecies pneumoniae were tested, with results summarized in (Table 7 and Figure 9).
Table 6: Antibiogram of Salmonella typhimurium and klebsiella isolates.
|
AMA/Sample |
AMC |
DO |
E |
C |
COT |
GENT |
CL |
|
Salmonella typhimurium |
I |
I |
R |
I |
S |
S |
S |
|
Salmonella typhimurium |
R |
R |
R |
R |
I |
R |
S |
|
Klebsilla pneumonia |
R |
R |
R |
R |
R |
R |
S |
|
Klebsilla pneumoniae |
R |
R |
R |
R |
R |
S |
S |
|
Klebsilla pneumonia |
I |
I |
R |
I |
I |
R |
S |
R: resistant; S: sensitive; I: intermediate.
Detection of Resistance Genes Among Resistant Isolates
Six isolates were subjected for detection of resistance genes of Doxycycline (TetA), Erythromycin (MphA),Amoxycillin (blaTEM )and Chloramphenicol (floR). The result show all tested isolates has both genes TetA and Flor with100% while five have blaTEM gene with 83.33% and only three has MphA (50) as shown in (Figures 10 and 11).
Antimicrobial Activity of Natural Extracts
The inhibition zones of various natural antimicrobial agents were evaluated against three bacterial strains: E. coli O78, Salmonella typhimurium, and Klebsiella pneumoniae ssp. pneumoniae. Measurements were obtained for the extracts both in isolation and in conjunction with antibiotics.
Table 7: Diameter of I.Z (mm) of antibiotics and extracts as well as combination on E. coli.
|
E. coli |
Inhibition zone (mm) |
||||||
|
Plant alone |
Antibiotic alone |
Combination |
|||||
|
Amoxy |
Doxy |
Flor |
Amoxy |
Doxy |
Flor |
||
|
Rosemary |
8 |
17 |
16 |
16 |
19 |
20 |
16 |
|
Cloves |
19 |
17 |
16 |
16 |
26 |
20 |
21 |
|
Garlic |
16 |
17 |
16 |
16 |
18 |
18 |
16 |
|
Ficus sycomorus |
0 |
17 |
16 |
16 |
17 |
16 |
16 |
|
Ziziphus spina-christi |
0 |
17 |
16 |
16 |
17 |
16 |
16 |
Amoxy: amoxycilin; Doxy: doxycycline; Flor: florofenicol.
The methanolic extract of cloves exhibited the most significant inhibitory effect extract with 19 mm, 19 mm, and 17 mm inhibition zones against E. coli, Salmonella typhimurium, and Klebsiella pneumoniae, respectively. While garlic and rosemary methanolic extracts demonstrated inhibition zones of 18 mm and 13 mm against Salmonella typhimurium, 16 mm and 8 mm against E. coli and Klebsiella pneumoniae, respectively as shown in Figure 12. In contrast, extracts from Ziziphus spina-christi and Ficus sycomorus showed no inhibitory effects on any of the tested strains.
In terms of antibiotic efficacy, Amoxicillin, Doxycycline, and Florfenicol exhibited inhibition zones ranging from 16 to 17 mm for Amoxicillin and 15 to 16 mm for both Doxycycline and Florfenicol against the three bacterial strains considered as intermediate resistance. However, when these antibiotics were combined with the extracts, particularly cloves, the inhibition zones increased significantly, reaching between 20 and 26 mm with Amoxicillin, 19 to 20 mm with Doxycycline, and 18 to 20 mm with Florfenicol across all 3 strains, which leaded to increase the antimicrobial effect of antibiotic against the bacteria from intermediate to sensitive interpretation reading according to (CLSI, 2011). The combination with rosemary showed enhanced activity only against E. coli and Salmonella, while Klebsiella pneumoniae was less effected by rosemary, yielding inhibition zones of 19 mm with Amoxicillin and 20 mm with Doxycycline, but a diminished effect with Florfenicol.
Table 8: Diameter of I.Z (mm) of antibiotics and extracts as well as combination on Salmonella.
|
Salmonella |
Inhibition zone (mm) |
||||||
|
Plant alone |
Antibiotic alone |
Combination |
|||||
|
Amoxy |
Doxy |
Flor |
Amoxy |
Doxy |
Flor |
||
|
Rosemary |
13 |
16 |
15 |
16 |
19 |
20 |
19 |
|
Cloves |
19 |
16 |
15 |
16 |
20 |
20 |
20 |
|
Garlic |
18 |
16 |
15 |
16 |
18 |
18 |
19 |
|
Ficus sycomorus |
0 |
16 |
15 |
16 |
16 |
15 |
16 |
|
Ziziphus spina-christi |
0 |
16 |
15 |
16 |
16 |
15 |
16 |
Amoxy: amoxycilin; Doxy: doxycycline; Flor:florofenicol.
Table 9: Diameter of I.Z (mm) of antibiotics and extracts as well as combination on Klebsiella pneumoniae.
|
Klebsiella pneumoniae |
Inhibition zone (mm) |
||||||
|
Plant alone |
Antibiotic alone |
Combination |
|||||
|
Amoxy |
Doxy |
Flor |
Amoxy |
Doxy |
Flor |
||
|
Rosemary |
8 |
16 |
16 |
15 |
18 |
16 |
15 |
|
Cloves |
17 |
16 |
16 |
15 |
20 |
19 |
18 |
|
Garlic |
18 |
16 |
16 |
15 |
16 |
18 |
16 |
|
Ficus sycomorus |
0 |
16 |
16 |
15 |
16 |
16 |
15 |
|
Ziziphus spina-christi |
0 |
16 |
16 |
15 |
16 |
16 |
15 |
Amoxy: amoxycilin; Doxy: doxycycline; Flor florofenicol.
The Synergistic Interaction Between Plant Extracts and Antibiotics
The antimicrobial properties of methanol extracts in combination with antibiotics were evaluated on the selected isolates, revealing interactions that can be classified as antagonistic, additive, or synergistic. An additive interaction occurs when the combined effect of the substances is equivalent to the sum of their individual effects. In contrast, antagonism identified when the efficacy of one or both compounds diminishes when used together. Synergism characterized by a combined effect that exceeds the total of the individual effects. The synergistic effect between plant extracts and antibiotics was evaluated by comparing the MIC values of plant extracts alone and the antibiotics alone and both on the selected isolates.
Table 10: Combination activity of antibiotics with extracts using DAA methods on E. coli.
|
E. coliO78 |
||||||
|
Plant extracts |
Antibiotics |
DAA |
MIC |
Effect |
||
|
AB |
E |
DAA |
AB alone |
|||
|
Rosemary |
A)Amoxycillin |
9 |
1 |
8 |
32 |
Synergy |
|
8 |
2 |
8 |
32 |
synergy |
||
|
7 |
3 |
8 |
32 |
synergy |
||
|
9 |
1 |
8 |
32 |
synergy |
||
|
B)Doxycycline |
8 |
2 |
8 |
32 |
synergy |
|
|
7 |
3 |
16 |
32 |
synergy |
||
|
Cloves |
A)Amoxycillin |
9 |
1 |
8 |
32 |
synergy |
|
8 |
2 |
8 |
32 |
synergy |
||
|
7 |
3 |
8 |
32 |
synergy |
||
|
B)Doxycycline |
9 |
1 |
8 |
32 |
synergy |
|
|
8 |
2 |
16 |
32 |
synergy |
||
|
7 |
3 |
16 |
32 |
synergy |
||
|
C)Florfenicol |
9 |
1 |
8 |
16 |
synergy |
|
|
8 |
2 |
8 |
16 |
synergy |
||
|
Garlic |
A)Amoxycillin |
9 |
1 |
16 |
32 |
synergy |
|
8 |
2 |
16 |
32 |
synergy |
||
|
B)Doxycycline |
9 |
1 |
16 |
32 |
synergy |
|
|
8 |
2 |
16 |
32 |
synergy |
||
DAA: Decimal Assay for Additivity; AB: antibiotic; E: extract; MIC: Minimal inhibitory concentration.
The findings indicated that amoxicillin (MIC 32 μg/ml) show good result synergy with cloves extract against E. coli with. 2fold (8 μg/ml) reduction in the MIC value at the ratios 9:1,8:2and 7:3 of combination but with 1fold reduction (16 μg/ml) with Salmonella typhimurium and Klebsiella pneumoniae was observed at same ratios. Meanwhile it show better result with rosemary against Salmonella typhimurium with 2fold (8 μg/ml) reduction in the MIC value at the three ratios. but synergy effect was intermediate in case of E. coli with 2fold (8 μg/ml) reduction in the MIC value at 9:1 and 8:2 ratios. Incase of garlic had only synergy against E. coli with 1 fold reduction (16 μg/ml) at 9:1 and 8:2 ratios.
Otherwise doxycycline (32 μg/ml) give good result with cloves and rosemary extracts which was reduced with 2fold at 9:1 and with 1fold at 8:2 and 7:3 in challenge with E. coli and Salmonella but only with 1fold at 9:1 against Klebsiella. Garlic extract show lesser synergy than other extract with 1fold with the ratios with Salmonella isolates.
The MIC of florophenicol (16 μg/ml) was modulated when combined with garlic and cloves with 1 fold reduction (8 μg/ml) when used against E. coli, Salmonella and Klebsiella.in contrast very good synergy obtained when combined with rosemary with 2 fold decrease (4 μg/ml) at Salmonella but no effect obtained with E. coli and Klebsiella as shown in Tables 10, 11 and 12.
Table 11: Combination activity of antibiotics with extracts using DAA methods on Salmonella.
|
Salmonella typhimurium |
||||||
|
Plant extracts |
Antibiotics |
DAA |
MIC |
Effect |
||
|
AB |
E |
DAA |
AB alone |
|||
|
Rosemary |
A)Amoxycillin |
9 |
1 |
8 |
32 |
Synergy |
|
8 |
2 |
8 |
32 |
synergy |
||
|
7 |
3 |
8 |
32 |
synergy |
||
|
9 |
1 |
8 |
32 |
synergy |
||
|
B)Doxycycline |
8 |
2 |
8 |
32 |
synergy |
|
|
7 |
3 |
8 |
32 |
synergy |
||
|
C)Florfenicol |
9 |
1 |
4 |
16 |
synergy |
|
|
8 |
2 |
8 |
16 |
synergy |
||
|
7 |
3 |
8 |
16 |
synergy |
||
|
Cloves |
A)Amoxycillin |
9 |
1 |
16 |
32 |
synergy |
|
8 |
2 |
16 |
32 |
synergy |
||
|
7 |
3 |
16 |
32 |
synergy |
||
|
B)Doxycycline |
9 |
1 |
8 |
32 |
synergy |
|
|
8 |
2 |
16 |
32 |
synergy |
||
|
7 |
3 |
16 |
32 |
synergy |
||
|
C)Florfenicol |
9 |
1 |
8 |
16 |
synergy |
|
|
Garlic |
A)Amoxycillin |
9 |
1 |
16 |
32 |
synergy |
|
B)Doxycycline |
9 |
1 |
16 |
32 |
synergy |
|
|
8 |
2 |
16 |
32 |
synergy |
||
|
7 |
3 |
16 |
32 |
synergy |
||
|
C)Florfenicol |
9 |
1 |
8 |
16 |
synergy |
|
|
8 |
2 |
8 |
16 |
synergy |
||
|
7 |
3 |
8 |
16 |
synergy |
||
DAA: Decimal Assay for Additivity; AB: antibiotic; E: extract; MIC: Minimal inhibitory concentration.
Foodborne infections linked to poultry and poultry products present a significant public health challenge, particularly due to the emergence of antibiotic-resistant bacteria. One of major foodborne infections is Salmonellosis, in 2007 Salmonellosis remained the second most commonly reported human zoonosis in the European Union (EU) in spite of a decrease in incidence over the past 4 years (European Food Safety Authority , 2009a).
The most commonly identified causative agent in the food-poisoning outbreaks in the UK in 2007 was Salmonella (EFSA, 2009b). In 2007 around 8.0% of the fattening turkey flocks in the EU tested positive for Salmonella, while in 2005 to 2007 1.5% or less of the turkey production flocks in the EU were positive for Salmonella Enteritidis or Salmonella Typhimurium (EFSA, 2009a). Other member of Enterobacteriaceae like E. coli also considered an important pathogen that causes diarrhea and death among humans and animals, and its presence gives an indication of the environmental status in poultry farms (Bo et al., 2018). An increase in the percentage of β-lactamase-producing E. coli has been observed among humans and in food samples, which are a potential serious risk to public health because of the considerable number of multidrug-resistant genes (Chong et al., 2011). Studies on prevalence of antibiotic resistance Enterobacteriaceae in turkey is important with searching for new aspect for treatment to overcome the emergence of antibiotic resistance.
Table12: Combination activity of antibiotics with extracts using DAA methods on klebsiella pneumoniae.
|
Klebsiella pneumoniae |
||||||
|
Plant extracts |
Antibiotics |
DAA |
MIC |
Effect |
||
|
AB |
E |
DAA |
AB alone |
|||
|
Rosemary |
Amoxycillin |
9 |
1 |
16 |
32 |
Synergy |
|
Cloves |
Amoxycillin |
9 |
1 |
16 |
32 |
synergy |
|
8 |
2 |
16 |
32 |
synergy |
||
|
B) Doxycycline |
9 |
1 |
16 |
32 |
synergy |
|
|
C) Florfenicol |
9 |
1 |
8 |
16 |
synergy |
|
|
ss |
||||||
DAA: Decimal Assay for Additivity; AB: antibiotic; E: extract; MIC: Minimal inhibitory concentration.
In this study, Enterobacteriaceae was collected from turkey poults. Overall, there was a significant difference in Enterobacteriaceae species, with the most prevalence rate seen in E. coli with 75%. This finding aligns with several previous studies, including Giovanardi et al. (2013) and Hoepers et al. (2018), who reported prevalence rates about 86.7% of 15 necropsied turkey poults isolates in Italy and 84% of 364 different organ samples recovered from brazilian turkey flocks respectively, and Altekruse et al. (2002), who noted 89% of 1,104 fecal specimens were E. coli positive. Some researchers have reported even higher rates finding, like Tawyabur et al. (2020), who collected 30 fecal samples from healthy turkeys and 25 intestinal samples from diseased turkeys that died of enteritis in Egypt. All 55 samples were positive for E. coli (using PCR targeting the malB gene) with prevalence 100%. However, lower rates have also been reported by Eid and Samir (2019), who recorded 18/120 (15%) of the total examined birds. The high prevalence of E. coli is attributed to its natural presence in the gastrointestinal flora of poultry, with specific strains possessing virulence factors enabling pathogenicity (Dho-Moulin and Fairbrother, 1999).
Notably, E. coli O78 and O1 were the most frequently isolated serotypes, consistent with global trends reported by multiple researchers (Altekruse et al., 2002; D’Incau et al., 2006; Giovanardi et al., 2007; 2011; Vaillancourt and Barnes, 2008; Circella et al., 2009). However recent meta-analyses indicate increasing diversity in pathogenic serotypes affecting poultry (Guabiraba and Schouler, 2015; Paudel et al., 2022). Also it is important to know the serotype of an APEC strain because the immune response in poultry primarily is directed against O antigens (Rikihisa et al., 2003). Effective inactivated vaccines against various serotypes including O2:K1 and O78:K80 have been produced which provide protection against the homologous serogroups, but no significant cross protection against heterologous serogroups (Trampel and Griffth, 1997).
E. coli strains are highly diverse antigenically, expressing a multitude of colonization factor and coli surface antigens, toxins, and other virulence proteins. To control colibacillosis in poultry under these circumstances, unique and alternative management strategies must be developed. Probiotics (Wang et al., 2017), bacteriophages (Kaikabo et al., 2017) and various new therapies (innate immune stimulants, growth and QS inhibitors (Peng et al., 2018) and antimicrobial peptides (Wang et al., 2016) have alldemonstrated promising efficacy in reducing Avian E. coli infections in chickens. However, none of these have yet made it into field applications.
Klebsiella pneumoniae often functions as a primary pathogen in respiratory tract diseases in birds (Jesus and Correia, 1998). In this study Klebsiella pneumoniae was isolated at a rate of 7.5%, which is comparable to the 5.8% reported by (Eid and Samir, 2019) collected from 120 freshly dead turkey poults but significantly lesser than (Funmilayo et al., 2020) with Klebsiella sp had the highest percentage of 26%, recovered from the 258 faecal droppings of turkey. This variation could be due to environmental settings in which the birds are raised and water sources of the birds (Ezekiel et al., 2011).
Salmonella has low prevalence rate of 5%, which is parallel with (Snow et al., 2010) but is lower than the 12.6% taken 250 paper-lined poults boxes reported by Osman et al. (2010) and El Kamshishy (2012). Meanwhile Tawyabur et al., (2020) has significant rate with 49.09% of 55 turkey poults sample. Which was significantly higher in diseased (64%; 16/25) than in healthy turkeys (36.67; 11/30). This high prevalence may be due to using PCR targeting the invA gene which is more accurate method for identification. Efficient laboratory methods for isolation, identification and typing of bacteria are essential elements in monitoring and control programs (Salm-Surv, 2003). One of the most common methods is the culture techniques and media that may work best in a particular diagnostic situation depends on a variety of factors, including serovar, source and type of specimens, animal species of origin, experience of the microbiologist, and availability of selective enrichment and selective plating media (OIE, 2014). In particular, culture could recognize viable organisms only, while amplification tests are not dependent on viable or structurally intact cells and the presence of DNA was sufficient to yield a positive result. Thus, the potential for detecting non-viable microorganisms explained the discrepancies between PCR and culture results following antibiotic therapy (Moalic et al., 1997).
Regarding antibiotic resistance, this findings revealed high resistance rates in E. coli isolates, with 74.19% resistant to Amoxicillin clavulanic acid and chloramphenicol, and 70.97% resistant to Erythromycin. Notably, 96.77% remained sensitive to colistin. The high resistance to Amoxicillin clavulanic acid is likely due to β-lactamase production, with the blaTEM gene detected in 83.33% of isolates. These findings are consistent with Eid and Samir (2019), who reported 88.9% resistance to Amoxicillin clavulanic acid in addition to 94.4%) of isolates were positive for blaTEM gene, and multiple other studies reporting similar patterns (Guerra et al., 2003; Hoepers et al., 2018; Osman et al., 2018).
E. coli isolates were highly resistant to Chloramphenicol, Erythromycin and Doxycycline with 74.19% 70.97% and 32.25% which regarded for presence of resistance genes doxycycline (TetA), erythromycin (MphA) and chloramphenicol (floR) detected with 100% in tested sample. this result is matching with Tawyabur et al. (2020) who reported that all E. coli isolates were resistant to erythromycin and chloramphenicol while was 52.73% with tetracycline among them tetA was detected in 27 (27/29; 93.1%). Another similar result in (Abd ElGawad et al., 2023) in which 5 (100%) isolates were found to have tetA(A) and MphA which correlated with phenotypic susceptibility with oxytetracycline and erythromycin with 90% and 80%. The result was higher than (Guerra et al., 2003; Safika et al., 2022) with 66% and 85.0% had tetA genes from E.coli and Salmonella strain respectively.
Antibiogram of Salmonella typhimurium revealed high resistance against Amoxicillin+ clavulanic acid, Doxycycline, Erythromicin with 100% and highly sensitive to Colistin with 100%.
It was analogous with Hasman et al. (2005) and Beutlich et al. (2010) in which all Salmonella isolates from turkey were resistant to Amoxicillin+ clavulanic acid and with Hui and Das (2001) with 86.66% of Salmonella isolates were resistant to chloramphenicol. In contrast with Shahada et al. (2006) who found that all 135 strains were susceptible to chloramphenicol. This result is higher than Diarra et al. (2014) who reported 43% of the isolates were resistant to amoxicillin-clavulanic acid accompined by presence of blaTEM. Meanwhile Penha Filho et al. (2016) has similar finding in which S. Gallinarum was full resistant to chloramphenicol but it was resistant to trimethoprime sulphamethazol with 96% and all isolates were sensitive to Amoxicillin+ clavulanic acid.
Consequently, isolates of Klebsiella pneumoniae exhibited resistance to 100% of all antibiotics subjected to testing, with the exception of gentamicin, which demonstrated a resistance rate of 66.6%, while these isolates were found to be 100% susceptible to colistin. Investigators such as Younis et al. (2016) in Egypt documented a complete resistance to amoxicillin, whereas Kowalczyk et al (2022) in Poland observed a sensitivity of 92.9% to colistin, 88.56% to florfenicol, and 82.6% to amoxicillin clavulanic acid. Among the tested agents, amoxicillin clavulanic acid emerged as the most efficacious against the Klebsiella spp. isolates. All strains of Klebsiella spp. displayed resistance to amoxicillin. A minor fraction of the strains (3.3%) were also capable of producing extended-spectrum beta-lactamases.
In recent years, there have been concerns about the greater frequencies of antibiotic resistance among bacteria isolated from food animals and from the environment (Jensen et al., 2001). The extensive use of antibiotics in human medicine, in animal practice for therapy and as growth promoters in agriculture are considered to be the major reasons for the development of bacterial resistance to antibiotics (Barton, 2000; Sengeløv et al., 2003). There is a growing interest in using natural antibacterial compounds such as extracts of spices and herbs for food preservation (Shan et al., 2007) . Plant-derived antibacterial compounds may be of value as a novel means for controlling antibiotic resistant zoonotic pathogens which contaminate food animals and their products (Palaniappan and Holley, 2010).
Plants are rich in a wide variety of secondary metabolites, such as tannins, terpenoids, alkaloids, and flavonoids, which have been found in vitro to have antimicrobial properties (Cowan, 1999; Lewis and Ausubel, 2006). This led to Tegos et al., (2002) hypothesizing that; Plants produce compounds that can be effective antimicrobials if they find their way into the cell of the pathogen especially across the double membrane barrier of Gram negative bacteria. Production of efflux pump inhibitors by the plant would be one way to ensure delivery of the antimicrobial compound. This hypothesis has been supported by the findings of (Stermitz Lorenz et al., 2000; Stermitz, Tawara-Matsuda et al., 2000). It has often been reported that Gram negative bacteria are more resistant to essential oils than Gram positive bacteria (Blaszyk and Holley, 1998; Shelef, 1984; Smith-Palmer et al., 1998).
Given the increasing antibiotic resistance, our study explored natural alternatives. Clove extract (Syzygium aromaticum) was the most effective extract against all selected strains, with inhibition zones of 19mm for both E. coli and Salmonella, and 17mm for Klebsiella. These effects were enhanced when combined with antibiotics. The antimicrobial activity is attributed to the high content of eugenol (70-90%) and tannins (10-19%). The antibacterial mechanism of eugenol against S. aureus and E.coli was probably related to the damage of cell wall and membrane, the inhibition on biofilm formation, the oxidative stress-mediated apoptosis and the disruption of DNA synthesis. Several researches were parallel with this finding as (Shaheen et al., 2015; Thanissery et al., 2014).
Garlic extract (Allium sativum) was the second most effective, showing inhibition zones of 16mm for E. coli and Klebsiella, and 18mm for Salmonella, with increased effectiveness in antibiotic combinations. it was comparable with (Alzowahi et al., 2013; Sudhir Kumar et al., 2012) with inhibition zones varies between 15-20mm and 24 mm against Escherichia coli and Salmonella spp respectively. The active compound in garlic, allicin, has been well-documented for its antimicrobial properties (Conner, 1993). The reactive organosulfur compounds form disulfide bonds with free sulfhydryl groups of enzymes and compromise the integrity of the bacterial membrane (Bhatwalkar et al., 2021). changes observed in membrane permeability, protein leakage and by scanning electron microscopy suggested that the antimicrobial activity of garlic extracts may be due to destruction of the structural integrity of cell membranes, leading to cell death (Chen et al., 2018).
Rosemary extract (Rosmarinus officinalis) showed variable effectiveness, with inhibition zones of 8mm, 13mm, and 8mm for E. coli, Salmonella, and Klebsiella, respectively. It was identical with (Abd-El Tawab et al., 2019; Celiktas et al., 2007; Mathlouthi et al., 2011). Their activity is linked to compounds such as 1,8-cineole, camphor, and borneol(Knobloch et al., 1989; kordali et al., 2005; Lopes-Lutz et al., 2008). Fu et al. (2007) found that essential oil of rosemary attached to the surface of bacterial body at lower concentrations. At higher concentrations, essential oil entered the cell wall leading cell wall desquamation and shape distortion. Subsequently, essential oils invaded and damaged the cell membrane, so that the intracellular contents burst from the bacterial body.
Ficus sycomorus and Ziziphus spina-christi extracts have no effect on tested strains with several concentration 500mg/ml, 250mg/ml, 125mg and 60mg/ml, this finding is correlated with (Agbidye et al., 2020). As reported by Moreno et al. (2006), the absence of an inhibition zone does not necessarily mean an inactive compound. Compounds less polar diffuse more slowly into the culture medium. The diameter of the inhibition zone is influenced by the rate of diffusion of the antimicrobial agent through the agar, and the hydrophobic nature of most plant extracts prevents uniform diffusion of these substances through agar media (Davidson and Parish, 1989; Rios et al., 1988). Other researches have promising antimicrobial effect such as (Al-Mutairi et al., 2016; Ghareeb et al., 2015; Jebur et al., 2020; Olusesan et al., 2010). The variability in antimicrobial efficacy among different plant extracts in our study reflects the complex nature of phytochemical-bacterial interactions. Recent research suggests that the effectiveness of plant-derived antimicrobials may be influenced by multiple factors, including the bacterial stress response and adaptive mechanisms (Baptista-Silva et al., 2020). Also antibacterial activity of a plant extract might be attributable to the age of the plant used, freshness of plant materials, physical factors (temperature, light water), time of harvesting of plant materials and drying method used before the extraction process (Parekh and Chanda, 2006).
The observed synergistic effects between plant extracts and antibiotics, particularly at specific ratios, support the emerging paradigm of combination therapy as a promising approach to combat antibiotic resistance (Caesar and Cech, 2019). However, the molecular mechanisms underlying these synergistic interactions remain incompletely understood and warrant further investigation. Significant synergistic effects were evaluated between plant extracts and antibiotics then observe the enhancement of antibiotic activity so the ratio chosen to be antiobiotic part is more than natural extract part. Clove and garlic extracts showed synergy with amoxicillin and doxycycline at ratios of 9:1, 7:3, and 8:2 for E. coli and Salmonella, though effectiveness against Klebsiella was limited to a 9:1 ratio. Rosemary showed synergy at 7:3 and 9:1 ratios, excluding Klebsiella. The obtain results regarding the limited effectiveness of some plant extracts against Klebsiella compared to other pathogens align with the general observation that Gram-negative bacteria often show higher resistance to plant-derived compounds (Gibbons et al., 2015). This differential susceptibility highlights the need for targeted approaches in developing alternative antimicrobials. Recent advancements in nanoformulation and delivery systems might offer solutions to enhance the efficacy of plant-derived compounds against resistant pathogens (Wang et al., 2021).
The inconsistency in efficacy among different plant extracts raises important questions about the underlying mechanisms of their antimicrobial properties. For instance, while clove extract has demonstrated significant synergy with antibiotics against resistant strains, as evidenced by a 64.2% inhibition rate of tested microorganisms (Nascimento et al., 2000), rosemary’s variable results suggest that its phytochemical profile may not interact favorably with certain bacterial targets or antibiotic classes. Furthermore, research indicates that specific compounds within these extracts can exhibit distinct modes of action; for example, eugenol from clove and other bioactive constituents might disrupt microbial cell membranes differently than the active components found in rosemary (Jouda et al., 2016). Several mechanism could explain the synergy between extract and antibiotic. Compounds within that extract may block the efflux mechanism or alter the process of efflux and in so doing, extend the life of existing antibacterial drugs, allowing these antibiotics to again block the growth of bacteria such as P. mirabilis strain, which was completely resistance to chloramphenicol (Chusri et al, 2009). Meanwhile specific plant compounds have been reported to induce perturbations in the cell membrane and increase the permeability of antibiotics to bacterial cells (Abreu et al., 2012).
These membrane perturbations, coupled with the action of β-lactams on the transpeptidation of the cell membrane, may enhance the inhibitory activity of the antibiotic (Aiyegoro et al., 2009). Furthermore, some plant-derived compounds can improve the in vitro activity of peptidoglycan inhibiting antibiotics by directly attacking the same site in the cell wall. Similarly, enhanced antimicrobial activity was observed in combinations of clove-ampicillin and clove-tetracycline against K. pneumonia and Proteus spp. Respectively (Nascimento et al., 2000). Abreu et al. (2012) reported that carnosic acid isolated from Rosmarinus officinalis L. potentiated the activity of erythromycin. That study determined that the increased erythromycin activity was due to an inhibition of the bacterial MDR pumps by carsonic acid.
While it remains imperative that research continues in the area of the development of the use of extracts derived from plant species as synergistic potentiators of medicines that had been previously effective signals a coming of age in the treatment of highly resistant infectious diseases that threaten the global community. By regaining the susceptibility of such pathogens to rigorously tested antibiotics, the fight against pervasive, transmissible, and deadly bacteria may finally shift in favor of the clinical treatment of such illnesses.
CONCLUSIONS AND RECOMMENDATIONS
On the basis of the antibacterial assay of this study E. coli was found the more (susceptible to the employed plant extracts) than Salmonella typhimurium and klebsiella pneumoae. All plant extracts were evaluated for their MIC against E. coli, Salmonella typhimurium and klebsiella pneumoae, The strongest effect against E. coli was recorded when cloves was mixed with amoxicillin and doxycycline at (9:1,8:2and 7:3) while Salmonella when cloves and rosemary were mixed with amoxicillin and doxycycline at same ratios . klebsiella was more affected when when cloves was mixed with amoxicillin at (9:1,8:2) . florophenicol hasn’t significant synergy with any of tested extracts.
ACKNOWLEDGEMENTS
Cardinal thanks and deep gratitude for Prof .Dr. Walid Fathy Prof. pharmacolgy Faculty of Veterinary Medicine, Suez Canal University.
NOVELTY STATEMENT
Remerakable antimicrobial effect of cloves against tested bacteria alone or with antibiotics especially E. coli.
AUTHOR’S CONTRIBUTIONS
Prof.Dr. Mohamed E. Enany provide the idea and experimental design, Prof. Dr. Ahmed M. Hamouda make the statics of the experiment and Reem M. Khashaba performing the experiment and write the research .
Conflict of Interest
The authors declare that they have no competing interests.
REFERENCES
Aarestrup, F.M.: Occurrence, selection and spread of resistance to antimicrobial agents used for growth promotion for food animals in Denmark. APMIS. Supplementum, 2000; 101, 1–48. https://doi.org/10.1111/j.1600-0463.2000.tb05380.x
Abd ElGawad, Raghda, Mahmoud Elsayed, Abo Elkheir Esawy, Tamer El Feky, and Mahmoud Abdelrahman. :“Prevalence of Klebsiella Species in Broiler Chickens with Special Reference to Antimicrobial Resistance and Virulence of K. Pneumoniae.” Suez Canal Veterinary Medical Journal. SCVMJ, 2023;28 (1): 87–98.. https://doi.org/10.21608/scvmj.2023.307355
Abd-El Tawab, A.A., Ammar, A.A., Hamouda, A.M., Wafaa, A., Elhawary, S.A., and El-Deen, S.S.: Interaction of Some Plant Extracts with Some Antibiotics against Salmonella from Chickens. International Journal of Current Microbiology and Applied Sciences , 2019; 8(01). https://doi.org/10.20546/ijcmas.2019.803.283
Abreu AC, McBain AJ, Simões M. Plants as sources of new antimicrobials and resistance-modifying agents. Nat Prod Rep. 2012;29:1007–21. https://doi.org/10.1039/c2np20035j
Abdukhalilova, G.; Kaftyreva, L.; Wagenaar, J.A.; Tangyarikov, B.; Bektimirov, A.; Akhmedov, I.; Khodjaev, Z.;Kruse, H.World Health Organization: Occurrence and antimicrobial resistance of Salmonella and Campylobacterin humans and broiler chicken in Uzbekistan. Public Health Panor. 2016; 2, 340–347.
Adams, C.M., Anderson, M.G., Motto, D.G., Price, M.P., Johnson, W.A., and Welsh, M.J.: Ripped pocket and pickpocket, novel Drosophila DEG/ENaC subunits expressed in early development and in mechanosensory neurons. The Journal of Cell Biology, 1998; 140(1), 143–152. https://doi.org/10.1083/jcb.140.1.143
Agbidye, I.G., Gimba, C.E., Igbum, O.G., Agbidye, B.N., and Iortyom, S.D.: phytochemical screening and antibacterial studies of the stem bark extracts of Ficus sycomorus. Chemistry Research Journal ,2020; 5(2), 174–184.
Aiyegoro OA, Afolayan AJ, Okoh AI. In vitro antibacterial activities of crude extracts of the leaves of Helichrysum longifolium in combination with selected antibiotics. Afr J Pharm Pharmacol. 2009;3:293–300
Al-Mutairi, M., Ali, S., Aly, S., and Yousef-Aldebasi, D. antibacterial activity of sider (ziziphus spina- christi), leaves extract against selected pathogenic bacteria. European Journal of Pharmaceutical and Medical Research 2016; 3, 138–144.
Altekruse, S.F., Elvinger, F., Lee, K.Y., Tollefson, L.K., Pierson, F.W., Eifert, J., and Sriranganathan, N. Antimicrobial susceptibilities of Escherichia coli strains from a turkey operation. journal of the american veterinary medical association, 2002; 221(3), 411–416. https://doi.org/10.2460/javma.2002.221.411
Alzowahi, F.A., Abu-Taleb, A., As-Suhbani,A., and Kadam,T.A. The inhibitory effects of garlic extract and its fractions against some Enterobacteriaceae sp isolated from sprouted Mung bean. International Journal of Current Microbiology and Applied Sciences, 2013; 2(7), 104–115.
Andersson, D.I.: Persistence of antibiotic resistant bacteria. Current Opinion in Microbiology, 2003; 6(5), 452–456. https://doi.org/10.1016/j.mib.2003.09.001
Andino, A.; Hanning, I. Salmonella enterica: Survival, Colonization, and Virulence Dierences among Serovars. Sci. World J. 2015;2015, 520179. https://doi.org/10.1155/2015/520179
Arikan, O.A., Sikora, L.J., Mulbry, W., Khan, S.U., and Foster, G.D.: Composting rapidly reduces levels of extractable oxytetracycline in manure from therapeutically treated beef calves. Bioresource Technology, 2007; 98(1), 169–176. https://doi.org/10.1016/j.biortech.2005.10.041
Asaduzzaman, M.; Salma, U.; Ali, H.S.; Hamid, M.A.; Miah, A.G. Problems and prospects of turkey (Meleagris gallopavo) production in Bangladesh. Res. Agric. Livest. Fish. 2017; 4, 77–90. https://doi.org/10.3329/ralf.v4i2.33719
Aury, K.; Chemaly, M.; Petetin, I.; Rouxel, S.; Picherot, M.; Michel, V.; Le Bouquin, S. Prevalence and risk factors for Salmonella enterica subsp. enterica contamination in French breeding and fattening turkey flocks at the end of the rearing period. Prev. Vet. Med. 2010; 94, 84–93. https://doi.org/10.1016/j.prevetmed.2009.12.002
Awoyinka, O.A, Balogun, I.O., Ogunnowo, A.A., :Phytochemical screening and in vitro bioactivity of Cnidoscolus aconitifolius (Euphor-biaceae). Journal of Medicinal Plants2007; 1, 063-065.
Bachman, M.A. :Colonization, Infection, and the Accessory Genome of Klebsiella pneumoniae. Frontiers in Cellular and Infection Microbiology, 2018; 8(4),1-15. https://doi.org/10.3389/fcimb.2018.00004
Bai, J., Li, J., Chen, Z., Bai, X., Yang, Z., Wang,Z., and Yang,Y. :Antibacterial activity and mechanism of clove essential oil against foodborne pathogens. LWT, 2023; 173, 114249. https://doi.org/10.1016/j.lwt.2022.114249
Balouiri, M., Sadiki, M., and Ibnsouda, S.K. :Methods for in vitro evaluating antimicrobial activity, A review. Journal of Pharmaceutical Analysis, 2016; 6(2), 71–79. https://doi.org/10.1016/j.jpha.2015.11.005
Baptista-Silva, S., Borges, S., Ramos, O.L., Pintado, M., and Sarmento, B. The progress of essential oils as potential therapeutic agents: A review. Journal of Essential Oil Research, 2020; 32(4), 279–295. https://doi.org/10.1080/10412905.2020.1746698
Barakat, D., El-Far, A., Sadek, K., Mahrous, U., Ellakany, H., and Abdel-Latif, M. :Anise (Pimpinella anisum) enhances the growth performance, immunity and antioxidant activities in broilers. International Journal of Pharmaceutical Sciences Review and Research, 2016; 37(24), 134–140.
Barham, A.R., Barham, B.L., Johnson, A.K., Allen, D.M., Blanton, J.R., and Miller, M.F. Effects of the Transportation of Beef Cattle from the Feed yard to the Packing Plant on Prevalence Levels of Escherichia coli O157 and Salmonella spp. Journal of Food Protection, 2002;65(2), 280–283. https://doi.org/10.4315/0362-028X-65.2.280
Barlow, M. 2009. What Antimicrobial Resistance Has Taught Us About Horizontal Gene Transfer. In M.B. Gogarten, J.P. Gogarten, and L.C. Olendzenski (Eds.), Horizontal Gene Transfer: Genomes in Flux (pp. 397–411). Humana Press. https://doi.org/10.1007/978-1-60327-853-9_23
Barton, M.D. Antibiotic use in animal feed and its impact on human health. Nutrition Research Reviews, 2000; 13(2), 279–299. https://doi.org/10.1079/095442200108729106
Beuchat, L.R. (2007). Control of foodborne pathogens and spoilage microorganisms by naturally occurring antimicrobials. In Microbial food contamination (pp. 341–368). CRC Press. https://doi.org/10.1201/9781420008470.ch12
Beutlich, J., Rodríguez, I., Schroeter , A., Käsbohrer, A., Helmuth, R. andGuerra, B.:.”A predominant multidrug-resistant Salmonella enterica serovar Saintpaul clonal line in German turkey and related food products.”Applied and environmental microbiology, 2010; 76(11): 3657-3667. https://doi.org/10.1128/AEM.02744-09
Bhatwalkar, S.B., Mondal, R., Krishna, S.B.N., Adam, J.K., Govender, P., and Anupam, R. :Antibacterial Properties of Organosulfur Compounds of Garlic (Allium sativum). Frontiers in Microbiology, 2021;12. https://doi.org/10.3389/fmicb.2021.613077
Blaszyk, M., and Holley, R.A. Interaction of monolaurin, eugenol and sodium citrate on growth of common meat spoilage and pathogenic organisms. International Journal of Food Microbiology, 1998; 39(3) 175–183. https://doi.org/10.1016/S0168-1605(97)00134-7
Bo, W., Duan, H., Qi, Q., Cai, Y., Zhong, Z. and Chai, T. :Identifying virulence factor genes in E. coli in animal houses and their transmission to outside environments. J. Aerosol Sci., 2018; 117(3): 189-199. https://doi.org/10.1016/j.jaerosci.2017.11.009
Caesar, L.K., and Cech, N.B. Synergy and antagonism in natural product extracts: When 1+ 1 does not equal 2. Natural Product Reports, 2019; 36(6), 869–888. https://doi.org/10.1039/C9NP00011A
Celiktas, O.Y., Kocabas, E.E.H., Bedir, E., Sukan, F.V., Ozek, T., and Baser, K.H.C. Antimicrobial activities of methanol extracts and essential oils of Rosmarinus officinalis, depending on location and seasonal variations. Food Chemistry, 2007; 100(2), 553–559. https://doi.org/10.1016/j.foodchem.2005.10.011
Chanda, S., Dudhatra, S., and Kaneria, M.: Antioxidative and antibacterial effects of seeds and fruit rind of nutraceutical plants belonging to the Fabaceae family. Food and Function 2010; 1(3), 308–315. https://doi.org/10.1039/c0fo00028k
Chen, C., Liu, C.H., Cai, J., Zhang, W., Qi, W.L., Wang, Z., Liu, Z.B., and Yang,Y:Broad-spectrum antimicrobial activity, chemical composition and mechanism of action of garlic (Allium sativum) extracts. Food Control, 2018; 86, 117–125 https://doi.org/10.1016/j.foodcont.2017.11.015.
Chong, Y., Ito, Y. and Kamimura, T. :Genetic evolution and clinical impact in extended spectrum beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae. Infect. Genet. Evol. 2011;11(7): 1499-1504. https://doi.org/10.1016/j.meegid.2011.06.001
Chusri S, Villanueva I, Voravuthikunchai SP, Davies J. Enhancing antibiotic activity: A strategy to control Acinetobacter infections. J Antimicrob Chemother. 2009;64:1203–11 https://doi.org/10.1093/jac/dkp381
Circella, E., Pennelli, D., Tagliabue, S., Ceruti, R., Giovanardi, D., & Camarda, A. Virulence – associated genes in Avian Pathogenic Escherichia coli of turkey. Italian Journal of Animal Science, 2009; 8(4), 775–779. https://doi.org/10.4081/ijas.2009.775
CLSI 2011. Clinical and Laboratory Standards Institute. PerformanceStandards for Antimicrobial Susceptibility Testing; Twenty-First Informational Supplement. CLSI document M100-S21 (ISBN 1-56238742-1). Clinical and Laboratory Standards Institute, 940 West Valley Road, Suite 1400, Wayne, Pennsylvania 19087 USA.
Colom K, PèrezJ, Alonso R, Fernández-AranguizA,LariňoE, Cisterna R. :Simple and reliable multiplex PCR assay for detection of blaTEM,blaSHV and blaOXA-1 genes in Enterobacteriaceae. FEMS Microbiology Letters, 2003; 223, 147-151. https://doi.org/10.1016/S0378-1097(03)00306-9
Conner, D.E. Naturally occurring compounds. Antimicrobials in Foods,1993;441–468.
Cowan, M.M. Plant products as antimicrobial agents. Clinical Microbiology Review,1999; S, 12(4), 564–582. https://doi.org/10.1128/CMR.12.4.564
Cressy, H.K., Jerrett, A.R., Osborne, C.M., and Bremer, P.J.: A novel method for the reduction of numbers of Listeria monocytogenes cells by freezing in combination with an essential oil in bacteriological media. Journal of Food Protection, 2003; 66(3), 390–395. https://doi.org/10.4315/0362-028X-66.3.390
Cushnie, T.T., and Lamb, A.J.: Recent advances in understanding the antibacterial properties of flavonoids. International Journal of Antimicrobial Agents, 2011; 38(2), 99–107. https://doi.org/10.1016/j.ijantimicag.2011.02.014
Davidson, P.M., and Parish, M.E. Methods for testing the efficacy of food antimicrobials, 1989;43(1), 148--155.
De Oliveira, A.L.; Newman, D.M.; Sato, Y.; Noel, A.; Rauk, B.; Nolan, L.K.; Barbieri, N.L.; Logue, C.M.:Characterization of Avian Pathogenic Escherichia coli (APEC) Associated With Turkey Cellulitis in Iowa.Front. Vet. Sci., 2020; 7, 380 https://doi.org/10.3389/fvets.2020.00380
Dho-Moulin, M., and Fairbrother, J.M: Avian pathogenic Escherichia coli (APEC). Veterinary Research, 1999;30 (2–3), 299–316.
Diarra, M. S., Delaquis, P., Rempel , H., Bach, S., Harlton, C., Aslam, M.,Pritchard, J. and Topp, E. :”Antibiotic resistance and diversity ofSalmonella Enterica serovars associated with broiler chickens.” Journal ofFood Protection, 2014;77(1): 40-49. https://doi.org/10.4315/0362-028.JFP-13-251
D’Incau, M., Pennelli, D., Lavazza, A., Tagliabue, S. Serotypes of E. coli isolated from avian species in Lombardia and Emilia Romagna (North Italy). Italian Journal of Animal Science, 2006; 5(3), 298–301. https://doi.org/10.4081/ijas.2006.298
Dorman, H.D., and Deans, S.G. :Antimicrobial agents from plants: Antibacterial activity of plant volatile oils. Journal of Applied Microbiology, 2000; 88(2), 308–316. https://doi.org/10.1046/j.1365-2672.2000.00969.x
Doublet, B.; Lailler, R.; Meunier, D.; Brisabois, A.; Boyd, D.; Mulvey, M.R.; Chaslus-Dancla, E. and Cloeckaert, A.: Variant Salmonella Genomic Island 1 Antibiotic Resistance Gene Cluster in Salmonella enteric Serovar Albany. Emerging Infectious Diseases, 2003; 9(5), 585-591. https://doi.org/10.3201/eid0905.020609
Edwards, P.R., and Ewing, W.H. 1972. Identification of enterobacteriaceae. 1st ed. Atlanta, Georgia
Eid, S., and Samir, A.H.. Extended-spectrum beta-lactamase and Class 1 integrons in multidrug-resistant Escherichia coli isolated from turkeys. Veterinary World, 2019, 12(7), 1167–1174. https://doi.org/10.14202/vetworld.2019.1167-1174
El-Demerdash, F.M., El-Sayed, R.A., and Abdel-Daim, M.M. :Hepatoprotective potential of Rosmarinus officinalis essential oil against hexavalent chromium-induced hematotoxicity, biochemical, histological, and immunohistochemical changes in male rats. Environmental Science and Pollution Research, 2021;28(14), 17445–17456. https://doi.org/10.1007/s11356-020-12126-8
El Kamshishy, M.M. 2012. Epidemiological studies on enterobacteriaceae organisms in pets and birds come through Cairo international airport. Ph.D. Thesis, Cairo University., Egypt.
European Food Safety Authority. 2009a: The Community Summary Report on Trends and Sources of Zoonoses, Zoonotic Agents, Antimicrobial Resistance and Foodborne Outbreaks in the European Union in 2007.
European Food Safety Authority. 2009b: United Kingdom*Trends and Sources of Zoonoses and Zoonotic Agents in Humans, Foodstuffs, Animals and Feedingstuffs in 2007.
Ezekiel, C.N., Olarinmoye, A.O., Oyinloye, J.M.A., Olaoye, O.B., and Edun, A.O. Distribution, antibiogram and multidrug resistance in Enterobacteriaceae from commercial poultry feeds in Nigeria. Afr j Microbiol Res2011; 5(3), 294–301.
Finegold, S.M., and Baron, E.J. 1986. Enterobacteriaceae. Bailey and Scott’s Diagnostic Microbiology, 7th Ed. The CV Mosby Co., St. Louis, 413.
Fluckey, W.M., Loneragan, G.H., Warner, R., and Brashears, M.M. :Antimicrobial Drug Resistance of Salmonella and Escherichia coli Isolates from Cattle Feces, Hides, and Carcasses. Journal of Food Protection, 2007; 70(3), 551–556 https://doi.org/10.4315/0362-028X-70.3.551.
Friedman, M., Henika, P.R., and Mandrell, R.E. :Bactericidal activities of plant essential oils and some of their isolated constituents against Campylobacter jejuni, Escherichia coli, Listeria monocytogenes, and Salmonella enterica. Journal of Food Protection, 2002; 65(10), 1545–1560. https://doi.org/10.4315/0362-028X-65.10.1545
Fu, Y., Zu, Y., Chen, L., Efferth, T., Liang, H., Liu, Z., and Liu,W.: Investigation of Antibacterial Activity of Rosemary Essential Oil against Propionibacterium acnes with Atomic Force Microscopy. Planta Medica, 2007; 73, 1275–1280. https://doi.org/10.1055/s-2007-981614
Funmilayo, A.T., Olufunke, O.A., and Abike, T.O. Detection of blaCTX, blaSHV and AAC-3-IV resistance genes among selected Klebsiella sp, Escherichia coli and Proteus mirabilis isolated from feacal droppings of Meleagris gallopavo f. Domestica .Multidisciplinary Academic Journal Publisher, 2020;12(10):15-23
Ghareeb, M.A., Refahy, L.A., Saad, A.M., Osman, N.S., Abdel-Aziz, M.S., ElShazly, M.A., and Mohamed, A.S. In vitro antimicrobial activity of five Egyptian plant species. Journal of Applied Pharmaceutical Science, 2015; 5(2), 045–049. https://doi.org/10.7324/JAPS.2015.58.S7
Gibbons, D., Morrissey, C., and Mineau, P. A review of the direct and indirect effects of neonicotinoids and fipronil on vertebrate wildlife. Environmental Science and Pollution Research, 2015; 22(1), 103–118. https://doi.org/10.1007/s11356-014-3180-5
Giovanardi, D., Lupini,C., Pesente,P., Rossi, G., Ortali,G., and Catelli, E. Characterization and antimicrobial resistance analysis of avian pathogenic Escherichia coli isolated from Italian turkey flocks. Poultry Science, 2013; 92(10), 2661–2667. https://doi.org/10.3382/ps.2013-03194
Guerra,B., Junker,E., Schroeter, A., Malorny, B., Lehmann, S., and Helmuth, R.:. Phenotypic and genotypic characterization of antimicrobial resistance in German Escherichia coli isolates from cattle, swine and poultry. Journal of Antimicrobial Chemotherapy, 2003; 52(3), 489–492. https://doi.org/10.1093/jac/dkg362
Habbal, O., Hasson, S.S., El-Hag, A.H., Al-Mahrooqi, Z., Al-Hashmi, N., Al-Bimani, Z., Al-Balushi, M.S., and Al-Jabri, A.A. Antibacterial activity of Lawsonia inermis Linn (Henna) against Pseudomonas aeruginosa. Asian Pacific Journal of Tropical Biomedicine, 2011; 1(3), 173–176. https://doi.org/10.1016/S2221-1691(11)60021-X
Hamza, E., Dorgham, S.M., and Hamza, D.A. Carbapenemase-producing Klebsiella pneumoniae in broiler poultry farming in Egypt. Journal of Global Antimicrobial Resistance, 2016; 7, 8–10. https://doi.org/10.1016/j.jgar.2016.06.004
Hasman, H., Mevius D., Veldman K., Olesen I. and Aarestrup F. M.:”β-Lactamases among extended-spectrum β-lactamase (ESBL)-resistantSalmonella from poultry, poultry products and human patients in TheNetherlands.” Journal of Antimicrobial Chemotherapy, 2005; 56(1): 115-121. https://doi.org/10.1093/jac/dki190
Hoepers, P.G., Silva, P.L., Rossi, D.A., Valadares Júnior, E.C., Ferreira, B.C., Zuffo, J.P., Koerich, P.K., and Fonseca, B.B. The association between extended spectrum beta-lactamase (ESBL) and ampicillin C (AmpC) beta-lactamase genes with multidrug resistance in Escherichia coli isolates recovered from turkeys in Brazil. British Poultry Science, 2018; 59(4), 396–401. https://doi.org/10.1080/00071668.2018.1468070
Hui, A. and Das R.:”Studies on isolation, serotyping and antibotic sensitivityof Salmonellae isolated from ducks.”Indian Veterinary Journal (India), 2001;781058 -1059
Humphries, R. M., Kircher, S., Ferrell, A., Krause, K.M., Malherbe, R., Hsiung, A., and Burnham, C.A.D.: The Continued Value of Disk Diffusion for Assessing Antimicrobial Susceptibility in Clinical Laboratories: Report from the Clinical and Laboratory Standards Institute Methods Development and Standardization Working Group. Journal of Clinical Microbiology, 2018; 56(8), e00437-18. https://doi.org/10.1128/JCM.00437-18
Jackson, M.A., and Esimone,C.:. Evaluation of in vitro antimicrobial effect of combinations of erythromycin and Euphorbia hirta leaf extract against Staphylococcus aureus. Pharm Biotechnol, 2010; 2, 22–24.
Jebur, Assist. Prof. Dr. M., Hamza, H., Alkaim, A., and Hindi, N. The Activity of Aquatic Extract of Ziziphus pina-christi against Bacteria, an in Vitro Study. International Journal of Psychosocial Rehabilitation, 2020; 24(5), 1821-1827. https://doi.org/10.37200/IJPR/V24I5/PR201854
Jensen, L.B., Baloda, S., Boye, M., and Aarestrup, F.M.: Antimicrobial resistance among Pseudomonas spp. And the Bacillus cereus group isolated from Danish agricultural soil. Environment International, 2001; 26(7–8), 581–587. https://doi.org/10.1016/S0160-4120(01)00045-9
Jesus, S.O., and Correia, J.H.D. 1998. Potential pathogens recovered from the upper respiratory tract of psittacine birds. Proceedings of International Virtual Conference in Veterinary Medicine: Diseases of Psittacine Birds. University of Georgia College of Veterinary Medicine.
Jouda, M. M., Elbashiti, T., Masad, A., and Albayoumi, M. :The antibacterial effect of some medicinal plant extracts and their synergistic effect with antibiotics. World Journal of Pharmacy and Pharmaceutical Sciences, 2016;5(2), 23–33..
Kalemba,D., and Kunicka, A.: Antibacterial and antifungal properties of essential oils. Current Medicinal Chemistry, 2003;10(10), 813–829. https://doi.org/10.2174/0929867033457719
Kaikabo, A.A., AbdulKarim, S.M., Abas, F. :Evaluation of the efficacy of chitosan nanoparticles loaded PhiKAZ14 bacteriophage in the biological control of colibacillosis in chickens. Poultry Sci., 2017; 96,295–302. https://doi.org/10.3382/ps/pew255
Kar, J.; Barman, T.R.; Sen, A.; Nath, S.K.: Isolation and identification of Escherichia coli and Salmonella sp. From apparently healthy Turkey. Int. J. Adv. Res. Biol. Sci. 2017; 4, 72–78
Karlowsky, J.A., Jones, M.E., Thornsberry, C., Friedland, I.R., and Sahm, D.F.: Trends in Antimicrobial Susceptibilities among Enterobacteriaceae Isolated from Hospitalized Patients in the United States from 1998 to 2001. Antimicrobial Agents and Chemotherapy, 2003; 47(5), 1672–1680. https://doi.org/10.1128/AAC.47.5.1672-1680.2003
Kauffmann, T. 1974. 1,3-Anionic Cycloadditions of Organolithium Compounds: An Initial Survey. New synthetic methods (4). Angewandte Chemie International Edition in English, 13(10), 627–639. https://doi.org/10.1002/anie.197406271
Kilonzo-Nthenge, A., Rotich, E., and Nahashon, S.N. :Evaluation of drug-resistant Enterobacteriaceae in retail poultry and beef. Poultry Science, 2013.;92(4), 1098–1107. https://doi.org/10.3382/ps.2012-02581
Kim, J.W., Y.S. Kim, and K.H. Kyung. :Inhibitory activity of essential oil of garlic and onion against bacteria and yeasts. J. Food Prot. ,2004; 67, 499–504 https://doi.org/10.4315/0362-028X-67.3.499
Knobloch, K., Pauli, A., Iberl, B., Weigand, H., and Weis, N. Antibacterial and Antifungal Properties of Essential Oil Components. Journal of Essential Oil Research, 1989; 1(3), 119–128. https://doi.org/10.1080/10412905.1989.9697767
Kordali, S., Cakir, A., Mavi, A., Kilic, H., and Yildirim, A. Screening of Chemical Composition and Antifungal and Antioxidant Activities of the Essential Oils from Three Turkish Artemisia Species. Journal of Agricultural and Food Chemistry, 2005; 53(5), 1408–1416. https://doi.org/10.1021/jf048429n
Kowalczyk, J., Czokajło, I., Gańko, M., Śmiałek, M., and Koncicki, A. Identification and Antimicrobial Resistance in Klebsiella spp. Isolates from Turkeys in Poland between 2019 and 2022. Animals, 2022; 12(22), 3157 https://doi.org/10.3390/ani12223157
Lacombe, A., V.C. Wu, S.Tyler, and K.Edwards. : Antimicrobial action of the American cranberry constituents; phenolics, anthocyanins, and organic acids, against Escherichia coli O157:H7. Int. J. Food Microbiol. , 2010; 139, 102– 107. https://doi.org/10.1016/j.ijfoodmicro.2010.01.035
Lewis, K., and Ausubel, F.M. Prospects: for plant-derived antibacterials. Nature Biotechnology, 2006; 24(12), 1504–1507. https://doi.org/10.1038/nbt1206-1504
Lewis, W.H., and Elvin-Lewis, M.P. (2003). Medical botany: Plants affecting human health. John Wiley and Sons.
Lopes-Lutz, D., Alviano, D.S., Alviano, C.S., and Kolodziejczyk, P.P. Screening of chemical composition, antimicrobial and antioxidant activities of Artemisia essential oils. Phytochemistry, 2008; 69(8), 1732–1738. https://doi.org/10.1016/j.phytochem.2008.02.014
Lorian, V. 2005. Antibiotics in laboratory medicine. Lippincott Williams and Wilkins. Martin, R. M.
Magaldi, S., Mata-Essayag, S., De Capriles, C. H., Pérez, C., Colella, M. T., Olaizola, C., and Ontiveros, Y.: Well diffusion for antifungal susceptibility testing. International Journal of Infectious Diseases, 2004;8(1), 39–45. https://doi.org/10.1016/j.ijid.2003.03.002
Mainali, C., Gensler, G., Mcfall, M., King, R., Irwin, R., and Senthilselvan, A.: Evaluation of Associations between Feed Withdrawal and Other Management Factors with Salmonella Contamination of Broiler Chickens at Slaughter in Alberta. Journal of Food Protection, 2009;72(10), 2202–2207. https://doi.org/10.4315/0362-028X-72.10.2202
Martin, R.M. and Bachman, M.A. 2018. Colonization, Infection, and the Accessory Genome of Klebsiella pneumoniae. Frontiers in Cellularand Infection Microbiology. 8. https://doi.org/10.3389/fcimb.2018.00004
Mathlouthi, N., Bouzaiene, T., Oueslati, I., Recoquillay, F., Hamdi, M., Urdaci, M., and Ridha, B. Use of rosemary, oregano, and a commercial blend of essential oils in broiler chickens: In vitro antimicrobial activities and effects on growth performance. Journal of Animal Science, 2011; 90, 813–823. https://doi.org/10.2527/jas.2010-3646
Moalic, P.-Y., Gesbert F., Laigret F. and Kempf I. (1997).”Evaluation of polymerase chain reaction for detection of Mycoplasma meleagridis infectionin turkeys.” Veterinary microbiology 58(2-4): 187-193. https://doi.org/10.1016/S0378-1135(97)00177-6
Moreno, S., Scheyer, T., Romano, C.S., and Vojnov, A.A. Antioxidant and antimicrobial activities of rosemary extracts linked to their polyphenol composition. Free Radical Research, 2006; 40(2). https://doi.org/10.1080/10715760500473834
Nascimento, G. G., Locatelli, J., Freitas, P.C., and Silva, G.L. :Antibacterial activity of plant extracts and phytochemicals on antibiotic-resistant bacteria. Brazilian Journal of Microbiology, 2000; 31, 247–256. https://doi.org/10.1590/S1517-83822000000400003
Nguyen, M.C.P.; Woerther, P.; Bouvet, M.; Andremont, A.; Leclercq, R. and Canu, A.: Escherichia coli as reservoir for macrolide resistance genes. Emerging infectious diseases, 2009; 15 (10), 1648. https://doi.org/10.3201/eid1510.090696
Normark, B.H., and Normark, S. 2002. Evolution and spread of antibiotic resistance. J. Int. Med., 252(2): 91–106. https://doi.org/10.1046/j.1365-2796.2002.01026.x
O.I.E., (2014). Version adopted by the World Assembly of Delegates of the OIE,Leptospirosis.
Olsen, R.H., Chadfield, M.S., Christensen, J.P., Scheutz, F., Christensen, H., and Bisgaard, M.: Clonality and virulence traits of Escherichia coli associated with haemorrhagic septicaemia in turkeys. Avian Pathology, 2011;40(6), 587–595. https://doi.org/10.1080/03079457.2011.618942
Olusesan, A.G., Ebele, O.C.L., Onwuegbuchulam, O.N., and Olorunmola, E.J. Preliminary in-vitro antibacterial activities of ethanolic extracts of Ficus sycomorus Linn. and Ficus platyphylla Del.(Moraceae). Afr. J. Microbiol. Res., 2010;. 4(8), 598.
Osman, K.M., Kappell, A.D., Elhadidy, M., ElMougy, F., El-Ghany, W.A.A., Orabi, A., Mubarak, A.S., Dawoud, T.M., Hemeg, H.A., and Moussa, I.M. Poultry hatcheries as potential reservoirs for antimicrobial-resistant Escherichia coli: A risk to public health and food safety. Scientific Reports, 2018; 8(1), 5859. https://doi.org/10.1038/s41598-018-23962-7
Osman, K.M., Yousef, A.M.M., Aly, M.M., and Radwan, M.I. Salmonella spp. Infection in Imported 1-Day-Old Chicks, Ducklings, and Turkey Poults: A Public Health Risk. Foodborne Pathogens and Disease, 2010, 7(4), 383–390. https://doi.org/10.1089/fpd.2009.0358
Palaniappan, K., and Holley, R.A. Use of natural antimicrobials to increase antibiotic susceptibility of drug resistant bacteria. International Journal of Food Microbiology, 2010;140(2–3), 164–168. https://doi.org/10.1016/j.ijfoodmicro.2010.04.001
Parekh. J and Chanda. :S. In-vitro Antimicrobial Activities of Extracts of Launaea procumbens Roxb. (Labiateae), Vitis vinifera L. (Vitaceae) and Cyperus rotundus L. (Cyperaceae). African Journal of Biomedical Research, 2006; 9: 89 -93 https://doi.org/10.4314/ajbr.v9i2.48780
Paudel, G., Vandelanotte, C., Dahal, P.K., Biswas, T., Yadav, U.N., Sugishita, T., and Rawal, L. Self-care behaviours among people with type 2 diabetes mellitus in South Asia: A systematic review and meta-analysis. Journal of Global Health, 2022; 12,04056. https://doi.org/10.7189/jogh.12.04056
Peng, L.Y., Yuan, M., Cui, Z.Q., Wu, Z.M., Yu, Z.J., Song, K., Tang, B., Fu, B.D. :Rutin inhibits quorum sensing, biofilm formation and virulence genes in avian pathogenic Escherichia coli. Microb.Pathog, 2018;119,54–59. https://doi.org/10.1016/j.micpath.2018.04.007
Penha Filho, R.A.C., Ferreira, J.C., Kanashiro, A.M.I., Darini, A.L. da C., and Berchieri Junior, A.: Antimicrobial susceptibility of Salmonella Gallinarum and Salmonella Pullorum isolated from ill poultry in Brazil. Ciência Rural, 2016, 46, 513–518. https://doi.org/10.1590/0103-8478cr20150398
Rakholiya,K., and Chanda, S. In vitro interaction of certain antimicrobial agents in combination with plant extracts against some pathogenic bacterial strains. Asian Pacific Journal of Tropical Biomedicine, 2012; 2(3), S1466–S1470. https://doi.org/10.1016/S2221-1691(12)60439-0
Randall, L.P.; Cooles, S.W.; Osborn, M.K.; Piddock, L.J.V. and Woodward, M.J.: Antibiotic resistance genes, integrons and multiple antibiotic resistance in thirty-five serotypes of Salmonella entericaisolated from humans and animals in the UK. Journal of Antimicrobial Chemotherapy, 2004;53, 208–216. https://doi.org/10.1093/jac/dkh070
Rikihisa, Y., Zhang, C., and Christensen, B.M. :Molecular Characterization of Aegyptianella pullorum ( Rickettsiales , Anaplasmataceae ). Journal of Clinical Microbiology, 2003;41(11), 5294–5297. https://doi.org/10.1128/JCM.41.11.5294-5297.2003
Rios, J.L., Recio, M.C., and Villar, A. Screening methods for natural products with antimicrobial activity: A review of the literature. Journal of Ethnopharmacology, 1988; 23(2–3), 127–149. https://doi.org/10.1016/0378-8741(88)90001-3
Safika, Safika, Zumala Nilasari, and Fachriyan Hasmi Pasaribu. :“Detection of Antibiotic Resistance Coding Gene in Klebsiella Pneumoniae Bacteria Isolated from Broiler Chickens in West Java, Indonesia.” Journal of Applied Pharmaceutical Science, 2022; 12 (7): 190–98. https://doi.org/10.7324/JAPS.2022.120719
Salm-Surv, G. (2003). “A global Salmonella surveillance and laboratory support project of thWorld Health Organization.” Laboratory Protocols Level 1Training Course: Isolation of Salmonella: 3-6.
Sanders, C.C., Sanders, W.E., and Moland, E.S. Decimal assay for additivity of drugs permits delineation of synergy and antagonism. Antimicrobial Agents and Chemotherapy, 1993;37(2), 260–264. https://doi.org/10.1128/AAC.37.2.260
Sengeløv, G., Agers, Y., Halling-Sørensen, B., Baloda, S.B., Andersen, J.S., and Jensen, L.B. Bacterial antibiotic resistance levels in Danish farmland as a result of treatment with pig manure slurry. Environment International, 2003; 28(7), 587–595. https://doi.org/10.1016/S0160-4120(02)00084-3
Shahada, F., Chuma, T., Tobata, T., Okamoto, K., Sueyoshi, M. and Takase, K.: “Molecular epidemiology of antimicrobial resistance amongSalmonella enterica serovar Infantis from poultry in Kagoshima, Japan.”International journal of antimicrobial agents, 2006; 28(4): 302-307. https://doi.org/10.1016/j.ijantimicag.2006.07.003
Shaheen, A.Y., Sheikh, A.A., Rabbani, M., Aslam, A., Bibi, T., Liaqat, F., Muhammad, J., and Rehmani, S.F. Antibacterial activity of herbal extracts against multi-drug resistant Escherichia coli recovered from retail chicken meat. Pakistan Journal of Pharmaceutical Sciences, 2015; 28(4).
Shan, B., Cai, Y.Z., Brooks, J.D., and Corke, H. The in vitro antibacterial activity of dietary spice and medicinal herb extracts. International Journal of Food Microbiology, 2007;117(1), 112–119. https://doi.org/10.1016/j.ijfoodmicro.2007.03.003
Shelef, L.A. Antimicrobial effects of spices. Journal of Food Safety, 1984; 6(1), 29–44. https://doi.org/10.1111/j.1745-4565.1984.tb00477.x
Smith-Palmer, Stewart, and Fyfe. Antimicrobial properties of plant essential oils and essences against five important food-borne pathogens. Letters in Applied Microbiology, 1998; 26(2), 118–122. https://doi.org/10.1046/j.1472-765X.1998.00303.x
Snow, L.C., Davies, R.H., Christiansen, K.H., Carrique‐Mas, J.J., Cook, A.J.C., and Evans, S J. Investigation of risk factors for Salmonella on commercial egg‐laying farms in Great Britain, 2004–2005. Veterinary Record, 2010;166(19), 579–586. https://doi.org/10.1136/vr.b4801
Soaad, A.D., Ramesa, S.B.: Antibacterial activities of extracts of leaf, fruit, seed and bark of pjoenix dactylifera. African Journal of Bacteriology, 2012; 11, 10021-10025. https://doi.org/10.5897/AJB11.4309
Stermitz, F.R., Lorenz, P., Tawara, J.N., Zenewicz, L.A., and Lewis, K. Synergy in a medicinal plant: Antimicrobial action of berberine potentiated by 5′-methoxyhydnocarpin, a multidrug pump inhibitor. Proceedings of the National Academy of Sciences, 2000;97(4), 1433–1437. https://doi.org/10.1073/pnas.030540597
Stermitz, F.R., Tawara-Matsuda, J., Lorenz, P., Mueller, P., Zenewicz, L., and Lewis, K. 5‘-Methoxyhydnocarpin-D and Pheophorbide A: Berberis Species Components that Potentiate Berberine Growth Inhibition of Resistant Staphylococcus a ureus. Journal of Natural Products, 2000; 63(8), 1146–1149. https://doi.org/10.1021/np990639k
Sudhir Kumar, S.K., Nancy Marwaha, N.M., Devendra Singh, D.S., and Vijay Kumar, V K. Evaluating the antibacterial activity of plant extracts against bacterial pathogens Journal of Drug Deli very and Therapeutics; 2012, 2(4), 182-185 https://doi.org/10.22270/jddt.v2i4.244
Tawyabur, M., Islam, M.S., Sobur, M.A., Hossain, M.J., Mahmud, M.M., Paul, S., Hossain, M.T., Ashour, H.M., and Rahman, M.T. Isolation and Characterization of Multidrug-Resistant Escherichia coli and Salmonella spp. From Healthy and Diseased Turkeys. Antibiotics, 2020; 9(11), Article 11. https://doi.org/10.3390/antibiotics9110770
Tegos, G., Stermitz, F.R., Lomovskaya, O., and Lewis, K. Multidrug Pump Inhibitors Uncover Remarkable Activity of Plant Antimicrobials. Antimicrobial Agents and Chemotherapy, 2002; 46(10), 3133–3141. https://doi.org/10.1128/AAC.46.10.3133-3141.2002
Thanissery, R., Kathariou, S., and Smith, D.P. Rosemary oil, clove oil, and a mix of thyme-orange essential oils inhibit Salmonella and Campylobacter in vitro. Journal of Applied Poultry Research, 2014; 23(2), 221–227. https://doi.org/10.3382/japr.2013-00888
Valgas, C., Souza, S. M. de, Smânia, E.F., and Smânia Jr, A. :Screening methods to determine antibacterial activity of natural products. Brazilian Journal of Microbiology, 2007; 38, 369–380. https://doi.org/10.1590/S1517-83822007000200034
Abdukhalilova, G., Kaftyreva, L., Wagenaar, J. A., Tangyarikov, B., Bektimirov, A., Akhmedov, I., Khodjaev, Z., Kruse, H., and Organization, W. H. (2016). Occurrence and antimicrobial resistance of Salmonella and Campylobacter in humans and broiler chicken in Uzbekistan. Public Health Panorama, 2(03), 340–347.
Andersson, D. I. (2003). Persistence of antibiotic resistant bacteria. Current Opinion in Microbiology, 6(5), 452–456. https://doi.org/10.1016/j.mib.2003.09.001
Andino, A., and Hanning, I. (2015). Salmonella enterica: Survival, Colonization, and Virulence Differences among Serovars. The Scientific World Journal, 2015(1), 520179. https://doi.org/10.1155/2015/520179
Arikan, O. A., Sikora, L. J., Mulbry, W., Khan, S. U., and Foster, G. D. (2007). Composting rapidly reduces levels of extractable oxytetracycline in manure from therapeutically treated beef calves. Bioresource Technology, 98(1), 169–176. https://doi.org/10.1016/j.biortech.2005.10.041
Asaduzzaman, M., Salma, U., Ali, H. S., Hamid, M. A., and Miah, A. G. (2017). Problems and prospects of turkey (Meleagris gallopavo) production in Bangladesh. Research in Agriculture Livestock and Fisheries, 4(2), 77–90. https://doi.org/10.3329/ralf.v4i2.33719
Aury, K., Chemaly, M., Petetin, I., Rouxel, S., Picherot, M., Michel, V., and Le Bouquin, S. (2010). Prevalence and risk factors for Salmonella enterica subsp. Enterica contamination in French breeding and fattening turkey flocks at the end of the rearing period. Preventive Veterinary Medicine, 94(1–2), 84–93. https://doi.org/10.1016/j.prevetmed.2009.12.002
Bai, J., Li, J., Chen, Z., Bai, X., Yang, Z., Wang, Z., and Yang, Y. (2023). Antibacterial activity and mechanism of clove essential oil against foodborne pathogens. LWT, 173, 114249. https://doi.org/10.1016/j.lwt.2022.114249
Balouiri, M., Sadiki, M., and Ibnsouda, S. K. (2016). Methods for in vitro evaluating antimicrobial activity: A review. Journal of Pharmaceutical Analysis, 6(2), 71–79. https://doi.org/10.1016/j.jpha.2015.11.005
Baptista-Silva, S., Borges, S., Ramos, O. L., Pintado, M., and Sarmento, B. (2020). The progress of essential oils as potential therapeutic agents: A review. Journal of Essential Oil Research, 32(4), 279–295. https://doi.org/10.1080/10412905.2020.1746698
Barakat, D., El-Far, A., Sadek, K., Mahrous, U., Ellakany, H., and Abdel-Latif, M. (2016). Anise (Pimpinella anisum) enhances the growth performance, immunity and antioxidant activities in broilers. International Journal of Pharmaceutical Sciences Review and Research, 37(24), 134–140.
Barham, A. R., Barham, B. L., Johnson, A. K., Allen, D. M., Blanton, J. R., and Miller, M. F. (2002). Effects of the Transportation of Beef Cattle from the Feedyard to the Packing Plant on Prevalence Levels of Escherichia coli O157 and Salmonella spp. Journal of Food Protection, 65(2), 280–283. https://doi.org/10.4315/0362-028X-65.2.280
Beuchat, L. R. (2007). Control of foodborne pathogens and spoilage microorganisms by naturally occurring antimicrobials. In Microbial food contamination (pp. 341–368). CRC Press. https://www.taylorfrancis.com/chapters/edit/10.1201/9781420008470-19/control-foodborne-pathogens-spoilage-microorganisms-naturally-occurring-antimicrobials-larry-beuchat
Bhatwalkar, S. B., Mondal, R., Krishna, S. B. N., Adam, J. K., Govender, P., and Anupam, R. (2021). Antibacterial Properties of Organosulfur Compounds of Garlic (Allium sativum). Frontiers in Microbiology, 12. https://doi.org/10.3389/fmicb.2021.613077
Cai, L. and Christine D. Wu*. (1996). Compounds from Syzygium aromaticum Possessing Growth Inhibitory Activity Against Oral Pathogens. Journal of Natural Products, 59(10), 987–990. https://doi.org/10.1021/np960451q
Chen, C., Liu, C.-H., Cai, J., Zhang, W., Qi, W.-L., Wang, Z., Liu, Z.-B., and Yang, Y. (2018). Broad-spectrum antimicrobial activity, chemical composition and mechanism of action of garlic (Allium sativum) extracts. Food Control, 86, 117–125. https://doi.org/10.1016/j.foodcont.2017.11.015
Circella, E., Pennelli, D., Tagliabue, S., Ceruti, R., Giovanardi, D., & Camarda, A. Virulence – associated genes in Avian Pathogenic Escherichia coli of turkey. Italian Journal of Animal Science, 2009; 8(4), 775–779. https://doi.org/10.4081/ijas.2009.775
Cressy, H. K., Jerrett, A. R., Osborne, C. M., and Bremer, P. J. (2003). A novel method for the reduction of numbers of Listeria monocytogenes cells by freezing in combination with an essential oil in bacteriological media. Journal of Food Protection, 66(3), 390–395. https://doi.org/10.4315/0362-028X-66.3.390
De Oliveira, A. L., Newman, D. M., Sato, Y., Noel, A., Rauk, B., Nolan, L. K., Barbieri, N. L., and Logue, C. M. (2020). Characterization of avian pathogenic escherichia coli (APEC) associated with Turkey cellulitis in Iowa. Frontiers in Veterinary Science, 7, 380. https://doi.org/10.3389/fvets.2020.00380
El-Demerdash, F. M., El-Sayed, R. A., and Abdel-Daim, M. M. (2021). Hepatoprotective potential of Rosmarinus officinalis essential oil against hexavalent chromium-induced hematotoxicity, biochemical, histological, and immunohistochemical changes in male rats. Environmental Science and Pollution Research, 28(14), 17445–17456. https://doi.org/10.1007/s11356-020-12126-8
Fluckey, W. M., Loneragan, G. H., Warner, R., and Brashears, M. M. (2007). Antimicrobial Drug Resistance of Salmonella and Escherichia coli Isolates from Cattle Feces, Hides, and Carcasses. Journal of Food Protection, 70(3), 551–556. https://doi.org/10.4315/0362-028X-70.3.551
Friedman, M., Henika, P. R., and Mandrell, R. E. (2002). Bactericidal activities of plant essential oils and some of their isolated constituents against Campylobacter jejuni, Escherichia coli, Listeria monocytogenes, and Salmonella enterica. Journal of Food Protection, 65(10), 1545–1560. https://doi.org/10.4315/0362-028X-65.10.1545
Fu, Y., Zu, Y., Chen, L., Efferth, T., Liang, H., Liu, Z., and Liu, W. (2007). Investigation of Antibacterial Activity of Rosemary Essential Oil against Propionibacterium acnes with Atomic Force Microscopy. Planta Medica, 73, 1275–1280. https://doi.org/10.1055/s-2007-981614
Guabiraba, R., & Schouler, C.: Avian colibacillosis: Still many black holes. FEMS Microbiology Letters, 2015; 362(15), fnv118.
Humphries, R. M., Kircher, S., Ferrell, A., Krause, K. M., Malherbe, R., Hsiung, A., and Burnham, C.-A. D. (2018). The Continued Value of Disk Diffusion for Assessing Antimicrobial Susceptibility in Clinical Laboratories: Report from the Clinical and Laboratory Standards Institute Methods Development and Standardization Working Group. Journal of Clinical Microbiology, 56(8), e00437-18. https://doi.org/10.1128/JCM.00437-18
Jackson, M. A., and Esimone, C. (2010). Evaluation of in vitro antimicrobial effect of combinations of erythromycin and Euphorbia hirta leaf extract against Staphylococcus aureus. Pharm Biotechnol, 2, 22–24.
Kalemba, D., and Kunicka, A. (2003). Antibacterial and antifungal properties of essential oils. Current Medicinal Chemistry, 10(10), 813–829. https://doi.org/10.2174/0929867033457719
Kar, J., Barman, T. R., Sen, A., and Nath, S. K. (2017). Isolation and identification of Escherichia coli and Salmonella sp. From apparently healthy Turkey. Int. J. Adv. Res. Biol. Sci, 4(6), 72–78. https://doi.org/10.22192/ijarbs.2017.04.11.001
Karlowsky, J. A., Jones, M. E., Thornsberry, C., Friedland, I. R., and Sahm, D. F. (2003). Trends in Antimicrobial Susceptibilities among Enterobacteriaceae Isolated from Hospitalized Patients in the United States from 1998 to 2001. Antimicrobial Agents and Chemotherapy, 47(5), 1672–1680. https://doi.org/10.1128/AAC.47.5.1672-1680.2003
Kilonzo-Nthenge, A., Rotich, E., and Nahashon, S. N. (2013). Evaluation of drug-resistant Enterobacteriaceae in retail poultry and beef. Poultry Science, 92(4), 1098–1107. https://doi.org/10.3382/ps.2012-02581
Lewis, W. H., and Elvin-Lewis, M. P. (2003). Medical botany: Plants affecting human health. John Wiley and Sons. https://books.google.com/books?hl=ar andlr= andid=ipQmSriMF9sC andoi=fnd andpg=PR9 anddq=Lewis,+W.+and+M.+Elvin-Lewis.+2003.+Medical+Botany:+Plants+Affecting+Human+Health.+2nd+edition.+New+York,+Wiley. andots=4r46j3CzBA andsig=NJTU2M7TQhf_aAYRl3eUX5Ack3k
Magaldi, S., Mata-Essayag, S., De Capriles, C. H., Pérez, C., Colella, M. T., Olaizola, C., and Ontiveros, Y. (2004). Well diffusion for antifungal susceptibility testing. International Journal of Infectious Diseases, 8(1), 39–45. https://doi.org/10.1016/j.ijid.2003.03.002
Mainali, C., Gensler, G., Mcfall, M., King, R., Irwin, R., and Senthilselvan, A. (2009). Evaluation of Associations between Feed Withdrawal and Other Management Factors with Salmonella Contamination of Broiler Chickens at Slaughter in Alberta. Journal of Food Protection, 72(10), 2202–2207. https://doi.org/10.4315/0362-028X-72.10.2202
Rikihisa, Y., Zhang, C., and Christensen, B.M. :Molecular Characterization of Aegyptianella pullorum ( Rickettsiales , Anaplasmataceae ). Journal of Clinical Microbiology, 2003;41(11), 5294–5297. https://doi.org/10.1128/JCM.41.11.5294-5297.2003
Trampel, D. W., and Griffth, R. W. (1997). Efficacy of aluminum hydroxide-adjuvanted Escherichia coli bacterin in turkey poults. Avian Diseases, 263–268. https://doi.org/10.2307/1592176
Vaillancourt, J. P., & Barnes, H. J. (2008). Coliform cellulitis (inflammatory process). I n YM Saif, AM Fadly, JR Glisson, LR McDougald, LK Nolan, & DE Swayn e (Eds.), Diseases of poultry(pp. 732–738). Iowa: Blackwell Publishing.
Valgas, C., Souza, S. M. de, Smânia, E. F., and Smânia Jr, A. (2007). Screening methods to determine antibacterial activity of natural products. Brazilian Journal of Microbiology, 38, 369–380. https://doi.org/10.1590/S1517-83822007000200034
Walker, R.I. :An assessment of enterotoxigenic Escherichia coli and Shigella vaccine candidates for infants and children. Vaccine, 2015;33(8), 954–965. https://doi.org/10.1016/j.vaccine.2014.11.049
Walker, R.I., and Clifford, A. :Recommendations regarding the development of combined enterotoxigenic Eschericha coli and Shigella vaccines for infants. Vaccine, 2015;33(8), 946–953. https://doi.org/10.1016/j.vaccine.2014.11.048
Wang, C., Wang, Z., Wang, G., Lau, J.Y.N., Zhang, K., and Li, W. COVID-19 in early 2021: status and looking forward. Signal Transduction and Targeted Therapy, 2021; 6(1), 1–14. https://doi.org/10.1038/s41392-021-00527-1
Wang, S., Peng, Q., Jia, H.M., Zeng, X.F., Zhu, J.L., Hou, C.L., Liu, X.T., Yang, F.J., Qiao, S.Y. Prevention of Escherichia coli infection in broiler chickens with Lactobacillus plantarum B1. Poultry Sci., 2017; 96, 2576–2586. https://doi.org/10.3382/ps/pex061
Wang, S., Zeng, X., Yang, Q., Qiao, S.:.Antimicrobial Peptides as Potential Alternatives to Antibiotics in Food Animal Industry. Int. J. Mol. Sci. 2016; 17, 603. https://doi.org/10.3390/ijms17050603
Yeh, J.C., Chen, C.L., Chiou, C.S., Lo, D.Y., Cheng, J.C., and Kuo, H.C Comparison of prevalence, phenotype, and antimicrobial resistance of Salmonella serovars isolated from turkeys in Taiwan. Poultry Science, 2018; 97(1), 279–288. https://doi.org/10.3382/ps/pex293
Younis, G., Awad, A., El-Gamal, A., and Hosni, R. Virulence properties and antimicrobial susceptibility profiles of Klebsiella species recovered from clinically diseased broiler chicken. Adv. Anim. Vet. Sci, 2016; 4(10), 536–542. https://doi.org/10.14737/journal.aavs/2016/4.10.536.542
Zhang, W., and Sack, D.A. :Progress and hurdles in the development of vaccines against enterotoxigenic Escherichia coli in humans. Expert Review of Vaccines, 2012;11(6), 677–694. https://doi.org/10.1586/erv.12.37