Special Issue:

Emerging and Re-emerging Animal Health Challenges in Low and Middle-Income Countries

Molecular Detection of Entamoeba histolytica in Human and Cattle

Mohammed Jawad Kadhim*, Qasim Jawad Amer

Department of Parasitology, College of Veterinary Medicine, Al-Qasim Green University, 51013, Babylon, Iraq.

Abstract | The purpose of this research is to determine how common Entamoeba histolytica is in Babylon City, Iraq, among both people and animals. One hundred samples were taken from humans and one hundred from cattle around the province, for a grand total of 200 fecal samples. PCR and microscopy were performed to assess the genetics and diversity of the Entamoeba histolytica. The ITS1 region of the parasite’s small subunit rRNA gene was amplified using a PCR. in conjunction with microscopy. The microscopy results revealed the existence of parasite cysts and trophozoites in both human and cattle fecal samples. The PCR results indicated that the genus Entamoeba was detected in 43% (43/100) of the human fecal samples (27 in male and 16 in female). Moreover, the results showed that the high frequency of E. histolytica was in children less than 5 years old (48.6%) as compared to patient from 5-10 years and patient more than 10 years where a rate of 38.2% and 41.4% was observed, respectively. For cattle, PCR indicated 59% positivity based on the ITS gene. A total of 13 were positive in male and 46 were positive in female. On the other hand, the high frequency (63.2%) of E. histolytica was recorded in animals from 2 years old and above as compared with those less than 2 years (56.5%). In conclusion, the molecular approaches employed in the present investigation shown a remarkable degree of sensitivity and specificity.

Keywords | Entamoeba histolytica, Cattle, PCR, Babylon, Human and Diarrhea


Received | July 18, 2024; Accepted | October 04, 2024; Published | December 04, 2024

*Correspondence | Mohammed Jawad Kadhim, Department of Parasitology, College of Veterinary Medicine, Al-Qasim Green University,51013 Babylon, Iraq; Email: [email protected]

Citation | Kadhim MJ, Amer QJ (2024). Molecular detection of Entamoeba histolytica in human and cattle. J. Anim. Health Prod. 12(s1): 182-186.

DOI | https://dx.doi.org/10.17582/journal.jahp/2024/12.s1.182.186

ISSN (Online) | 2308-2801

Copyright: 2024 by the authors. Licensee ResearchersLinks Ltd, England, UK.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).



Introduction

Internal protozoa of the genus Entamoeba can cause an infection known as amoebiasis. Following malaria and schistosomiasis in terms of human mortality, E. histolytica is ranked as the third most dangerous parasite (Lourenço, 2023; Baig et al., 2024). Amoebiasis typically spreads in underdeveloped nations due to a lack of sanitation, low hygiene standards, and overcrowding in the housing market. In contrast, people who have traveled to regions where the disease is common are the principal vector for its spread in developed countries (Fletcher et al., 2012). Many cases arise from persons who are carriers of the illness, referred to as cyst passers, and who excrete the parasite in their feces, either in a fully mature or partially formed state (Cui et al., 2019). Monkeys, dogs, cattle, and potentially pigs are naturally affected by E. histolytica, although the likelihood of human exposure from these species is quite low compared to humans themselves (Hossain et al., 2023). Global frequency of E. histolytica infection is significant, particularly in tropical and subtropical regions. Amoebiasis is expected to impact five hundred million worldwide (Roro et al., 2022). Recently a study has approximated that amoebiasis affects fifty million individuals on a yearly basis, resulting in an estimated 100,000 deaths per year (Flaih et al., 2021; Gupta et al., 2022). Entamoeba spp. is a type of protozoan that lives in the intestines and can cling to and damage the tissue lining the intestines. The life cycle of this organism consists of two forms: Trophozoites and cysts. Infection is acquired through the consumption of water or food that has been contaminated with cysts. The trophozoites in the small intestine undergo excystation to reach maturity and establish themselves in the colonic area, where they then attach to the mucosal layer of the large intestines. E. histolytica is the causative agent of both intestinal and extra-intestinal infections (Al-Yasari et al., 2019; Vaisusuk and Saijuntha, 2021; Hamzah et al., 2020). PCR-based methods often demonstrate higher sensitivity and specificity in comparison to microscopy tests (Markussen et al., 2023). This study was conducted in Babylon City, Iraq to assess the efficacy of a multiplex PCR method for the molecular detection of Entamoeba histolytica in both humans and cattle.

Materials and Method

Sampling

In various parts of Babylon Governorate, Iraq, feces samples were taken from 100 humans and 100 animals. Containers containing the samples were sealed and sent cold to the Parasitology Laboratory at the College of Veterinary Medicine at Al-Qasim Green University in Babylon, Iraq. The collection period for these samples was from October 2023 to April 2024.

Microscopic inspection

The condition of the feces and the presence of any visible blood or mucus were meticulously recorded in each sample. Parasite cysts and their vegetative stages were detected using a wet direct dye using iodine dye.

PCR analysis

The DNA was extracted after each 200 mg fecal sample was washed in 1 ml of sterile Phosphate Buffer saline with a pH of 7.2. The samples were then centrifuged at 14,000 × g for 5 minutes, following the instructions of the QIAGEN kit from Hilden, Germany. Primers used in this investigation were F: GGCCGTTCTTAGTTGGTGGA and R: GTGTGTACAAAGGGCAGGGA for a product of 374bp (Albanese et al., 2019; Mosa et al., 2022). 0.2 microliters of DNA polymerase at 5 units per microliter, 2 microliters of DNA at 100 nanograms, 0.6 microliters of each primer at 40 micromoles, and 16.5 microliters of PCR-water were utilized for the PCR reaction component. Thermocycler settings included 92°C denaturation, 40 cycles of denaturation, annealing, and extension (72°C for 45 seconds followed by 72°C for 5 minutes), and 72°C for 5 minutes of final extension.

Statistical assessment

According to Schiefer (1980), statistical analysis was performed on all samples in this study using chi-square to evaluate if there were significant differences for the analyzed variables. Significant differences were defined at the probability level (P≤0.05).

Results and Discussion

Microscopically findings

The morphology and motility of the trophozoite were examined under the microscope, and the nuclei in both the cyst of the parasite and the trophozoite were stained with iodine Figure 1.

 

 

PCR technique

We used PCR on DNA samples that had a concentration of 400 to 710 ng/μl and a purity level of 1.6 to 1.8. Out of 100 human feces samples, 43% tested positive for the ITS gene, according to the total results of the PCR technique (Figure 2). The correlation between frequency and sex of patient showed that out of 54 male 27 were positive (27/54) 50% of infection, while in female were (16/46) 34.8% as described in Table 1. Moreover, the results shown in Table 2 showed that the highly frequency of E. histolytica were in children less than 5 years old 48.6% (18/37). While in patient from 5-10 years and patient more than 10 years were 13/34(38.2) and 12/29(41.4), respectively.

 

Table 1: The frequency of E. histolytica in feces of human diagnosed by PCR.

Percentage of total (٪)

Positive

Total cases

Sex

50

27

54

Male

34.8

16

46

female

43

43

100

Total

2.346868

X2

0.125535NS

P value

 

Table 2: The age correlation with the frequency of E. histolytica of fecal human samples.

Percentage of total (٪)

Positive

Total cases

Age

48.6

18

37

Less than 5 years

38.2

13

34

From 5 years to 10 years

41.4

12

29

More than 10 years

43

43

100

Total

0.827671

X2

0.661110 NS

P value

 

For cattle, the total results of PCR technique showed that, out of 100 cow stool samples (59%) were positive for (ITS) gene as depicted in Figure 3. The correlation between frequency of E. histolytica and sex of animal showed that out of 25 male 13 were positive (13/25) 52% of infection, while in female were (46/75) 61% as described in Table 3. On the other hand, the results in Table 4 showed that the highly frequency of E. histolytica were in animals from 2 years old and above 63.2% (24/38). While the animals aged less than 2 years the frequency were 35/62(56.5).

 

Table 3: The frequency of E. histolytica in cattle that diagnosed by PCR.

Percentage of total (٪)

Positive

Total cases

Sex

52

13

25

Male

61

46

75

Female

59

59

100

Total

0.675210

X2

0.411241 NS

P value

 

Table 4: Age correlation with frequency of E. histolytica in cattle fecal samples.

Percentage of total (٪)

Positive

Total cases

Age

56.5

35

62

Less than 2 years

63.2

24

38

From 2 years and above

59

59

100

Total

0.438029

X2

0.508075 NS

P value

 

 

The findings of this study indicate that PCR is a highly efficient method for detecting E. histolytica. Therefore, employing PCR is a feasible method for distinguishing between distinct species. This approach has superior sensitivity and specificity when compared to microscopy (Hamzah et al., 2019). The ITS1 region of the parasite genome is essential for molecular diagnostics, as it is used for both species’ identification and overall diagnosis (Paul and Kannan, 2019). López-López et al. (2017) have utilized a segment of the ITS1 gene to accurately distinguish and categorize E. histolytica and E. dispar in their investigation. Five single nucleotide changes were identified in this gene between the two species. The precise detection of E. histolytica and E. dispar was achieved by various approaches, including real-time PCR. Regrettably, the excessively high cost limits their usage in developing nations, and specific models may generate inaccurately pessimistic results (Calderaro et al., 2015; Van Den Broucke et al., 2018). In addition, the PCR method based on the ITS1 gene was shown to be extremely efficient in the current study. The user’s text is a single period. The findings align with the study conducted by Saba and Meki (2017), which determined that the ITSI gene is the suitable DNA region for identifying E. histolytica in the middle Euphrates region of Iraq. The findings of this experiment were like those seen by (Zebardast et al., 2014; Mohmood et al., 2020). The infection rate was 62.96%, while Iran’s infection rate stood at 67.7%. A study conducted by Sajid et al. (2024) revealed that 3.2% of Malaysians were exclusively infected with E. histolytica, whereas 13.4% had concurrent infections of both E. histolytica and E. dispar. According to the studies conducted by Abdel-Naim (2012) and Al-Aarif and Al-Jarjary (2023), the infection rate of E. histolytica among patients in the outpatient clinic at Al-Zaqaziq University Hospital was 50%, while the infection rate of E. dispar was 35%. Emphasizing the efficacy of the primers developed for diagnosing E. histolytica is crucial. The primers successfully amplified the target section in the ITS1 region, leading to the presence of migration products at the target test. The size of these products was 374 base pairs, as depicted in Figures 2 and 3. This confirms and validates the accuracy of the diagnosis. The discrepancies in the outcomes of the PCR approach can be ascribed to variations in the methodologies employed for DNA extraction from fecal samples and the implementation of PCR, together with potential disparities in the quantity of parasites detected in the feces. Alternatively, the variations in infection rates of these parasites may be attributed to their random spread across numerous countries worldwide, influenced by diverse climatic conditions, cultural practices, and traditional beliefs.

Conclusions and Recommendations

Microscopic examination continues to be a dependable technique for verifying the existence of the parasite. Nevertheless, it lacks efficacy in assessing the parasite’s pathogenicity or discerning its precise classifications. Hence, it is advisable to employ serological or molecular diagnostic techniques in addition to the findings from microscopic inspection. The molecular and serological methods used in this study demonstrated a high level of sensitivity and specificity.

Acknowledgment

Warmest our-thanks for the head of Department of parasitology for their supporting me to completion of the study.

Novelty Statement

Evaluate the potential of Molecular Detection of Entamoeba histolytica in Human and Cattle.

Author’s Contribution

Qasim Jawad Amer and Mohammed Jawad Kadhim are participatred in research desing, proposal writing, experimental and clinical works and also drafting the manuscript.

Ethical approval

Ethical approval was obtained from the ethical committee (127/2023) in the Al-Qasim Green University, College of Veterinary Medicine.

Conflict of interest

The authors have declared no conflict of interest.

References

Abdel-Naeem FA (2012). A differential study between Entamoeba histolytica and Entamoeba dispar using PCR technique. PhD thesis, Zagazig University, Faculty of Medicine; pp. 101.

Al-Aarif ASK, Al-Jarjary SAA (2023). Serological and molecular methods to detection Entamoeba histolytica. J. Surv. Fish. Sci., 10(1S): 4588-4595.

Albanese GA, Lee DH, Mueller AE, Jordan BJ (2019). Identification of a Short DNA bar code in the 18S rDNA for improved differentiation of common Eimeria species infecting chickens. J. Parasitol., 105(5): 816-820. https://doi.org/10.1645/19-34

Al-Yasari HF, Hashim HO, Altaei AHO, Al-Shuhaib MBS (2019). Identification of serious clinical amebic dysentery cases in the middle Euphrates region of Iraq.

Bahrami F, Haghighi A, Zamini G, Khademerfan M (2019). Differential detection of Entamoeba histolytica, Entamoeba dispar and Entamoeba moshkovskii in faecal samples using nested multiplex PCR in west of Iran. Epidemiol. Infect., 147: e96. https://doi.org/10.1017/S0950268819000141

Baig AM, Suo X, Liu D (2024). Pathogenesis of protozoan infections. In: Molecular medical microbiology. Academic Press. pp. 2921-2940. https://doi.org/10.1016/B978-0-12-818619-0.00091-5

Calderaro A, Piergianni M, Buttrini M, Montecchini S, Piccolo G, Gorrini C, De Conto F (2015). MALDI-TOF mass spectrometry for the detection and differentiation of Entamoeba histolytica and Entamoeba dispar. PLoS One, 10(4): e0122448. https://doi.org/10.1371/journal.pone.0122448

Cui Z, Li J, Chen Y, Zhang L (2019). Molecular epidemiology, evolution, and phylogeny of Entamoeba spp. Infect. Genet. Evol., 75: 104018. https://doi.org/10.1016/j.ympev.2018.10.010

Flaih MH, Khazaal RM, Kadhim MK, Hussein KR, Alhamadani FAB (2021). The epidemiology of amoebiasis in Thi-Qar Province, Iraq (2015-2020): Differentiation of Entamoeba histolytica and Entamoeba dispar using nested and real-time polymerase chain reaction. Epidemiol. Health, 43. https://doi.org/10.4178/epih.e2021034

Fletcher SM, Stark D, Harkness J, Ellis J (2012). Enteric protozoa in the developed world: A public health perspective. Clin. Microbiol. Rev., 25(3): 420-449. https://doi.org/10.1128/CMR.05038-11

Gupta P, Singh KK, Balodhi A, Jain K, Deeba F, Salam N (2022). Frequency of amoebiasis and associated complications in India: A systematic review. Acta Parasitol., 67(2): 947-961. https://doi.org/10.1007/s11686-022-00547-z

Hamzah KJ, Alhtheal ED, Ibraheem AK (2020). Pathological changes induced by Klebsiella pneumoniae in immunized rats wit whole sonicated Klebsiella pneumoniae antigens mixed with certain adjuvants. Biochem. Cell. Arch., 20(2).

Hamzah KJ, Mahmood AK, Saad MH (2019). Comparative study of blood pressure between local breed and different breed of dogs in Iraq. Biochem. Cell. Arch., 19(2).

Hossain MS, Hatta T, Labony SS, Kwofie KD, Kawada H, Tsuji N, Alim MA (2023). Food-and vector-borne parasitic zoonoses: Global burden and impacts. Adv. Parasitol., 120: 87-136. https://doi.org/10.1016/bs.apar.2023.02.001

López-López P, Martínez-López MC, Boldo-León XM, Hernández-Díaz Y, González-Castro TB, Tovilla-Zárate CA, Luna-Arias JP (2017). Detection and differentiation of Entamoeba histolytica and Entamoeba dispar in clinical samples through PCR-denaturing gradient gel electrophoresis. Braz. J. Med. Biol. Res., 50: e5997. https://doi.org/10.1590/1414-431x20175997

Lourenço MFA (2023). Survey of gastrointestinal parasites of non-human primates from two Iberian zoos and perspectives of their integrated control (Doctoral dissertation, Universidade de Lisboa, Faculdade de Medicina Veterinária).

Mahmood AK, Hamzah KJ, Dirwal AR, Salh AH (2020). Isolation of Escherichia coli from skin wounds in cow. Plant Arch., 20(1): 3108-3110.

Markussen DL, Ebbesen M, Serigstad S, Knoop ST, Ritz C, Bjørneklett R, Grewal HM (2023). The diagnostic utility of microscopic quality assessment of sputum samples in the era of rapid syndromic PCR testing. Microbiol. Spect., 11(5): e03002-23. https://doi.org/10.1128/spectrum.03002-23

Mosa AH, Hamzah KJ, Aljabory HA (2022). First study on the molecular prevalence of caprine arthritis encephalitis virus in goats in Babylon, Iraq. Vet. World, 15(4): 1129. https://doi.org/10.14202/vetworld.2022.1129-1133

Paul S, Kannan I (2019). Molecular identification and antifungal susceptibility pattern of Candida species isolated from HIV infected Patients with candisiasis. Curr. Med. Mycol., 5(1): 21. https://doi.org/10.18502/cmm.5.1.533

Roro GB, Eriso F, Al-Hazimi AM, Kuddus M, Singh SC, Upadhye V, Hajare ST (2022). Frequency and associated risk factors of Entamoeba histolytica infection among school children from three primary schools in Arsi Town, West Zone, Ethiopia. J. Parasit. Dis., 46(3): 776-784. https://doi.org/10.1007/s12639-022-01495-1

Saba FA, Mike AH (2017). Molecular detection of E. histolytica in middle Euphrates, Iraq. J. Univ. Babylon, 25(1).

Sajid T, Razzaq A, Shamim A, Shahid S, Anwar DM, Fatima Z, Khosa SA (2024). Investigation on water borne protozoan parasites in drinking water of Quetta and Sohbat Pur Districts of Balochistan. J. Agric. Vet. Sci., 3(1): 97-105.

Schiefer (1980). Statistics for the biological science. 2nd Addison. Wesley publcomp, California, London.

Vaisusuk K, Saijuntha W (2021). Intestinal protozoa: Their role as human pathogens and zoonoses. Biodiv. Southe. Asian Parasit. Vectors Causing Hum. Dis., pp. 35-61. https://doi.org/10.1007/978-3-030-71161-0_3

Van Den Broucke S, Verschueren J, Van Esbroeck M, Bottieau E, Van den Ende J (2018). Clinical and microscopic predictors of Entamoeba histolytica intestinal infection in travelers and migrants diagnosed with Entamoeba histolytica/dispar infection. PLoS Neglect. Trop. Dis., 12(10): e0006892. https://doi.org/10.1371/journal.pntd.0006892

Zebardast N, Haghighi A, Yeganeh F, Tabaei SJS, Gharavi MJ, Fallahi S, Naderi F (2014). Application of multiplex PCR for detection and differentiation of Entamoeba histolytica, Entamoeba dispar and Entamoeba moshkovskii. Iran. J. Parasitol., 9(4): 466.