Special Issue:

Emerging and Re-emerging Animal Health Challenges in Low and Middle-Income Countries

Effects of Newcastle Disease Infection on the mRNA Expression of Inflammatory Biomarkers in Naturally Infected Chicks

Hakeem Jawad Kadhim1, Abbas Kamil Shlaga1*, Safaa Hussein Ali2

1Department of Microbiology, College of Veterinary medicine and Surgery, Shatrah University, Shatrah, Thi-Qar, Iraq; 2Department of Physiology, College of Veterinary Medicine and Surgery, Shatrah University, Shatrah, Thi-Qar, Iraq.

Abstract | The Newcastle disease (ND) has a profound impact on the poultry health, causing substantial economic losses due to high mortality. Consequently, despite the implementation of intensive vaccination programs, many flocks still experience clinical signs of ND virus infection. In this study, we aimed to detect the ND virus and characterize the associated inflammatory response in naturally infected broilers. Utilizing RT-PCR, the expression of the matrix (M) gene of NDV and inflammatory biomarkers, including C-reactive protein (CRP), interleukin 6 (IL-6), interleukin-1 beta (IL-1β), and gamma interferon (IFN-γ) genes were analyzed. There were ninety birds used in the study; sixty samples were collected from infected flocks and assigned as an infected group, while thirty samples were gathered from healthy (uninfected) flocks and considered as a control group. Samples, including blood, liver, and tracheal swabs, were collected from 3 to 5 weeks old broilers. The infected birds showed various signs and postmortem lesions, such as mottled spleen and hemorrhages in the proventriculus and cecum. The NDV infection was confirmed using the NDV rapid test, which showed positive results in 52 out of 60 suspected samples (86.66%). Furthermore, RT-PCR data revealed that only 27 (51.92%) out of 52 samples were positive for the M gene. Thereafter, the mean antibody levels of ND-infected birds were significantly lower than those of uninfected birds. In contrast, inflammatory biomarkers’ gene expression exhibited an increase in their mRNA levels, indicating that the birds were infected with a viral infection and that there is inflammation in the body. In conclusion, the M gene could be used as a marker for identifying NDV in infected birds. Similarly, the NDV infection led to a decrease in antibody titers, which is associated with an increase in the gene expression of inflammatory biomarkers in infected birds. Therefore, serological tests as well as the molecular approach should always be considered in endemic regions.

 

Keywords | Matrix gene, IFN-γ, Interleukins, RT-PCR


Received | July 18, 2024; Accepted | September 13, 2024; Published | November 20, 2024

*Correspondence | Abbas Kamil Shlaga, Department of Microbiology, College of Veterinary medicine and Surgery, Shatrah University, Shatrah, Thi-Qar, Iraq; Email: [email protected]

Citation | Kadhim HJ, Shlaga AK, Ali SH (2024). Effects of Newcastle disease infection on the mRNA expression of inflammatory biomarkers in naturally infected chicks. J. Anim. Health Prod. 12(s1): 120-126.

DOI | http://dx.doi.org/10.17582/journal.jahp/2024/12.s1.120.126

ISSN (Online) | 2308-2801

 

BY%20CC.png 

Copyright: 2024 by the authors. Licensee ResearchersLinks Ltd, England, UK.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).



Introduction

Newcastle disease (ND) is one of the worst illnesses affecting chickens worldwide (Shabbir et al., 2013). Although depression, neurological symptoms, or diarrhea may be the most common clinical form, it is a global issue that typically manifests as an acute respiratory illness. Furthermore, the high rates of mortality in the ND infection limit the growth of poultry production. Turkeys, chickens, and other poultry species are susceptible to ND, which can be categorized based on pathogenicity into velognic, mesogmic, or lentogenic. The severity of the ND infection and clinical signs are dependent on several factors such as the virus strain, the host species, host ages, coinfection, stress, and immunity (Waheed et al., 2013).

The cause of ND is avain paramyxovirus-1 (APMV-1), genus Avulavirus. family Paramyxoviridae, and order mononegavirales (Briand et al., 2012). NDV is an enveloped virus with a negative polarity, non-segmented, single-stranded RNA. NDV is an enveloped virus with a negative polarity, non-segmented, single-stranded RNA, which carries six proteins: RNA polymerase (L), haemaggluatination neuraminidase (HN), fusion protein (F), matrix protein (M), phosphoprotein (P) and nucleoprotein (NP) (Kolakofsky et al., 2005). NDV infects the host cells of targeted species in different ways, starting with virus entry via haemaggluatination neuraminidase (HN) and fusion (F) glycoproteins. The HN interacts with the host cell surface via cell receptors that are composed of sialic acid. On the other hand, viral entry is attributed to the F protein. Following fusion, viral nucleic acid (nucleocaspid) enters the host cell cytoplasm, where transcription and translation phases start (Mao et al., 2022).

Furthermore, cytokines act on target cells by attaching to specific receptors and can enhance or inhibit cell functions. Interleukin, tumor necrosis factor, and chemokines are types of cytokines classified based on their function and synthesis location. On the other hand, there is a lot of crossovers across the various classifications (Mitra and Leonard, 2018). Gamma interferon (IFN-γ), interleukin 6 (IL-6), and interleukin 1 beta (IL-1β) are multifunctional cytokines that have essential roles in acute-phase responses, immunological control, and haematopoesis, and are released by many cells. Serum amyloid A and C reactive protein (CRP) are examples of acute-phase proteins that are produced as part of an inflammatory response to infection or other stressors in animals (Aliyu et al., 2022).

Despite the development in the laboratory diagnostic tools, diagnosis still relies mainly on the field examination and serological tests. Therefore, we hypothesized that besides serological tests such as HI and NDV antigen rapid tests, RT-PCR would be an essential molecular method to identify ND infection in each province. To conduct our hypothesis, serological tests such as antigen rapid and HI tests will be used to detect a possible NDV infection; then, matrix (M) gene expression will be measured by RT-PCR as an indicator of NDV infection. Further, antibody titers in the serum will be measured for the infected and control birds. Similarly, the inflammatory response will be evaluated by studying the mRNA levels of inflammatory biomarkers, which are CRP, IL-6, and IL-1β, as well as FN-γ.

Materials and Methods

Based on the case history, clinical signs, and postmortem symptoms, samples were collected from 3-5-week-old broilers. The number of birds was 30 samples (control) and 60 samples (suspected cases). The initial diagnosis was performed using the NDV antigen rapid kit (Bionote, Korea). Samples of blood, liver, and tracheal swabs were collected and snap frozen rapidly, except for the blood samples. The blood sample was divided into two parts; the first part was assigned for measuring antibody titer in the infected and control birds using HI test (Reda and Jasim 2022), and the second part (200 μl) was mixed with Trizol for RNA extraction using the Trizol-Chloroform protocol (Kadhim et al., 2020).

For the positive samples detected by the NDV antigen Rapid test, viral Gene-spinTM Viral DNA/RNA extraction Kit was used to extract viral RNA from tracheal swabs for matrix (M) gene expression to confirm the ND infection. While total RNA was extracted from blood and liver samples for inflammatory biomarkers’ expression using Trizol-Chloroform, and RNeasy mini kit (Qiagen) was utilized to purify RNA (Kadhim et al., 2019). For viral and total RNA, Dnase1 was used to remove genomic DNA. Then, concentration of RNA was measured using a nanodrop spectrophotometry. Thereafter, Superscript®III (Invitrogen) was used for cDNA formation as described in our previous publications (Kadhim et al., 2021, 2022). In RT-PCR, samples were achieved using Power SYBR green master mix in 30 µl and ran in duplicate for 40 cycles. Inflammatory biomarkers, CRP, IL-6, IL-1β, and IFN-γ, were measured, and glyceraldehyde3-phophate dehydrogenase (GAPDH), was a housekeeping gene. The primer details were described (Table 1). Fold changes in mRNA expression were calculated for inflammatory biomarkers after normalization with a housekeeping gene using the 2−ΔΔCt equation (Schmittgen and Livak, 2008).

Statistical analysis

JMP® 18.0 was used to analyze gene expression and antibody titer data. A student t-test and Tukey’s HSD test were calculated to evaluate the significant effects of infection and compared with control. Fold changes in the mRNA levels were calculated and presented as mean ± SEM, with p< 0.05 considered significant statistically.

Results and Discussion

Clinical signs and postmortem symptoms

Based on field observation, the infected birds showed a variety of clinical signs, such as respiratory, nervous, and digestive signs. The main clinical signs were decreased appetite, coughing, watery eyes, nasal discharge, greenish

 

Table 1: Primer details used in the current experiment.

Target gene Sequence (5’-3’) Amplicon size Reference Accession number
M gene-NDV

F: ATCTATCTGTTCGGGCTCAGTC

R: GGCTGTCCCACTGCTAGAGA

107 (Reda and Jasim, 2022) MZ306221
CRP

F: ATACGTCGCCTTCCACATCC

R: CGTTGCCCACCACGTA

149

(Tang et al., 2019)

NM_001313720.3
IL-6

F: TGGTGATAAATCCCGATGAAG

R: GGCACTGAAACTCCTGGTCT

191

(Zghoul et al., 2019)

NM_204628.2

IL-1β

F: GCATCAAGGGCTACAAGCTC

R: CAGGCGGTAGAAGATGAAGC

131 XM_046931582.1

IFN-γ

F: AGCTGACGGTGGACCTATTATTGT

R: CGGCTTTGCGCTGGATTC

260

(Wu et al., 2015)

NM_205149.2
Gapdh

F: GACGTGCAGCAGGAACACTA

R: CTTGGACTTTGCCAGAGAGG

128

(Kadhim et al., 2019)

NM_204305


watery diarrhea, and nervous manifestations, which were head and neck twist, legs and/or wings paralysis, or whole-body paralysis (Figure 1A, B). During postmortem examination of birds with clinical signs, spots of necrosis were observed in the gizzard, proventriculus, and intestine (Figure 1C, D). Furthermore, hemorrhage spots in the proventriculus were widely found. Also, mottled spleen and an enlarged liver were observed (Figure 1E, F). In the early dead birds, several other symptoms were observed, such as dehydrated congested muscles, dehydrated carcass, periventricular gland-tip hemorrhages, congested and hemorrhage of the intestine, and catarrhal tracheitis.

NDV rapid test

The test was performed in the fields for suspected cases (with clinical signs). The results of the test showed that 52 (86.65%) samples out of 60 were positive, as evidenced by the two lines appearing on the device.

Haemaggluatination inhibition (HI) test

Utilizing the HI test to measure AB titers in the infected and control birds, the AB titers decreased significantly in the infected birds compared with (Figure 2, p <0.001; T-test = 11.32). The mean AB titer in the control birds was (532.15±32.12), while it was (34.27±2.32) in the infected birds.

Molecular diagnosis for NDV

Utilizing reverse transcription-PCR (Figure 3), the matrix (M) gene, which is a universal protein for NDV detection, was successfully amplified and detected in 27 (51.92%) samples out of 52; however, the ct values vary by sample from 18 to 33 cycles.

Gene expression data of inflammatory biomarkers

Several biomarkers were tested to observe the inflammatory response induced by NDV in infected birds compared with healthy birds (Figure 4). Specifically, CRP gene expression showed a significant increase in birds after two days (48 h) of infection, documented by about twofold changes (p<0.01). In contrast, IL6, Il1β, and IFN-γ mRNA expression increased significantly after 24 hours of infection and showed 4-fold changes in mRNA expression compared with their expression in non-infected birds. Remarkably, the Infγ mRNA expression showed more than a six-fold increase (p < 0.001).

 

The researchers utilized RT-PCR to detect NDV and identify changes in mRNA expression of inflammatory biomarkers in infected flocks. The birds exhibited a variety of signs, including respiratory, digestive, and nervous (Figure 1). In this context, Getabalew et al. (2019) reported that the respiratory signs may be due to an ND infection in the bronchi or pneumonia. Furthermore, the greenish, watery stool can be a sign of digestive complications such as malabsorption syndrome, dehydration, and malnutrition (Bhutia et al., 2017). During ND infection, when virulent NDV strains infect the central nervous system (CNS), viruses can replicate in neurons, causing encephalitis and nervous signs (Cattoli et al., 2011; Ecco et al., 2011). Moreover, postmortem examination revealed typical gross lesions such as mottled spleen, congested and enlarged liver, periventricular gland-tip hemorrhages, and catarrhal tracheitis (Figure 1). Other researchers reported the same gross lesions (Sen et al., 2017; Awad et al., 2020). Notably, utilizing NDV rapid test exhibited that not all cases with clinical signs were positive (86.65%). As we know, the principle of the NDV antigen rapid test kit depends on antibody-antigen reaction. Therefore, the possible explanations for that could account for the test sensitivity, antibody-antigen compatibility, and/or other viral infections. Similarly, the antibody titer was decreased significantly in the infected birds (Figure 2).

To detect ND infection in chicks suffered from above clinical signs and P.M. symptoms, a molecular approach, PCR, was applied, which is the most specific and efficient approach for detecting NDV is the RT-PCR (Selim et al., 2022). RT-PCR was utilized for positive samples detected by the rapid test. The matrix (M) gene was amplified successfully by PCR (Figure 3). Similarly, Alsahami et al. (2018) have identified the NDV in the suspected cases by RT-PCR. In this study, the M gene, which is a standard gene used for detection of NDV infection with high sensitivity, was observed in about 27 samples (51.92%) out of 52 positive samples detected by the NDV rapid test. The possible explanation is due to the low concentration of viral nucleic acid in the tested sample, and this could be supported by the Ct values recorded in the results.

In the current study, the ct values of M gene differ from sample to sample, range from 18 to 33, and appear to be dependent on the concentration of NDV in the samples, reflecting the intensity of the infection. The ct value variations indicate that the concentrations of viruses in the sample are not the same among samples. Similarly, previous studies showed that 26 out of 34 fields were positive when tested by RT-PCR (Hasan et al., 2010). Utilizing RT-PCR for lung samples, the NDV was detected in 17 out of 63 samples (Worku et al., 2022). Unlike the findings in this study, Ahmed and Odisho (2018) found that 100% of the analyzed samples tested positive using RT-PCR. This could be attributed to the study’s primers used or local NDV strains.

In reviewing the literature, a few papers addressed the mRNA expression of inflammatory biomarkers or cytokines in NDV-infected chickens. Therefore, RT-qPCR was utilized to observe gene expression changes of several inflammatory biomarkers in NDV-infected birds (Figure 4). Specifically, the mRNA levels of CRP increased significantly in the liver tissue after two days (48 h) of infection, resulting in about twofold changes. A high CRP level indicated that there is inflammation somewhere in the bodies of birds, and NDV infection seems to be responsible for that rise. Further, CRP has been widely used as an indicator for viral infections such as COVID-19 and it demined disease mortality (Zheng et al., 2020).

The second biomarker measured in this study was interferon gamma (IFN-γ). It is synthesized and secreted by T lymphocytes and natural killer cells and mediates the T-helper type I immune response (Fensterl and Sen, 2009). Furthermore, IFN-γ has antiviral roles in birds, including avian flu, ND, and Marek’s disease (Swant et al., 2011; Susta et al., 2013). Researchers showed that IFN-γ is able to remove intracellular pathogens, hinder viral replication, activate major histocompatibility complexes I and II, and aid in the processing and presentation of antigens (Yeh et al., 1999; Schultz and Chisari, 1999; Kaiser, 2010). Remarkably, IFN-γ mRNA increased in the infected birds compared with controls, Thus, the possible increase of IFN-γ in the current study is conclusive evidence of the immune response to viral infection with NDV.

The study found that IL-1β mRNA levels increased significantly in the NDV-infected birds compared with controls. IL-1β is a key mediator in the inflammatory reaction during viral infections, resulting in the release of IL-6, which is a molecule that is involved in intercellular and vascular cell adhesion and facilitates lymphocyte activation and leukocytes’ infiltration (Peiro et al., 2017). Furthermore, IL-1β can reduce the proliferation of the virus and repair tissue damage, but a high amount of it worsens inflammation and increases lethality rates. The elevation of IL-Iβ can be observed not only in NDV infections but also in other viral infections such as avian flu and infectious bronchitis, as previously documented in other studies (Wang et al., 2016; Thomas et al., 2009; Thi and Hong, 2017; Amarasinghe et al., 2018). Notably, IL-Iβ reduction was linked to the decreasing severity of pneumonia in H1N1 infection (Kim et al., 2015).

The last biomarker tested in the infected samples was interlukin-6 (IL-6) that is produced in the body during inflammation. The study found high IL-6 mRNA expression in the infected birds compared with the control. IL-6 is an immune protein and pyrogen responsible for fever in infectious and noninfectious diseases. Furthermore, Queiroz et al. (2022) reported that IL-6 is essential for corona virus infection in human, including disease duration and severity. It is synthesized by several types of cells during inflammation, including endothelial cells (Chi et al., 2001), immune cells (Tanaka et al., 2014) and fat cells (Fain, 2010). IL-6 is essential for adaptive immunity development because it helps the differentiation of naïve CD4+ T cells (Tanaka et al., 2014). Therefore, the high temperature resulted from viral infections and severe inflammation that may occur due to the same infection with ND. It is likely that the increase is the result of a high immune response and the production of more IL-6. The findings of this study are consistent with other studies that addressed proinflammatory cytokine profiling and found that NDV predominantly increased the production of interleukin 6 (IL-6) in most cells (Chhabra et al., 2018).

Conclusions and Recommendations

ND is a devastating viral disease that causes significant economic losses in the research region. The experiment addressed gene expression to observe changes in the mRNA levels of several inflammatory biomarkers. Furthermore, data showed an increase in all the inflammatory biomarker mRNA levels in infected birds compared with controls, and a decrease of the AB titers in the infected birds was found. Moreover, utilizing the molecular approach, PCR, appears to crucial to detect NDV in the samples, and M gene is reliable gene for ND infection.

Acknowledgments

We would like to thank College of Vet. Medicine and Surgery/ Shatrah University for their help with animal husbandry during animal experimentation. This manuscript is a part of Abbas master thesis.

Novelty Statement

The study investigated the changes in the genetic material of Newcastle disease virus circulated in Thi-Qar Province to observe outbreak causes. The study found a mismatch between the virus strain and the vaccine that used to prevent the ND infection in broiler flocks. Furthermore, the ND infection reduce the titer of the antibodies. In contrast, the mRNA expression of inflammatory biomarkers was increased in the infected birds. Therefore, the molecular approach, PCR, should be used periodically during the outbreaks and in the epidemic regions.

Author contributions

Authors contributed equally to perform the Manuscript.

Funding

The research received no particular fund.

Data availability

All data are included within the manuscript.

Conflict of interest

The authors have declared no conflict of interest.

References

Ahmed AI, Odisho SM (2018). Isolation identification and pathotyping of Newcastle disease viruses form naturally infected chickens In Iraqi Kurdistan region. Iraqi J. Agric. Sci., 49(1): 132-141. https://doi.org/10.36103/ijas.v49i1.216

Aliyu M, Zohora FT, Anka AU, Ali K, Maleknia S, Saffarioun M, Azizi G (2022). Interleukin-6 cytokine: An overview of the immune regulation, immune dysregulation, and therapeutic approach. Int. Immunopharmacol., 111: 109130. https://doi.org/10.1016/j.intimp.2022.109130

Alsahami AA, Ideris A, Omar A, Ramanoon SZ, Sadiq MB (2018). Isolation, identification and molecular characterization of Newcastle disease viruses in vaccinated chickens from commercial farms in the Sultanate of Oman. Int. J. Vet. Sci. Med., 6(2): 248-252. https://doi.org/10.1016/j.ijvsm.2018.08.007

Al-Zghoul MB, Saleh KM, Ababneh MMK (2019). Effects of pre-hatch thermal manipulation and post-hatch acute heat stress on the mRNA expression of interleukin-6 and genes involved in its induction pathways in 2 broiler chicken breeds. Poult. Sci., 98(4): 1805–1819. https://doi.org/10.3382/ps/pey499

Amarasinghe A, Abdul-Cader MS, Almatrouk Z, Van der Meer F, Cork SC, Gomis S, Abdul-Careem MF (2018). Induction of innate host responses characterized by production of interleukin (IL)-1β and recruitment of macrophages to the respiratory tract of chickens following infection with infectious bronchitis virus (IBV). Vet. Microbiol., 215: 1–10. https://doi.org/10.1016/j.vetmic.2018.01.001

Awad M, Mosad S, El-Kenawy A (2020). Molecular differentiation between velogenic isolates and lentogenic LaSota strain of Newcastle disease virus. Mansoura Vet. Med. J., 21(4): 193-198. https://doi.org/10.21608/mvmj.2020.146340

Bhutia LD, Rajkhowa TK, Ravindran R, Arya RS, Roychoudhury P, Mandakini RK, Singh YD (2017). Occurrence of Newcastle disease in poultry population of Mizoram, India. Indian J. Vet. Pathol., 41(2): 151-154. https://doi.org/10.5958/0973-970X.2017.00037.2

Briand FX, Henry A, Massin P, Jestin V (2012). Complete genome sequence of a novel avian paramyxovirus. J. Virol., 86(14): 7710. https://doi.org/10.1128/JVI.00946-12

Cattoli G, Susta L, Terregino C, Brown C (2011). Newcastle disease: A review of field recognition and current methods of laboratory detection. J. Vet. Diagn. Invest., 23(4): 637-656. https://doi.org/10.1177/1040638711407887

Chhabra R, Ball C, Chantrey J, Ganapathy K (2018). Differential innate immune responses induced by classical and variant infectious bronchitis viruses in specific pathogen free chicks. Dev. Comp. Immunol., 87: 16-23. https://doi.org/10.1016/j.dci.2018.04.026

Chi L, Li Y, Stehno-Bittel L, Gao J, Morrison DC, Stechschulte DJ, Dileepan KN (2001). Interleukin-6 production by endothelial cells via stimulation of protease-activated receptors is amplified by endotoxin and tumor necrosis factor-alpha. J. Interf. Cytok. Res. Off. J. Int. Soc. Interf. Cytok. Res., 21(4): 231–240. https://doi.org/10.1089/107999001750169871

Ecco R, Susta L, Afonso CL, Miller PJ, Brown C (2011). Neurological lesions in chickens experimentally infected with virulent Newcastle disease virus isolates. Avian Pathol., 40(2): 145-152. https://doi.org/10.1080/03079457.2010.544289

Fain JN (2010). Release of inflammatory mediators by human adipose tissue is enhanced in obesity and primarily by the nonfat cells: A review. Mediat. Inflamm., 513948. https://doi.org/10.1155/2010/513948

Fensterl V, Sen GC (2009). Interferons and viral infections. Biofactors, 35: 14–20. https://doi.org/10.1002/biof.6

Getabalew M, Alemneh T, Akeberegn D, Getahun D, Zewdie D (2019). Epidemiology, diagnosis and prevention of Newcastle disease in poultry. Am. J. Biomed. Sci. Res., 16: 50-59. https://doi.org/10.34297/AJBSR.2019.03.000632

Hasan AR, Ali MH, Siddique MP, Rahman MM, Islam MA (2010). Clinical and laboratory diagnoses of Newcastle and infectious bursal diseases of chickens. Bangladesh J. Vet. Med., 8(2): 131-140. https://doi.org/10.3329/bjvm.v8i2.11196

Kadhim HJ, Kuenzel WJ (2022). Interaction between the hypothalamo-pituitary-adrenal and thyroid axes during immobilization stress. Front. Physiol., 13: 972171. https://doi.org/10.3389/fphys.2022.972171

Kadhim HJ, Kang SW, Kuenzel WJ (2019). Differential and temporal expression of corticotropin releasing hormone and its receptors in the nucleus of the hippocampal commissure and paraventricular nucleus during the stress response in chickens (Gallus gallus). Brain Res., 1714: 1–7. https://doi.org/10.1016/j.brainres.2019.02.018

Kadhim HJ, Kang SW, Kuenzel WJ (2021). Possible roles of brain derived neurotrophic factor and corticotropin releasing hormone neurons in the nucleus of hippocampal commissure functioning within the avian neuroendocrine regulation of stress. Stress (Amsterdam, Netherlands), 24(5): 590–601. https://doi.org/10.1080/10253890.2021.1929163

Kadhim HJ, Kidd M, Jr, Kang SW, Kuenzel WJ (2020). Differential delayed responses of arginine vasotocin and its receptors in septo-hypothalamic brain structures and anterior pituitary that sustain hypothalamic-pituitary-adrenal (HPA) axis functions during acute stress. Gen. Comp. Endocrinol., 286: 113302. https://doi.org/10.1016/j.ygcen.2019.113302

Kaiser P (2010). Advances in avian immunology prospects for disease control: A review. Avian Pathol., 39(5): 309–324. https://doi.org/10.1080/03079457.2010.508777

Kim KS, Jung H, Shin IK, Choi BR, Kim DH (2015). Induction of interleukin-1 beta (IL-1β) is a critical component of lung inflammation during influenza A (H1N1) virus infection. J. Med. Virol., 87: 1104–1112. https://doi.org/10.1002/jmv.24138

Kolakofsky D, Roux L, Garcin D, Ruigrok RWH (2005). Paramyxovirus mRNA editing, the rule of six and error catastrophe: A hypothesis. J. Gen. Virol., 86(Pt 7): 1869–1877. https://doi.org/10.1099/vir.0.80986-0

Mao Q, Ma S, Schrickel PL, Zhao P, Wang J, Zhang Y, Wang C (2022). Review detection of Newcastle disease virus. Front. Vet. Sci., 9: 936251. https://doi.org/10.3389/fvets.2022.936251

Millar NS, Emmerson PT (1988). Molecular cloning and nucleotide sequencing of Newcastle disease virus. In: (eds. D.J. Alexander) Newcastle disease. Dev. Vet. Virol., Springer, Boston, MA. pp. 8. https://doi.org/10.1007/978-1-4613-1759-3_5

Mitra S, Leonard WJ (2018). Biology of IL‐2 and its therapeutic modulation: Mechanisms and strategies. J. Leukocyte Biol., 103(4): 643-655. https://doi.org/10.1002/JLB.2RI0717-278R

Peiró C, Lorenzo Ó, Carraro R, Sánchez-Ferrer CF (2017). IL-1β inhibition in cardiovascular complications associated to diabetes mellitus. Front. Pharmacol., 8: 363. https://doi.org/10.3389/fphar.2017.00363

Queiroz MAF, Neves PFMD, Lima SS, Lopes JDC, Torres MKDS, Vallinoto IMVC, Bichara CDA, Dos Santos EF, de Brito MTFM, da Silva ALS, Leite MM, da Costa FP, Viana MNDSA, Rodrigues FBB, de Sarges KML, Cantanhede MHD, da Silva R, Bichara CNC, van den Berg AVS, Veríssimo AOL, Vallinoto ACR (2022). Cytokine profiles associated with acute COVID-19 and long COVID-19 syndrome. Front. Cell. Infect. Microbiol., 12: 922422. https://doi.org/10.3389/fcimb.2022.922422

Reda AM, Jasim NS (2022). Molecular diagnosis of Newcastle disease virus by RT-RCR and detection fusion gene using conventional PCR. J. Pharma. Negative Results, 13(3): 983-944. https://doi.org/10.47750/pnr.2022.13.S03.144

Sawant P, Verma P, Subudhi P, Chaturvedi U, Singh M, Kumar R, Tiwari A (2011). Immunomodulation of bivalent Newcastle disease DNA vaccine induced immune response by co-delivery of chicken IFN-γ and IL-4 genes. Vet. Immunol. Immunopathol., 144: 36–44. https://doi.org/10.1016/j.vetimm.2011.07.006

Schmittgen TD, Livak KJ (2008). Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc., 3(6): 1101–1108. https://doi.org/10.1038/nprot.2008.73

Schultz U, Chisari FV (1999). Recombinant duck interferon gamma inhibits duck hepatitis B virus replication in primary hepatocytes. J. Virol., 73(4): 3162–3168. https://doi.org/10.1128/JVI.73.4.3162-3168.1999

Selim K, Adel A, Eid S, Shahein M (2022). Development of real time reverse transcription loop-mediated isothermal amplification assay for rapid detection of genotype VII of Newcastle disease viruses. Br. Poult. Sci., 63(6): 864–870. https://doi.org/10.1080/00071668.2022.2094219

Sen A, Torab A, Salam SMA, Halder B, Alauddin MD (2017). Comparative study on newcastle disease and infectious bursal disease in chicken submitted to Upazilla Veterinary Hospital, Bogra Sadar. Bangladesh J. Vet. Sci. Technol., 8(2). https://doi.org/10.4172/2157-7579.1000455

Shabbir MZ, Zohari S, Yaqub T, Nazir J, Shabbir MA, Mukhtar N, Shafee M, Sajid M, Anees M, Abbas M, Khan MT, Ali AA, Ghafoor A, Ahad A, Channa AA, Anjum AA, Hussain N, Ahmad A, Goraya MU, Iqbal Z, Munir M (2013). Genetic diversity of Newcastle disease virus in Pakistan: A countrywide perspective. Virol. J., 10: 170. https://doi.org/10.1186/1743-422X-10-170

Susta L, Cornax I, Diel DG, Garcia SC, Miller PJ, Liu X, Hu S, Brown CC, Afonso CL (2013). Expression of interferon gamma by a highly virulent strain of Newcastle disease virus decreases its pathogenicity in chickens. Microb. Pathogen., 61-62: 73–83. https://doi.org/10.1016/j.micpath.2013.05.009

Tanaka T, Narazaki M, Kishimoto T (2014). IL-6 in inflammation, immunity, and disease. Cold Spring Harbor Persp. Biol., 6(10): a016295. https://doi.org/10.1101/cshperspect.a016295

Tang H, Finn RD, Thomas PD (2019). Tree Grafter: phylogenetic tree-based annotation of proteins with Gene Ontology terms and other annotations. Bioinformatics (Oxford, England), 35(3): 518–520. https://doi.org/10.1093/bioinformatics/bty625

Thi HTH, Hong S (2017). Inflammasome as a therapeutic target for cancer prevention and treatment. J. Cancer Prevent., 22(2): 62–73. https://doi.org/10.15430/JCP.2017.22.2.62

Thomas PG, Dash P, Aldridge JR Jr, Ellebedy AH, Reynolds C, Funk AJ, Martin WJ, Lamkanfi M, Webby RJ, Boyd KL, Doherty PC, Kanneganti TD (2009). The intracellular sensor NLRP3 mediates key innate and healing responses to influenza A virus via the regulation of caspase-1. Immunity, 30: 566–575. https://doi.org/10.1016/j.immuni.2009.02.006

Waheed U, Siddique MI, Arshad M, Ali M, Saeed A (2013). Preparation of Newcastle disease vaccine from VG/GA strain and its evaluation in commercial broiler chicks. Pak. J. Zool., 45: 339-344.

Wang B, Zhu J, Li D, Wang Y, Zhan Y, Tan L, Qiu X, Sun Y, Song C, Meng C, Ying L, Xiang M, Meng G, Ding C (2016). Newcastle disease virus infection induces activation of the NLRP3 inflammasome. Virology, 496: 90–96. https://doi.org/10.1016/j.virol.2016.05.023

Wang Z, Liu H, Xu J, Bao J, Zheng D, Sun C, Wei R, Song C, Chen J (2006). Genotyping of Newcastle disease viruses isolated from 2002 to 2004 in China. Ann. N. Y. Acad. Sci., 1081: 228–239. https://doi.org/10.1196/annals.1373.027

Worku T, Dandecha M, Shegu D, Aliy A, Negessu D (2022). Isolation and molecular detection of Newcastle disease virus from field outbreaks in chickens in central Ethiopia. Vet. Med. (Auckland, N.Z.), 13: 65–73. https://doi.org/10.2147/VMRR.S352727

Wu G, Liu L, Qi Y, Sun Y, Yang N, Xu G, Zhou H, Li X (2015). Splenic gene expression profiling in White Leghorn layer inoculated with the Salmonella enterica serovar Enteritidis. Anim. Genet., 46(6): 617–626. https://doi.org/10.1111/age.12341

Yeh HY, Winslow BJ, Junker DE, Sharma JM (1999). In vitro effects of recombinant chicken interferon-gamma on immune cells. J. Interf. Cytok. Res. Off. J. Int. Soc. Interf. Cytok. Res., 19(6): 687–691. https://doi.org/10.1089/107999099313848

Zheng Z, Peng F, Xu B, Zhao J, Liu H, Peng J, Li Q, Jiang C, Zhou Y, Liu S, Ye C, Zhang P, Xing Y, Guo H, Tang W (2020). Risk factors of critical and mortal COVID-19 cases: A systematic literature review and meta-analysis. J. Infect., 81(2): e16–e25. https://doi.org/10.1016/j.jinf.2020.04.021