Special Issue:
Emerging and Re-emerging Animal Health Challenges in Low and Middle-Income Countries
Investigation of Cryptosporidium Species Infecting Dogs
Suhad I.J. Al-Asady1*, Mohammad H. Al-Hasnawy2
1Department of Public Health, Babil Health Directorate, Ministry of Health, Iraq; 2Department of Parasitology, College of Veterinary Medicine, Al-Qasim Green University,51013 Babylon, Iraq.
Abstract | The percentage of dog breeding has increased recently, however, no epidemiological or molecular data regarding Cryptosporidium species infection in dogs is available in Iraq. Therefore, the current study aimed to detect and identify Cryptosporidium species infecting dogs using microscopy and molecular techniques. For the microscopic examination, feces samples of 100 dogs were examined from September 2023 to March 2024 by the flotation technique based on the modified Ziehl–Neelsen-staining technique. The results showed that the overall percentage of Cryptosporidium infection was 22% (22 out of 100). These results also found that the infected males recorded the highest infection rate compared with infected females, where the percentages were 22.41% (13/58) and 21.42% (9/42), respectively. In addition, the infection rate of infected animals less than one year was higher than those aged more than one year, with percentages of 23.18% (16/69) and 19.35% (6/31), respectively. The findings also demonstrated that the infection rate was high in infected dogs in rural areas 23.33% (14/60), in comparison with those living in urban areas 20% (8/40). Regarding the molecular techniques, two species (C. Canis, and C. parvum) were genetically identified based on the PCR and DNA sequencing techniques using the gene: 60 kDa glycoprotein (gp60) gene sequence. We conclude the first molecular study in Babylon province that detected and identified these two species in dogs. Interestingly, the species of C. parvum is a zoonotic species that can transmit the infection to humans, highlighting its epidemiological importance of Cryptosporidium.
Keywords | Cryptosporidium, Dog, Zoonotic species, Nested PCR, DNA sequencing
Received | June 15, 2024; Accepted | October 01, 2024; Published | December 04, 2024
*Correspondence | Suhad I.J. Al-Asady, Department of Public Health, Babil Health Directorate, Ministry of Health, Iraq; Email: [email protected]
Citation | Al-Asady SIJ, Al-Hasnawy MH (2024). Investigation of Cryptosporidium species infecting dogs. J. Anim. Health Prod. 12(s1): 174-181.
DOI | https://dx.doi.org/10.17582/journal.jahp/2024/12.s1.174.181
ISSN (Online) | 2308-2801
Copyright: 2024 by the authors. Licensee ResearchersLinks Ltd, England, UK.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
INTRODUCTION
Cryptosporidium species is a common protozoan that affects domestic and wild dogs (Taghipour et al., 2020). Animals with symptomatic or asymptomatic cryptosporidiosis poses a risk infection to humans and other animals, where the reinfection is common unless infectious abscesses are eliminated in environment (Nichols, 1992; Khan et al., 2023). Cryptosporidiosis typically manifests in acute to severe diarrhea along with abdominal pain. In immunocompetent individuals, the course of infection is normally self-limiting. Dogs rarely show signs of infection and act as asymptomatic carriers (Thompson et al., 2016). Considering the close contact between companion animals and their owners, the role of dogs as a potential risk factor for the infection with zoonotic pathogens comes to the center of attention (Murnik et al., 2022). Various animal species that serve as reservoirs host parasites harboring C. parvum capable of infecting humans. The extent of the parasite’s danger to public health (Ali and Ali, 2023; Jarad, 2020; Al-Musawi et al., 2022; Alali et al., 2021), Cryptosporidium parasite can be diagnosed in the laboratory through a fecal microscopic examination, various immunological tests, and molecular methods. Research using nested PCR (nPCR) has been shown to be more effective, accurate and useful for diagnosing Cryptosporidium species infections compared to the microscopic examination (Smith, 2007). While there are other methods available to detect Cryptosporidium oocysts in feces, such as microscopic staining and surface antigen detection, these techniques are not enough to identify the species and genotypes due to the identical appearance and antigens of the oocysts (Chalmers and Katzer, 2013; Tamura et al., 2021). Molecular methods like conventional PCR, Nested-PCR, and sequencing identify and characterize the parasite at species and subspecies levels using gp60 genes (Al-Hassan and Al-Safo, 2024; Kadim et al., 2022; Faraj, 2019).
Cryptosporidium species are important on public health and has economic implications in the country due to the risk of the outbreak of the disease and its associated conditions of economic losses. It was mentioned that prevalence of Cryptosporidium oocysts was recorded by some studies in Iraq depending on microscopic and molecular techniques; however, the investigation of this infection in other parts of the country is still incompletely done (Alali et al., 2021). Previous studies performed in Iraq showed the presence of Cryptosporidium species in dog in Baghdad by Faraj (2019), in Karbala Province Iraq by Al-Yasary and Faraj (2021), Mosul city, Iraq by Hadi et al. (2014). However, there is no previous epidemiological or molecular data regarding Cryptosporidium spp. Infection in dogs in Babylon province. Thus, this study aimed to detect and identify Cryptosporidium species in dogs in this region using microscopic and molecular techniques.
METERIALS AND METHODS
Samples collections, period and location of the study
This study was conducted in Babylon province from September, 2023 to March, 2024 using the microscopic and molecular techniques for diagnosing Cryptosporidium species in dogs. For the microscopic examination, fecal samples (approximately 10 g) of 100 dogs were collected in sterile plastic cups labeled with necessary data, such as sex, age, and date. These samples were also collected from different locations (zoos, veterinary clinics, and houses), then transferred with icebox directly to the advance parasitic laboratory.
Fecal samples examination
Each fecal sample was divided into 2 parts: The first part was checked using the Sheather’s sugar flotation technique based on the modified Ziehl–Neelsen-staining technique, where it was examined microscopically under 40 ×, 100x magnifications for the detection of Cryptosporidium oocysts according to parasitology keys (Henriksen and Pohlenz, 1981; Hassan et al., 2021) the second part was subjected to the DNA extraction and PCR analyses. Cryptosporidium-positive samples were also stored in 2.5% potassium dichromate at 4°C (Thompson et al., 2005) the dimensions of the parasite stages were measured using an ocular micrometer using a Leica microscope equipped with a digital camera (Scope Image 9.0, China). The camera software was calibrated for all microscope lenses using a 0.01 mm stage micrometer (ESM-11/Japan). C. parvum 4.5 × 5.0, C. canis 4.7 × 5.0 infected dog (Mohamed, 2014).
Molecular study
The current study utilized the Nested-PCR technique to molecularly detect Cryptosporidium spp. in dog feces by targeting the GP60 genes. Later on, the sequencing method was employed to analyze and describe the different species of Cryptosporidium.
DNA extraction
Following the manufacturer’s instructions, DNA was extracted directly from 50 fecal samples from dogs, including microscopically positive samples for confirmation and further identifications using (EasyPure®Stool Genomic DNA Kit, Transgen Company, China).
Primers used in the study
Nested PCR
Four sets of primers were used in this study according to Tables 1 and 2 for identifying two species of Cryptosporidium, where two sets of primers were for identifying (C. parvum) according to Table 1 and two sets of primers were for identifying (C. canis) according to Table 2.
Table 1: The sequence of primer of nested PCR that used for detecting C. parvum.
|
Primer |
Sequence |
Primer sequence 5'→ 3' |
Tm (oC) |
GC% |
Size of product (bp) |
Reference |
|
First reaction GP60 Cryptosporidium spp. |
(4) |
|||||
|
First reaction GP60 |
F |
ATAGTCTCCGCTGTATTC |
51.7 |
44 |
921bp |
|
|
R |
GGAAGGAACGATGTATCT |
53.1 |
44 |
|||
|
Second reaction GP60 Cryptosporidium parvum |
||||||
|
Second reaction GP60 |
F |
TCCGCTGTATTCTCAGCC |
59.1 |
56 |
887bp |
|
|
R |
GCAGAGGAACCAGCATC |
58.4 |
59 |
|||
Table 2: The sequence of primer of PCR that used for detecting C. canis.
|
Primer |
Sequence |
Primer sequence 5'→3' |
Tm (oC) |
GC% |
Size of product (bp) |
Reference |
|
GP60 Cryptosporidium canis |
||||||
|
Reaction GP60 |
F |
AAACGCCTCACTCGTTTCCT |
61.3 |
50 |
390 bp Primer design |
ID: ON863571.1 |
|
R |
AGTTCGTCCTTGCGAATCCA |
|||||
Phylogenetic tree
To compute evolutionary distances, a phylogenetic tree was constructed using the Unweighted Pair Group Method with Arithmetic Mean (UPGMA) method (Moss and Hendrickson Jr, 1973; Tamura et al., 2004). The optimal tree with the sum of branch length = 0.00795808 is shown of C. parvum. the optimal tree with the sum of branch length = 11.90711807 is shown of Cryptosporidium canis (Tamura et al., 2013).
DNA sequencing
DNA sequencing was conducted to identify Cryptosporidium species, and four nPCR-positive local isolate products were sent to Macrogene Company in Korea to identify Cryptosporidium spp. A homology search was conducted using the Basic Local Alignment Search Tool available at the National Center for Biotechnology Information (NCBI, http://www.ncbi. nlm.nih.gov) and the BioEdit program, version 7.2. The results were compared with data obtained from the GenBank and the ExPASY program (SIB Swiss Institute of Bioinformatics, Switzerland) available on the NCBI website (Mphephu et al., 2021).
Statistical analysis
The data was tabulated in a datasheet of IBM SPSS version 26.0, which was utilized to do the statistical analysis. The significant differences were tested using the analysis of the person chi-square test. Statistical significance was defined as a probability value (p≤ 0.05) (Firdaus, 2021).
RESULTS and Discussion
Microscopic examination
The microscopy is one of the most widely used methods for the detection of Cryptosporidium oocysts in fecal samples in dogs. The observations appeared that 22 out of 100 (22%) fecal samples were found to be positive for the diarrhea causing protozoan (Cryptosporidium species). The microscopic examination results demonstrated that Cryptosporidium spp. oocyst appeared as a pink to red round bodies against blue background when stained with the modified ziehl-neelsen acid fast staining. The average size of these oocysts were ( ±4µm × ±5.2 µm) as shown in the Figure 1.
According to sex, the infection rate in dogs was 13/85 (22.41%) in males while 9/42 (21.42 %) in female as shown in the Figure 2, The highest infection rates were observed in animals under one year of age, with 16/69 (23.18 %) and above one year was 6/31 (19.35) as illustrated in the Figure 3. Rural areas had a higher rate of infection in dogs, where it was 14/60 (23.33 %) compared with urban areas 8/40 (20 %) Figure 4.
Molecular diagnosis
The molecular diagnosis results showed that the nested PCR amplification of the GP60 gene was positive for 24 % (12/50) fecal samples of dogs 10% (5/50) of Cryptosporidium canis and 14% (7/50) of Cryptosporidium parvum (Figures 5, 6, 7).
DNA sequence analysis of Cryptosporidium spp.
To investigate C. canis and C. parvum in dogs in Babylon province, four isolates were genetically characterized using GP60 gene sequencing. In dogs, sequencing revealed specific C. canis (1/4, 20 %) and C. parvum (3/4, 60 %), zoonotic species. cryptosporidium spp. isolates were submitted to the NCBI GenBank database, and GenBank accession numbers were obtained for 4 Cryptosporidium canis (1) and Cryptosporidium parvum (3) isolates: C. parvum that have been deposited in the gene bank under the accession numbers (PP707752.1; PP707753.1; PP707754.1). and identified C. canis gene (GP60) that have been deposited in the gene bank under the accession numbers (PP707750.1) as shown in the (Table 3 and Figures 8, 9, 10, 11).
Table 3: DNA sequence analysis of Cryptosporidium spp. based on 60 kDa glycoprotein (GP60) gene.
|
Gene : 60 kDa glycoprotein (GP60) gene |
|||||||
|
Identities |
Sequence ID with compare |
Host |
Source |
Nucleotide |
Location |
Type of substitution |
No. of sample |
|
99% |
ID: MT954608.1 |
Dog |
Cryptosporidium canis |
A\G |
316 |
Transition |
1 |
|
T\G |
384 |
Transvertion |
|||||
|
100% |
ID: GU214366.1 |
Dog |
Cryptosporidium parvum |
-- |
-- |
-- |
2 |
|
99% |
ID: GU214366.1 |
Dog |
Cryptosporidium parvum |
T\C |
331 |
Transvertion |
3 |
|
99% |
ID: GU214366.1 |
Dog |
Cryptosporidium parvum |
T\C |
331 |
Transition |
4 |
Phylogenetic tree
Phylogenetic tree Cryptosporidium canis
Phylogenetic tree Cryptosporidium parvum: The evolutionary history was inferred using the UPGMA method (Moss and Hendrickson Jr, 1973). the optimal tree with the sum of branch length = 11.90711807 is shown. the tree was drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the maximum composite likelihood method (Tamura et al., 2004) and are in the units of the number of base substitutions per site. the analysis involved 11 nucleotide sequences codon positions included were 1st+2nd+3rd+Noncoding. All positions containing gaps and missing data were eliminated. There were a total of 281 positions in the final dataset. Evolutionary analyses were conducted in MEGA6 (Tamura et al., 2013) as shown in the the (Figure 8A, B).
Conclusions and Recommendations
According to the overall finding of the current study, it was shown that the results of the molecular techniques represented the first contribution to the knowledge of cryptosporidium species in dogs in Babylon Province/Iraq. Two species of the protozoan Cryptosporidium (specific species C. canis and zoonotic species C. parvum) have been successfully identified in dogs living in this area. Understanding the parasite species isolated in a certain area is crucial for providing accurate information about the risk of zoonotic transmission, host specificity, and the sources of infection during outbreaks. This analysis could also help define the role of Cryptosporidium spp. as an animal pathogen that harms animal health (Robertson et al., 2020).
Through microscopic examinations, the infection rate of cryptosporidium spp. observed in dogs was 22%. This result was significantly agreed with a previous study done by Moreira et al. (2018). In Brazil was reported 24.63%. It was in agreement with (Gharieb et al., 2018) in Egypt who found the rate of infection by using microscopic examination was 35%. In Iraq a study conducted by Al-Yasary and Faraj (2021) that reported 34.5 % in Karbala province. While it was not similar to the findings of (Hadi et al., 2014) in Mosul city, Iraq, which recorded 42%. The current study did not also agree with other studies; (Lindsay and Zajac, 2004) in the USA were recorded the rates of infection 44.8% and (El-Madawy et al., 2010) in Egypt 50%. The reason for the difference infection rates of Cryptosporidium spp. in dogs might be ascribed into the areas of study, numbers of examined animals, and techniques. In addition, the transmission occurs through direct contact between healthy and diseased dogs, as well as the availability of a favorable environment for oocysts to persist for extended durations (Arsalan et al., 2006).
The study found no significant difference in the infection rate between females and males. However, it was found that male dogs had a higher prevalence of Cryptosporidium spp. infection compared to female dogs, this result was consistent with that study in Egypt distribution of Cryptosporidium infection was higher in male household dogs than females 38.9% and 21.4%, respectively (Jian et al., 2014). While it disagreed with a study of (Al-Yasary and Faraj, 2021) in Karbala province in Iraq which found the higher infection rate in female dogs 48.27% compared to male dogs 23.89%. current and previous research indicates that Cryptosporidium is quite prevalent, and both males and females of dogs have an equal probability of getting infected when exposed to contaminated substances (Olabanji et al., 2016).
With regard to the effects of age on cryptosporidiosis, the results of present study found highest rate of infection in dogs with less than one year old compared to other age groups. The results were in agreement with the studies done in Iraq (Al-Yasary and Faraj, 2021; Faraj, 2019). Al-Yasary and Faraj (2021) who found that the infection rate was higher 55.69% and 20%, respectively in young’s dogs than adults were 20.66% and 10%, respectively. The results were also consistent with research conducted in Egypt, which found a 50% infection rate in young pups compared to a 10% rate in adult animals (Gharieb et al., 2018). The findings of the present study contradict a previous study conducted in Iran by Tavalla et al. (2017), which reported a higher infection incidence in adults at 12% and a lower infection rate in young individuals at 2.36% (Tavalla et al., 2017). there is a strong link between both age and the danger of Cryptosporidium infection, which was explained by This finding might be attributed to immature immune systems of pope dogs, whereas these dogs could be more venerable to Cryptosporidium infection (Kváč et al., 2006).
The results of the study showed non-significant differences between area of the study that include (rural and urban area). The higher infection rate was in rural area and the lower infection rate was in the urban area. Similar trends have been observed in studies in Egypt, 40% and 10% respectively (Gharieb et al., 2018). Also a study of Al-Yasary in Karbala province in Iraq 47.5% in rural than 20% urban (Al-Yasary and Faraj, 2021). The elevated rates of infection in rural areas can be attributed to various factors, such as inadequate access to potable water, reliance on river water as a primary water source, exposure to contaminated soils in agricultural areas containing parasite cysts, frequent contact with animals acting as reservoirs for the parasite, utilization of animal waste as organic fertilizer, and lower levels of health and cultural development among rural populations (Mugala et al., 2018).
According to the results of nested PCR and DNA sequencing techniques, the frequency of infection rates in DNA samples showed that samples were positive. In Iraq, previous studies found the prevalence of Cryptosporidium spp. in dogs using nested PCR technique was 28.6% (Faraj, 2019; Al-Yasary and Faraj, 2021) Karbala province in Iraq, 47% by Faraj in Bagdad Province Iraq (Al-Yasary and Faraj, 2021). In addition, infection rate of Cryptosporidium spp. by this technique in Iran was 12.3% (Tavalla et al., 2017). However, the percentage of current results was compatible with the percentage of infection in Egypt. In addition, the current results were different with other studies in China (Jian et al., 2014) they found infection rates of Cryptosporidium spp. in dogs by using PCR were 6.9% and in Poland (Piekara-Stepinska et al., 2021), Cryptosporidium spp. was identified by nested PCR in canine fecal samples was 3.4%.
According to the phylogenetic tree, the Cryptosporidium spp. isolates in this study exhibited similarity to sequences deposited in GenBank, with the maximum homology of the gene sequences between the Iraqi Cryptosporidium spp. strains and strains worldwide being 99%–100% for dogs. The phylogenetic analysis results confirmed minimal differences between the Iraqi strains of Cryptosporidium spp. and those from other countries. This genetic variation may be due to differences in the area size of the reference sequence and in the geographical areas where the isolates were collected. Various methods were used for the genetic analysis, including nPCR-based gene sequencing of partial or complete genes. The results of this study align with studies that have reported the existence of genetic variation and phylogenetic relationships among Cryptosporidium spp. populations worldwide thought these isolates to be adaptable for both zoonotic and anthroponotic transmissions, by direct or indirect contact. The current findings were in an agreement with by previous studies (Gharieb et al., 2018; Adam et al., 2019; Al-Yasary and Faraj, 2021). Overall, the present study highlighted the presence and prevalence of this protozoan in dogs living in this city, as well as identifying two important species C. canis and C. parvum. One of them is C. parvum which is a zoonotic species that plays a vital role in zoonotic infections.
It can be concluded that the current study highlighted the presence and distribution of the infection by Cryptosporidium species in dogs in this part of Iraq, where the infected males recorded the highest infection rate compared with infected females. The results also revealed that the infection rate was high in dogs in the age less than one year old. In addition, the infected dogs in rural areas had the highest infection rate compared with those in urban areas. The findings of the PCR and DNA sequencing techniques added significant knowledge to the present study, recording two important species of genus Cryptosporidium, included; C. canis which is a specific species infecting dogs, and C. parvum which is a zoonotic species between human and dogs. Importantly, the outcomes of the molecular techniques consider the first molecular investigation that has identified these two species in dogs living in Babylon province, Iraq. Thus, further research may be useful to understand the epidemiology of this infection and procedures for its control.
Highlights
Acknowledgments
The authors did not receive any funds for this study. The authors are thankful to the Department of Parasitology, College of Veterinary Medicine, Al-Qasim Green University, Iraq for providing the necessary facilities of this study.
NOVELTY STATEMENT
The first genetic investigation and Microscopic diagnosis of Cryptosporidium species infecting dogs also, the zoonotic species of C. parvum in dogs in Babylon city, Iraq.
AUTHOR’S CONTRIBUTION
Both authors equally contributed to complete this research.
Ethics approval
This study was approved by the ethics committee of the College of Veterinary Medicine/Al-Qasim Green University according to the letter (No.1152 in 18/7/2023) before beginning work on the present study; we contacted animal owners and obtained their permission to include their animals’ data in the current study.
Confect of interest
The authors have declared no conflict of interest.
REFERENCES
Adam KY, Ismail A, Masri M, Gameel A (2019). First report and molecular characterization of Cryptosporidium spp. in humans and animals in Khartoum state, Sudan. Vet. World, 12(1): 183. https://doi.org/10.14202/vetworld.2019.183-189
Alali F, Abbas I, Jawad M, Hijjawi N (2021). Cryptosporidium infection in humans and animals from Iraq: A review. Acta Trop., 220: 105946. https://doi.org/10.1016/j.actatropica.2021.105946
Al-Hassan NT, Al-Safo AA (2024). Molecular, immunological, and histological study of Cryptosporidium parvum in local duck Anas platyrhnchos in some regions of Mosul city, Iraq. Iraqi J. Vet. Sci., https://doi.org/10.33899/ijvs.2024.145610.3382
Ali N, Ali M (2023). Molecular detection of Cryptosporidium spp. in stray cats in Al-Qadisiyah Governorate, Iraq. https://doi.org/10.33899/ijvs.2022.132974.2155
Al-Musawi A, Awad A, Al-Khaled MJ (2022). Molecular analysis of Cryptosporidium species in domestic goat in central Iraq.
Al-Yasary JT, Faraj AA (2021). Genotyping of Cryptosporidium spp. in domestic dogs and humans in Karbala Province Iraq. Annls Roman. Soc. Cell Biol., 25(6): 4120-4125. http://annalsofrscb.ro/index.php/journal/article/view/6199.
Arsalan S, Daham E, Al-Obaidi Q, Sulaiman E (2006). Study the percentage of infection with endo and ecto parasites in dogs in Mosui, Iraq. Iraqi J. Vet. Sci., 20(1): 125-137. https://doi.org/10.33899/ijvs.2006.62475
Chalmers RM, Katzer F (2013). Looking for Cryptosporidium: The application of advances in detection and diagnosis. Trends Parasitol., 29(5): 237-251. https://doi.org/10.1016/j.pt.2013.03.001
El-Madawy R, Khalifa N, Khater H (2010). Detection of Cryptosporidial infection among Egyptian stray dogs by using Cryptosporidium parvum outer wall protein gene.
Faraj A (2019). Traditional and molecular study of Cryptosoporidium spp. in domestic dogs in Baghdad city, Iraq. Iraqi J. Agric. Sci., 50(4): https://doi.org/10.36103/ijas.v50i4.754
Firdaus M (2021). Metodologi penelitian kuantitatif; dilengkapi analisis regresi IBM SPSS Statistics Version 26.0. CV. Dotplus Publisher.
Gharieb RMA, Merwad AMA, Saleh AA, El-Ghany AMA (2018). Molecular screening and genotyping of Cryptosporidium species in household dogs and in-contact children in Egypt: Risk factor analysis and zoonotic importance. Vector Borne Zoonot. Dis., 18(8): 424-432. https://doi.org/10.1089/vbz.2017.2254
Hadi E, Suleiman E, Al-Obadi Q, Arslan S (2014). Diagnostic study of Cryptosporidium spp. and Giardia spp. in stray dogs and cats in Mosul city, Iraq. https://doi.org/10.33899/ijvs.2014.89337
Hamzah KJ, Mahmood AK, Saad MH (2019). Comparative study of blood pressure between local breed and different breed of dogs in Iraq. Biochem. Cell. Arch., 19(2).
Hassan EM, Örmeci B, DeRosa MC, Dixon BR, Sattar SA, Iqbal (2021). A review of Cryptosporidium spp. and their detection in water. Water Sci. Technol., 83(1): 1-25. https://doi.org/10.2166/wst.2020.515
Henriksen SA, Pohlenz JFL (1981). Staining of Cryptosporidia by a modified Ziehl-Neelsen technique. Acta Vet. Scand., 22(3-4): 594. https://doi.org/10.1186/BF03548684
Hijjawi N, Zahedi A, Al-Falah M, Ryan U (2022). A review of the molecular epidemiology of Cryptosporidium spp. and Giardia duodenalis in the Middle East and North Africa (MENA) region. Infect. Genet. Evol., 98: 105212. https://doi.org/10.1016/j.meegid.2022.105212
Jarad NI (2020). Molecular detection of Cryptosporidium parvum in chicken in Al-Diwaniya province. Iraqi J. Vet. Sci., 34(2): 441-445. https://doi.org/10.33899/ijvs.2019.126159.1249
Jian F, (2014). Occurrence and molecular characterization of Cryptosporidium in dogs in Henan Province, China. BMC Vet. Res., 10: 26. https://doi.org/10.1186/1746-6148-10-26
Kadim AM, Habash AH, Ali MJ (2022). Molecular subtype analysis of Cryptosporidium spp. in sheep of Babylon province, middle Iraq. J. Basrah Res. (Sci.), 48(1): 40-48. https://doi.org/10.56714/bjrs.48.1.4
Khan B, (2023). Animals to human transmission of intestinal diseases: A review of the mechanism and factors involved. Zoon. Unique Sci. Publ. Faisalabad, Pakistan, 4: 29-45. https://doi.org/10.47278/book.zoon/2023.136
Kváč M, Kouba M, Vítovec J (2006). Age-related and housing-dependence of Cryptosporidium infection of calves from dairy and beef herds in South Bohemia, Czech Republic. Vet. Parasitol., 137(3-4): 202-209. https://doi.org/10.1016/j.vetpar.2006.01.027
Lindsay DS, Zajac A (2004). Cryptosporidium infections in cats and dogs. Compendium on continuing education for the practising veterinarian-North American Edition, 26(11): 864-876. www.VetLearn.com.
Mohamed YAHA (2014). Epidemiological investigations on the public health significance of Cryptosporidium parasites in livestock and people in the Ismailia Canal Zone of Egypt.
Moreira ADS, Baptista CT, Brasil CL, Valente JDSS, Bruhn FRP, Pereira DIB (2018). Risk factors and infection due to Cryptosporidium spp. in dogs and cats in southern Rio Grande do Sul. Rev. Brasil. Parasitol. Vet., 27(1): 112-117. https://doi.org/10.1590/s1984-296120180012
Mosa AH, Hamzah KJ, Aljabory HAH (2022). First study of the molecular prevalence of caprine arthritis encephalitis virus in goats in Babylon, Iraq. Vet. World, 15(4): 1129–1133. https://doi.org/10.14202/vetworld.2022.1129-1133
Moss WW, Hendrickson Jr JA (1973). Numerical taxonomy. Ann. Rev. Entomol., 18(1): 227-258. https://doi.org/10.1146/annurev.en.18.010173.001303
Mphephu MG, Ekwanzala MD, Momba MNB (2021). Cryptosporidium species and subtypes in river water and riverbed sediment using next-generation sequencing. Int. J. Parasitol., 51(5): 339-351. https://doi.org/10.1016/j.ijpara.2020.10.005
Mugala L, Siwila J, Saasa N, Pandey GS (2018). Prevalence of Cryptosporidium spp. oocysts in dogs in Lusaka district of Zambia. Vet. World, 11(5): 585. https://doi.org/10.14202/vetworld.2018.585-589
Murnik LC, Daugschies A, Delling C (2022). Cryptosporidium infection in young dogs from Germany. Parasitol. Res., 121(10): 2985-2993. https://doi.org/10.1007/s00436-022-07632-2
Nichols GL (1992). The biology, epidemiology and typing of Cryptosporidium spp. University of Surrey (United Kingdom).
Olabanji GM, Maikai BV, Otolorin GR (2016). Prevalence and risk factors associated with faecal shedding of Cryptosporidium oocysts in dogs in the federal capital territory, Abuja, Nigeria. Vet. Med. Int., 2016: 4591238. https://doi.org/10.1155/2016/4591238
Piekara-Stepinska A, Piekarska J, Gorczykowski M (2021). Cryptosporidium spp. in dogs and cats in Poland. Ann. Agric. Environ. Med., 28(2): 345-347. https://doi.org/10.26444/aaem/120467
Robertson LJ, Johansen ØH, Kifleyohannes T, Efunshile AM, Terefe G (2020). Cryptosporidium infections in Africa how important is zoonotic transmission? A review of the evidence. Front. Vet. Sci., 7: 575881. https://doi.org/10.3389/fvets.2020.575881
Smith H (2007). Diagnostics in Cryptosporidium and Cryptosporidiosis: CRC Press, pp. 173-208. https://doi.org/10.1201/9781420052275-6
Taghipour A, (2020). The global prevalence of Cryptosporidium infection in dogs: A systematic review and meta-analysis. Vet. Parasitol., 281: 109093. https://doi.org/10.1016/j.vetpar.2020.109093
Tamura K, Nei M, Kumar S (2004). Prospects for inferring very large phylogenies by using the neighbor-joining method. Proc. Natl. Acad. Sci., 101(30): 11030-11035. https://doi.org/10.1073/pnas.0404206101
Tamura K, Stecher G, Kumar S (2021). MEGA11: Molecular evolutionary genetics analysis version 11. Mol. Biol. Evol., 38(7): 3022-3027. https://doi.org/10.1093/molbev/msab120
Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013). MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol., 30(12): 2725-2729. https://doi.org/10.1093/molbev/mst197
Tavalla M, Kord E, Abdizadeh R, Asgarian F (2017). Molecular study of Cryptosporidium spp. in dogs from southwest of Iran. Jundishapur J. Microbiol. In Press. https://doi.org/10.5812/jjm.43412
Thompson RA, Koh WH, Clode PL (2016). Cryptosporidium what is it? Food Waterb. Parasitol., 4: 54-61. https://doi.org/10.1016/j.fawpar.2016.08.004
Thompson RA, Olson M, Zhu G, Enomoto S, Abrahamsen MS, Hijjawi N (2005). Cryptosporidium and Cryptosporidiosis. Adv. Parasitol., 59: 77-158. https://doi.org/10.1016/S0065-308X(05)59002-X