Comparative Biochemical and Genetic Analysis of Two Species of Ghost Crabs, Ocypode rotundata and Ocypode ceratophthalmus from the Coast of Pakistan
Sahir Odhano1*, Michael S Rosenberg2, Noor Us Saher3, Guan Yang Zhang4 and Mustafa Kamal5
1Department of Fisheries and Aquaculture, Shaheed Benazir Bhutto University of Veterinary and Animal Sciences, Sakrand-671200, Pakistan
2Center for Biological Data Science, Virginia Commonwealth University, Box 842030, Richmond, VA 23284-2030, Virginia, USA
3Center of Excellence in Marine Biology, University of Karachi, Karachi, 57270
4A Bclonal, 500 W Cummings Park, Woburn, MA, 01801, USA
5Department of Biotechnology, University of Karachi, Karachi, 25270, Pakistan
ABSTRACT
The present study focused on the taxonomic, biochemical, and molecular redescription of the genus Ocypode (Family Ocypodidae) from two localities of the Karachi, Sindh coast (Sandspit and Sonari) and one locality of Miani Hor, Balochistan (Sonmiani). The species belonging to the genus Ocypode are commonly known as ghost crabs. Previously, there was no such research conducted on biochemical and molecular studies. Polyacrylamide gel electrophoresis was used for the biochemical study to identify and quantify proteins and other enzymes by using seven markers: Coomassie brilliant blue (COM), creatine kinase (CK), carbonate dehydratase (CD), catalase (CAT), amylases (AMY), peroxidase (PXD) and octanol (OCT). The isozyme CD was revealed as a distinguishing marker between two species with significant differences (P=0.00), deviating from the hardy weinberg (HW) equilibrium. The fixation index (FST) was higher (53.3%) between the two species indicating species are distinct from each. The molecular study of the combined data set revealed both species belong to a highly supportive monophyletic clade with 100 bootstrap values by using maximum likelihood (ML), maximum parsimony (MP), and bayesian interference (BI). Genetic distance also showed a higher level of variation between the two species (5.5%). The current study revealed a significant finding regarding Ocypode rotundata with a higher intra-specific variation in isozyme (37% polymorphic loci) and molecular data (genetic distance = 0.7%), which needs further analysis on Ocypode rotundata. It is highly recommended that targeted species be collected from different localities of Pakistan coastline and more molecular markers be used like (28S, ITS-1 and ITS-2) to resolve this issue.
Article Information
Received 21 July 2022
Revised 13 January 2023
Accepted 21 February 2023
Available online 26 June 2023
(early access)
Published 06 January 2024
Authors’ Contribution
SO: Field work and laboratory work. MS: Writing especially English grammar, punctuation and paragraph setting. NUS: Writing/drafting. GYZ: Data analysis. MK: Molecular work.
Key words
Taxonomic revision, Molecular phylogeny, Ghost crabs, Comparative analysis, Isozyme study
DOI: https://dx.doi.org/10.17582/journal.pjz/20220721190738
* Corresponding author: [email protected]
0030-9923/2025/0001-0117 $ 9.00/00
Copyright 2025 by the authors. Licensee Zoological Society of Pakistan.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Introduction
The Pakistan coastline is enriched with crab populations; most of the coastal areas provide habitat to crabs belong the family Ocypodidae Rafinesque, 1915 (Crustacea: Arthropoda) (Saher, 2008; Shih et al., 2016). Species belonging to this family inhabit sandy and muddy coastal beaches by constructing burrows of variable size and shape (Barass, 1963; Strachen et al., 1999; Vecchioni et al., 2019). This family is broadly distributed in tropical and some temperate coastal regions. They are dominant throughout the sandy and muddy coastal areas of Pakistan. These crabs always fascinate and attract visitors with their beautiful colors and behavior.
Although the family Ocypodidae is one of the largest studied groups of Brachyura in the world, most attention and detailed study have been conducted on its morphological, and taxonomic analysis by many scientists (Rosenberg, 2001). Sakai and Tȕrkay (2013) described the comprehensive morphological study of taxonomic revision of ghost crab throughout the world, divided the family into two subfamilies Ucinae Dana, 1851 and Ocypodinae Rafinesque, 1815 (including two Genera Ocypode Weber, 1795; Hoplocypode Sakai and Turkay, 2013) reporting 22 species of ghost crabs. In comparison, Shih et al. (2016) described the complete phylogenetic tree of the family Ocypodidae using the mitochondrial analysis based on COI and 16S ribosomal genes. Based on the sequences, Shih et al. (2016) rearranged the family Ocypodidae. They proposed three sub-families Ocypodinae (including three genera as Ocypode Weber 1795, Uca Leach, 1814, and Afruca Crane, 1975), (Gelasiminae Miers, 1886 and Ucidinae Števčić, 2005).
The four species of ghost crabs O. ceratophthalmus Pallas 1772, O. gaudichaudii H. Milne Edwards and Lucas, 1843, O. macleayana Hess, 1865, and O. rotundata Miers 1882 were reported from the coastal areas of Pakistan (Hashmi, 1962, 1963, 1968; Tirmizi and Kazmi, 1986; Yousuf et al., 2007). Later, detailed description and evidence were provided by Sakai and Tȕrkay (2013) that O. gaudichaudii is abundantly found in Eastern Pacific regions, whereas O. macleayana is the synonym of O. ceratophthalmus and O. rotundata. Therefore, it is considered that there are only two confirmed species found along the coast of Pakistan (O. ceratophthalmus and O. rotundata). The occurrence of O. ceratophthalmus is widely distributed throughout the Indo-West Pacific region from Eastern Australia to the Eastern and Southern part of Africa Whereas, O. rotundata is limited to India, Pakistan, Persian Gulf, and Gulf of Oman (Sakai and Tȕrkay, 2013; Shih et al., 2016).
Isozyme study is a valuable technique to identify the species and distinguish sub-species by using the polyacrylamide gel electrophoresis (PAGE) (Snider, 1973; Aly et al., 2013). This technique is widely used for systematic study in plants, fungi, and invertebrates, including marine crustaceans (Thrope et al., 2000; Weber et al., 2003; Naz et al., 2017; Odhano et al., 2018). The electrophoretic patterns provide the irregular frequency and physicochemical properties of proteins or gene products. Previously, various isozyme types have been used for the interspecific and intraspecific variation, such as carbonic dehydratase (CD), catalase (CAT), amylase (AMY) extracted from muscle tissues of marine crabs such as Portunid crabs, fiddler crabs, and porcellanid crabs have been observed from the coastal waters of Pakistan (Saher et al., 2016; Naz et al., 2017; Odhano et al., 2018). However, no previous data is available on isozyme analysis of ghost crabs from the coastal waters of Pakistan.
No molecular data exists for these two species from Pakistan coastal areas to date. The current study reveals that wide distribution of O. rotundata throughout the coastal areas of Pakistan, whereas the distribution of O. ceratophthalmus is disjunct between a few coastlines of Pakistan. This study suggests that the gene flow is present in O. rotundata and absent in O. ceratophthalmus between the coastal regions of Pakistan. Due to the absence of gene flow, there are favorable chances of allopatric speciation or yet cryptic species emergence from O. ceratophthalmus.
The species samples were collected and analyzed genetically for sequencing the fragments of mitochondrial DNA (mtDNA) Cytochrome oxidase I 16S rRNA and 12S rRNA to test the hypothesis and investigate the patterns of molecular diversity from two coastal regions of Pakistan. Furthermore, samples from fiddler crabs (Austruca iranica and Austruca sindensis) were also selected as closely related species. The data set of COI, 16S rRNA and 12S rRNA of selected species were taken from GenBank and analyzed.
Previously, Tirmizi and Ghani (1996) reported two species of ghost crabs. Whereas Yousuf et al. (2007) reported four species of ghost crabs from Pakistani coastal waters. To remove the ambiguity and provide latest data using the latest techniques. Therefore, the present research was conducted based on the assessment of genetic variation within and between the species of ghost crabs using isozyme electrophoresis and molecular analysis along the coast of Pakistan.
MATERIALS AND METHODS
Site selection and sampling activities
The species belonging to the genus Ocypode were sampled for study from three sandy coastal regions of Pakistan, Sandspit (24°49′41.0^N 66°56′26.0″ E), Sonari (24°53′00.0^N 66°42′00.0″E), and Sonmiani (25°26′ 00.0^N 66°35′00.0″E) from 2015 to 2017 by random method at dusk time. The Sandspit and Sonari sites are in Sindh Province in Karachi city with 27.5 km distance, whereas Sonmiani is in Balochistan Province of Miani Hor area, which is approximately 90 km at a distance from Karachi. Twenty (20) specimens were randomly collected from each selected site for isozyme and molecular study. All the collected samples were placed in labeled polythene bags in the icebox, carried to the research laboratory, and kept at -20 °C.
Morphological analysis
The collected specimens were sorted as per their morphological characters and identified based on available literature (Sakai and Tȕrkay, 2013; Shih et al., 2016). The ghost crab species were analysed morphologically by using the identification keys (Sakai and Turkay, 2013; Shih et al., 2016). Three distinguishing characters observed between the species carapace structure and stridulating ridge and gonopod structure. The carapace of O. ceratophthalmus possesses red spots and stridulating ridge also have showed different number of cirri in both species. The identified ghost crab species were placed in marked polythene bags prior to tissue extraction for isozyme electrophoresis and DNA analysis.
PAGE analysis
The frozen muscle tissue was extracted from each specimen for isozyme study (PAGE-Native), and the same specimen was used for DNA extraction for correlation and accurate molecular measurements. Approximately 200 to 500 mg of frozen muscle tissue was extracted from enlarged cheliped for the electrophoretic study. Extracted tissue was soaked in 1.00 ml Tris-Citrate buffer (pH: 8.8) and minced with the help of hand homogenizer. The homogenate was then centrifuged at 13500 rpm for 15 minutes to settle the solid tissue particles and separate the enzymes from debris. The supernatant was poured into labeled Eppendorf tubes (1.5 ml) stored at -20oC for electrophoretic analysis. Vertical slab gel electrophoresis (PAGE-Native) was used for the isozyme electrophoretic study. A discontinuous buffer system was used, and five enzymes and a general protein were examined (Naz et al., 2017; Odhano et al., 2018).
For the staining of gel, the available literature (Murphy et al., 1996) was used with few modifications. The staining revealed the banding patterns representing the enzyme loci. The banding patterns were recorded through photographs. Shaklee et al. (1990) proposed the enzyme nomenclature system. Therefore, all the banding patterns were documented and assigned the nomenclature as described by Shaklee et al. (1990). The banding pattern and zymograms are inferred according to the expected phenotypes, which follow the patterns of co-dominant inheritance (Sin and Jonesf, 1983). All the alleles were designated with English letters according to enzyme name with a number such as CD*-1, CAT-1 (Table I).
PCR amplification
The tissue sample was taken from muscles of enlarged cheliped with a scalpel form the same specimen which was used for isozyme study. About 25 mg of muscles tissue was collected and placed into a 1.5ml micro-centrifuge tube for DNA extraction. DNA was extracted through DNeasy Blood and Tissue Extraction Kit (Qiagen). All the work was performed at room temperature (15-25ºC), and the complete protocol for DNA extraction was followed by DNeasy Blood and Tissue Extraction Kit (Qiagen).
The universal primers were selected for the gene amplifications. The genes were selected for PCR amplification and sequencing from previous literature for species identification and can best describe the taxonomic diversity of crabs of the family Ocypodidae (Shih et al., 2016). A total of three short fragments of genes were selected for amplification from mitochondrial DNA. The details of genes, size of the gene fragment, primers used, and their sources are given in Table II. The extracted DNA (1µl) was poured into a 24-µl reaction volume containing 9.5 µl double-distilled/sterile water, 12.5 µl of PCR master mix (EmeraldAmp Max PCR master mix), 1µl forward primer, and 1µl reverse primer. The thermal cycle maintained at 35 cycles of denaturation at 98°C for 15 s, annealing at 50°C for 30 s, and extension at 72°C for 60 s, followed by an incubation step at 72°C for 7 min.
Table I. Enzyme nomenclature system of Alleles, and buffer systems utilized in the genetic analyses buffer: discontinuous Tris-citrate (pH 8.7) buffer system.
|
Enzyme |
Abbreviation |
Structure |
No. of loci observed |
|
Amylase |
AMY* |
Monomer |
3 |
|
Octanol dehydrogenase |
OCT* |
Dimer |
4 |
|
Peroxidase |
PXD* |
Uncertain |
3 |
|
Catalase |
CAT* |
Tetramer |
5 |
|
Carbonate dehydratase |
CD* |
Monomer |
5 |
|
Creatine kinase |
CK* |
Dimer |
5 |
|
Commassie (General protein) |
COM* |
Uncertain |
7 |
Subsequently, the 5µl of PCR product was separated in 1% TAE Agarose Gel Electrophoresis (BioRad Power Pac Basic) at 70-80V for 30 min. The gel was stained in (Syber Safe DNA Gel Stain), and bands were visualized by ultraviolet (Illuminator (Taiwan)) transilluminator. The visible bands were clear with expected length, photographs were taken for record and gel was discorded.
Sequence of PCR products
The PCR products were sequenced from School of Life Sciences (SOLS) Core Laboratories (DNA Laboratory), ASU Tempe Campus.
Isozyme data analysis
The genetic variation was estimated by observing the banding pattern difference between two species of the genus Ocypode. The POPGENE ver. 1.31 program (Yeh et al., 1999) was used for statistical analysis of genetic data for isozymes alleles. The following analysis was carried out using the banding patterns: Percentage of polymorphic loci, frequency of genotypes, frequency of alleles, Hardy-Weinberg (HW) equilibrium test, fixation
Table II. Descriptive analysis of allele frequency between two populations of O. ceratophthalmus and O. rotundata.
|
Locus |
Allele |
Allele frequency |
|
|
O. ceratophthalmus |
O. rotundata |
||
|
Amy*-1 |
A |
1.0000 |
0.5000 |
|
B |
0.5000 |
||
|
Amy*-2 |
A |
1.0000 |
1.0000 |
|
B |
|||
|
Amy*-3 |
A |
1.0000 |
1.0000 |
|
B |
|||
|
Oct*-1 |
A |
0.7000 |
0.0455 |
|
B |
0.3000 |
0.9545 |
|
|
Oct*-2 |
A |
0.3182 |
|
|
B |
1.0000 |
0.4545 |
|
|
C |
0.2273 |
||
|
Oct*-3 |
A |
0.7237 |
|
|
B |
1.0000 |
0.2727 |
|
|
Oct*-4 |
A |
1.0000 |
1.0000 |
|
B |
|||
|
Pxd*-1 |
A |
0.5000 |
0.9545 |
|
B |
0.5000 |
0.0455 |
|
|
Pxd*-2 |
A |
0.9091 |
|
|
B |
1.0000 |
0.0909 |
|
|
Pxd*-3 |
A |
0.4545 |
|
|
B |
1.0000 |
0.5455 |
|
|
Cat*-1 |
A |
0.9091 |
|
|
B |
1.0000 |
0.0909 |
|
|
Cat*-2 |
A |
1.0000 |
1.0000 |
|
B |
|||
|
Cat*-3 |
A |
0.5000 |
|
|
B |
0.5000 |
1.0000 |
|
|
Cat*-4 |
A |
1.0000 |
|
|
B |
1.0000 |
||
|
Cat*-5 |
A |
0.5000 |
|
|
B |
0.5000 |
1.0000 |
|
|
Cd*-1 |
A |
1.0000 |
|
|
B |
1.0000 |
||
|
Cd*-2 |
A |
1.0000 |
|
|
B |
1.0000 |
||
|
Cd*-3 |
A |
1.0000 |
|
|
B |
1.0000 |
||
|
Cd*-4 |
A |
1.0000 |
|
|
B |
0.5000 |
||
|
0.5000 |
|||
|
Table continued on next column....... |
|||
|
Locus |
Allele |
Allele frequency |
|
|
O. ceratophthalmus |
O. rotundata |
||
|
Cd*-5 |
A |
1.0000 |
|
|
B |
1.0000 |
||
|
Ck*-1 |
A |
1.0000 |
0.5000 |
|
B |
0.5000 |
||
|
Ck*-2 |
A |
0.5000 |
|
|
B |
1.0000 |
0.5000 |
|
|
Ck*-3 |
A |
1.0000 |
|
|
B |
1.0000 |
||
|
Ck*-4 |
A |
1.0000 |
|
|
B |
1.0000 |
||
|
Ck*-5 |
A |
0.5000 |
1.0000 |
|
B |
0.5000 |
||
|
Com*-1 |
A |
1.0000 |
0.5000 |
|
B |
0.5000 |
||
|
Com*-2 |
A |
1.0000 |
|
|
B |
1.0000 |
||
|
Com*-3 |
A |
1.0000 |
|
|
B |
1.0000 |
||
|
Com*-4 |
A |
1.0000 |
|
|
B |
1.0000 |
||
|
Com*-5 |
A |
0.8000 |
|
|
B |
0.2000 |
1.0000 |
|
|
Com*-6 |
A |
0.5000 |
1.0000 |
|
B |
0.5000 |
||
|
Com*-7 |
A |
1.0000 |
|
|
B |
1.0000 |
||
|
Percent of polymorphic loci |
21.88% |
37.50% |
|
|
Mean number of alleles per locus |
1.2188±0.4200 |
1.4062±0.5599 |
|
|
Mean Shannon information index |
0.143±0.276 |
0.211±0.319 |
|
|
Mean observed heterozygosity |
0.1875±0.3765 |
0.2301±0.4059 |
|
|
Mean expected heterozygosity |
0.1066±0.2072 |
0.1485±02192 |
|
|
Mean Nei’s (1973) expected heterozygosity |
0.1012±0.1968 |
0.1418±0.2192 |
|
|
Genetic distance between two species |
D=0.987 |
||
|
Genetic Identity between two species |
I =0.372 |
||
A list of abbreviations is given in Table I.
index (FST), number of alleles per locus, observed homozygosity, observed heterozygosity (Ho), expected heterozygosity (He) (Nei, 1973), and Shanon information index. The genetic distance D was also calculated and dendrogram was constructed using the UPGMA (unweighted pair group method with arithmetic mean) (Sneath and Sokal, 1973). The frequency of genotypes was verified through Hardy-Weinberg equilibrium, followed by Leven (1949). The chi-square test (χ2) was performed, and the percentage of polymorphic loci was calculated at each locus for each population. Those loci were selected as polymorphic, which express more than one allele, while others were designated as monomorphic at 0.95 standards whose allele’s frequency does not exceed 0.95. The expected heterozygosity of the mean was calculated at each locus through Nei (1973) randomly mating heterozygosity and Nei (1978) unbiased heterozygosity. For two species from three regions of coastal areas of Pakistan, unbiased genetic identity and genetic distance were also calculated, and with the help of Nei’s genetic distance, a dendrogram was constructed using the UPGMA. The fixation index (FST) was also calculated to observe the genetic differentiation between and within the populations (Hartl and Clark, 1997).
DNA data analysis
The chromatograms were manually read and analyzed using the software Geneious v. 7.2 (http://www.geneious.com). Forward and reverse sequences were merged using the software Geneious (Version 7.2) to obtain consensus sequences of selected genes and the annotation and trimming of 16S, 12S, and COI. The final sequences were aligned in MUSCLE using default parameters and analyzed using software MEGA v.7 (Kumar et al., 2016) to identify the evolutionary model and gene diversity within and among the species. The software MEGA is also used to translate COI sequences into amino acids to test whether the presence of frameshifts or stop codons. If frameshifts or stop codons are present, it indicates sequencing errors or pseudogenes presences; such phenomenon is widely observed in crustaceans (Buhay, 2009). The combined sequences were analyzed with the maximum likelihood (ML), maximum parsimony (MP) and bayesian inferences (BI) methods using MEGA 7, PAUP, and MrBayes, respectively. The ML and MP analysis was achieved using an ML heuristic search method, setting the parameters to the values calculated by nearest-neighbor-interchange (NNI), No. of nucleotide difference for distance and ML initial tree Default-NJ/BioNJ applied. The bootstrap analyses were evaluated in ML and MP with 2000 replications and 107 replications for Mrbayes. The best fit model was obtained from MEGA 7 and subsequently applied to all tree construction methodologies (Table V). For nucleotide divergence and genetic distance matrix, it was using Kimura 2 Model in PAUP*. These phylogenetic methods were analyzed to assess the strength of the phylogeny.
All the aligned nucleotide sequencing representing all three genes merged with the help of Sequence Matrix (version 1.8), which gave a nexus format file. The combined data set was analyzed for Bayesian analysis through Mr Bayes v. 3.2.2 (Ronquist et al., 2011). The following parameters were used in software to get the best results: The search runs with four chains for 10 million generations and four independent runs with trees sampled every 1000 generations. The adequate sample size for convergence of chains was determined with recommended >200, and the first 25% of trees were discarded after the burning (Ronquist et al., 2011). The final tree was visualized with the software FigTree v. 1.4.3, while the maximum likelihood and maximum parsimony analysis were carried out through MEGA ver. 7 (Kumar et al., 2016) and PAUP*, respectively, with 2000 bootstraps.
RESULTS
Morphological analysis
During the species identification of ghost crabs three distinguishing characters found species-specific carapace structure, gonopod shape and stridulating ridge (Figs. 1 and 2). The stridulating ridge was composed of 10-15 tubercles with striae in O. rotundata whereas in O. ceratophthamus the stridulating ride was composed of 10-11 interspaced tubercles and 20-30 closely spaced striae. The colour pattern of ghost crabs found also different. The colour pattern can also be considered as distinguishing character among both species of ghost crabs. The carapace of O. ceratophthalmus is light maroon along with maroon-coloured spots found on its posterior region. Whereas the carapace of O. rotundata is pale yellow in colour and not visible spots can be observed. Importantly, O. ceratophthalmus (Ocypodidae) exhibits rhythmic changes in color change daily such as it is brighter in color during the daytime and during nighttime it is darker, significantly increasing camouflage on sandy substrates (Castro et al., 2015).
O. ceratophthalmus
Size of the crab ranges from 2.1 to 3.5 inches carapace width (CW) (Fig. 1A). Cornea located at the base of the eyestalk; away from the cornea the eyestalks extend to form horns or stylophthalmous (stylus). The outer margins of the exorbital corner laterally focused and exorbital positions generally trilateral and extended horizontally in large specimens. Enlarged cheliped possesses
approximately 10-11 inter-spaced tubercles on dorsal side of palm, 8 thick striae in the mid of palm and 20-30 close spaced striae on ventral third to form a stridulating ridge. Minor cheliped tapering to sharp distal end. Parapodium 2 and 3 having setae on dorsal half of anterior surface, possessing only one in female and two in male middle lines of setae. Slender shaped gonopods with bearing palp (Fig. 2A). Sternite settled around operculum in the direction of genital opening, no noticeable lateral border. Carapace light maroon with shades of pale having dark, maroon-coloured spots found on the posterior region of carapace (Fig. 1A). The abdominal region is completely dark maroon. Eyes are pale with horned straight stalks dark maroon. All the five pairs of legs including both chela along with the ambulatory legs are pale yellow on their lateral sides while their ventral sides are purely dark maroon.
O. rotundata
These species are relatively bigger in size than O. ceratophthalmus (max: 4.1 inches CW) (Fig. 1B). Eyestalks prolonged distally beyond cornea in a stylus. Exorbital angles rounded. Only 10-15 tubercles with striae form stridulating ridge. Small cheliped narrower at the point of distal end. Two rows of setae on anterior surface at the centre of P2 propodus present. P3-5 porpodi smooth devoid of setae. Gonopod 1 thickened, curled sideways from distal end, with separate palp (Fig. 2B). The female genital operculum is rounded distally, leading medially in button shape. Vaginal opening focused lengthwise. Carapace is pale yellow in colour; eyes are white with light maroon eye stalk (horned eyes) (Fig. 1B). All the appendages including both chela found pale yellow in colour.
Isozyme analysis
A total of five isozymes with two general proteins using different dyes (Amido Black and Coomassie Brilliant Blue R-250) were examined for the genetic variability between two species of the genus Ocypode along the coasts of Pakistan (Sandspit, Sonari, and Sonmiani). The current study yielded 32 bands using the 10% vertical slab gel (PAGE-Native). The O. rotundata showed relatively higher percentage values of polymorphic loci 12 loci out of 32 were polymorphic (37.5%), the mean number of alleles per locus was 1.406±0.559, Shannon information index was 0.211±0.319, mean observed heterozygosity was 0.2301±0.4059, and moreover, the mean expected heterozygosity (Nei, 1973) was 0.1485±02192 when compared with O. ceratophthalmus (Table III). The overall allele frequency among all the populations of O. rotundata clarified allele B with a higher (18/32 loci) frequency as compared to allele A (14 loci). Total 20/32 loci showed a significant value (P<0.05); among them, carbonate dehydratase enzymes appeared as the most specific enzyme between two species of 5/5 loci with a
Table III. The level of genetic differentiation through Wright’s (1943) fixation index and Chi-Square test for HW-Equilibrium.
|
Locus |
Sample size |
Chi- |
P value |
Fis |
Fit |
Fst |
Nm* |
|
Amy-1 |
40 |
02.36 |
0.124 |
-1 |
-0.33 |
0.33 |
0.50 |
|
Amy-2 |
40 |
00.00 |
0.000 |
**** |
**** |
0 |
**** |
|
Amy-3 |
40 |
00.00 |
0.000 |
**** |
**** |
0 |
**** |
|
Oct-1 |
40 |
01.88 |
0.169 |
-0.36 |
0.26 |
0.46 |
0.30 |
|
Oct-2 |
40 |
02.43 |
0.487 |
-0.42 |
-0.05 |
0.26 |
0.71 |
|
Oct-3 |
40 |
08.14 |
0.000 |
0.08 |
0.61 |
0.57 |
0.19 |
|
Oct-4 |
40 |
00.00 |
0.000 |
**** |
**** |
0 |
**** |
|
Pxd-1 |
40 |
02.34 |
0.124 |
-0.86 |
-0.38 |
0.26 |
0.71 |
|
Pxd-2 |
40 |
22.05 |
0.000 |
1.00 |
1.00 |
0.83 |
0.05 |
|
Pxd-3 |
40 |
01.81 |
0.177 |
-0.83 |
-0.29 |
0.29 |
0.60 |
|
CAT-1 |
40 |
22.05 |
0.000 |
1.00 |
1.00 |
0.83 |
0.05 |
|
CAT-2 |
40 |
00.00 |
0.000 |
**** |
**** |
0 |
**** |
|
CAT-3 |
40 |
01.81 |
0.177 |
-1.00 |
-0.33 |
0.33 |
0.50 |
|
CAT-4 |
40 |
22.05 |
0.000 |
**** |
1.00 |
1.00 |
0.00 |
|
CAT-5 |
40 |
1.814 |
0.177 |
-1.00 |
-0.33 |
0.33 |
0.50 |
|
CD-1 |
40 |
22.05 |
0.000 |
**** |
1.00 |
1.00 |
0.00 |
|
CD-2 |
40 |
22.05 |
0.000 |
**** |
1.00 |
1.00 |
0.00 |
|
CD-3 |
40 |
22.05 |
0.000 |
**** |
1.00 |
1.00 |
0.00 |
|
CD-4 |
40 |
41.58 |
0.000 |
-1.00 |
0.20 |
0.60 |
0.17 |
|
CD-5 |
40 |
22.04 |
0.000 |
**** |
1.00 |
1.00 |
0.00 |
|
GP-1 |
40 |
2.365 |
0.124 |
-1.00 |
-0.33 |
0.33 |
0.50 |
|
GP-2 |
40 |
2.365 |
0.124 |
-1.00 |
-0.33 |
0.33 |
0.50 |
|
GP-3 |
40 |
22.05 |
0.000 |
**** |
1 |
1 |
0 |
|
GP-4 |
40 |
22.05 |
0.000 |
**** |
1 |
1 |
0 |
|
GP-5 |
40 |
01.81 |
0.177 |
-1.00 |
-0.33 |
0.33 |
0.50 |
|
COM-1 |
40 |
2.365 |
0.124 |
-1.00 |
-0.33 |
0.33 |
0.50 |
|
COM-2 |
40 |
22.05 |
0.000 |
**** |
1.00 |
1.00 |
0.00 |
|
COM-3 |
40 |
22.05 |
0.000 |
**** |
1.00 |
1.00 |
0.00 |
|
COM-4 |
40 |
22.05 |
0.000 |
**** |
1.00 |
1.00 |
0.00 |
|
COM-5 |
40 |
08.14 |
0.000 |
-0.25 |
0.58 |
0.67 |
0.13 |
|
COM-6 |
40 |
01.81 |
0.770 |
-1.00 |
-0.33 |
0.33 |
0.50 |
|
COM-7 |
40 |
22.05 |
0.000 |
**** |
1.00 |
1.00 |
0.00 |
|
Mean |
40 |
-0.72 |
0.47 |
0.69 |
0.11 |
* Nm = Gene flow estimated from Fst = 0.25(1 - Fst)/Fst.
significant value (P=0.00), confirming the differences between two species of the genus Ocypode deviating from Hardy-Weinberg Equilibrium. While the other isozyme also showed a partial significant difference, i.e., amylase (2/3 loci), octanol (2/4 loci), peroxidase (1/3), and catalase (3/5) loci, partially deviating the HW-equilibrium. Wright’s (1978) Fixation Index (FIS=-0.72) revealed significant intraspecific variation that may be the cause of higher gene flow among the same species (O. rotundata). The fixation index (F-Statistics) was also tested for genetic structure and gene flow among the two species O. rotundata and O. ceratophthalmus. The average FST value across all the loci was negative (FST = -0.69), whereas, in contrast the enzyme carbonate dehydratase enzyme value was positive (FST=1.00) meaning that this enzyme can be used as key isozyme for separating the species of ghost crabs. Nei’s unbiased genetic distance (D=0.99) and dendrogram revealed two selected species as genetically isolated and less similar (I=0. 37).
DNA analysis
A total of three gene (16S, 12S, and COI) short segments for two species were sequenced and aligned, including the outgroup (Table IV) from the 14 specimen and two outgroup sequences (taken from GenBank data). A monophyletic phylogenetic tree with a high value of bootstrap support (ML, MP, and BI) was observed. The phylogenetic tree revealed two clades one for ghost crabs and other outgroup. The clade belonging to ghost crabs was further divided into two subclades O. rotundata and O. ceratophthalmus, respectively (Fig. 4).
Table IV. The selected genes, fragment size, primer name, and reference used for the analysis.
|
Selected genes |
Fragment size (bp) |
Primer name |
Primer sequence 5’- 3’ |
Source of purchase |
Reference |
|
16S |
~540-550 |
16Sar-F |
CGCCTGTTTATCAAAAACAT |
IDT, USA |
Shih et al., 2016 |
|
16Sbr-R |
CCGGTCTGAACTCAGATCACGT |
||||
|
12S |
~440-450 |
12Sai-F |
AAACTAGGATTAGATACCCTATTAT |
IDT, USA |
Shih et al., 2016 |
|
12Sbi-R |
AAGAGCGACGGGCGATGTGT |
||||
|
COI |
~650-700 |
LCO1490 |
GGTCAACAAATCATAAAGATATTGG |
IDT, USA |
Folmer et al. 1994 |
|
HC02198 |
TAAACTTCAGGGTGACCAAAAAATCA |
Table V. Description of molecular markers including variable sites, best-fit models for ML, MP, and BI selected through Bayesian Information Criterion (BIC) criterion and were corrected by Akaike Information Criterion (AICc), Nucleotide content in percent, Total haplotypes observed, overall mean distance, intraspecific and interspecific distance through Kimura 2 Parameter in two species of genus Ocypode along the coast of Pakistan.
|
Molecular markers |
|||
|
16S |
12S |
COI |
|
|
Total sequences |
10 |
11 |
10 |
|
Total variable sites |
42 |
112 |
105 |
|
Informative sites |
40 |
86 |
80 |
|
Model |
TN93+G |
T92+I |
TN93+G |
|
Nucleotide contents |
|||
|
A% |
33.4 |
35.9 |
28.2 |
|
T% |
35 |
37.1 |
34.1 |
|
C% |
11.0 |
16.8 |
21.4 |
|
G% |
20.6 |
10.2 |
16.2 |
|
AT% |
68.4 |
73.94 |
62.3 |
|
GC% |
31.6 |
26.06 |
37.7 |
|
Total Haplotypes |
05 |
07 |
09 |
|
Overall distance |
10.1% |
18.2% |
16.6% |
|
Distance b/w two species |
8.6% |
1.19% |
16.2 |
|
O. ceratophthalmus |
0.3% |
0.2% |
0.5% |
|
O. rotundata |
0.2% |
1.3% |
1.8% |
|
Overall mean distance |
5.5% |
||
|
Mean distance between the two species |
9.8% |
||
|
Mean distance in O. ceratophthalmus |
0.2% |
||
|
Mean distance within O. rotundata |
0.7% |
||
TN93, Tamura-Nei; T92, Tamura 3-parameter; +G, discrete Gamma distribution; +I, Assuming that a certain fraction of sites is evolutionarily invariable.
A ~520 bp segment of the 16S rRNA gene was analysed (excluding primers) of two ghost crab species amplified and aligned together. A total of 42 variable sites found in each sample, among which 40 sites were parsimony informative sites. AT-rich content (68.4%) observed in 16S rRNA gene (A= 33.4%, T=35%, G=20.6%=, C=11.0%). For 12 rRNA gene, yield approximately 304 bp segment. A total of 112 positions were found variable, among which 86 were parsimony-informative positions. Eleven observed haplotypes from the 14 samples showed AT-rich content (73.94%). Whereas COI gene with approximately ~ 680 bp segment was analyzed, amplified, and aligned; total 105 positions found variable and 80 positions parsimony informative. Fifteen haplotypes were observed in COI sequences by using DnaSP (ver. 5). The COI segment observed with AT-rich content (62.30%) (T=34.1%, A=28.2%, G=16.2% and C=21.4%) (Table V).
The best-fitting model for sequences evolution with the lowest Bayesian Information Criterion (BIC) scores describe the best-selected substitution pattern, and each model was corrected by Akaike Information Criterion (AICc) value. The model was determined by MEGA (ver. 6), and Mr Model test (ver. 2.2) for each gene (Table V) was applied to construct a dendrogram through ML, MP, and BI analysis by using MEGA (ver. 6), PAUP*, and MrBayes, respectively. Each tree showed the same topological structure with maximum bootstrap support (> 90%). Based on four gene sequences of the genus Ocypode (O. rotundata and O. ceratophthalmus) is monophyletic with high BI, ML, and NJ support. Within this complex, two sub-clades of both species were observed with high BI, ML, and NJ support.
A relatively higher level of intra-specific divergence within the O. rotundata species was observed in 12S (13 base pair difference and 4.42% nucleotide divergence) (Table VI) and COI (20 base pair difference and 3.26% nucleotide divergence) (Table VIII). For the 16S gene, the genetic distance and divergence showed little variation among the sequences of the same species (≤2) bp difference (Table VII). Whereas interspecific nucleotide differences (12S≤76, 16S≤87, and COI≤123) bp and nucleotide divergence (12S≤32%, 16S≤19% and COI≤23%) were observed (Table VIII).
Table VI. shows the nucleotide percent pairwise divergence (K2P) matrix (lower-left) and number of base pair differences (upper right) between Ocypode species based on 12S rRNA gene between haplotypes.
|
S. |
OC1 |
OC2 |
OR1 |
OR2 |
OR3 |
OR4 |
OR5 |
AA |
AI |
AS |
|
1 |
- |
1 |
30 |
28 |
39 |
29 |
29 |
73 |
75 |
69 |
|
2 |
0.33 |
- |
31 |
29 |
40 |
30 |
30 |
73 |
75 |
69 |
|
3 |
10.71 |
11.10 |
- |
2 |
9 |
3 |
4 |
69 |
66 |
69 |
|
4 |
9.97 |
10.36 |
0.66 |
- |
11 |
1 |
2 |
67 |
64 |
67 |
|
5 |
14.33 |
14.75 |
3.03 |
3.72 |
- |
10 |
13 |
74 |
71 |
76 |
|
6 |
10.36 |
10.76 |
0.99 |
0.33 |
3.37 |
- |
3 |
66 |
63 |
66 |
|
7 |
10.34 |
10.73 |
1.33 |
0.66 |
4.42 |
0.99 |
- |
67 |
64 |
67 |
|
8 |
29.65 |
29.65 |
27.49 |
26.58 |
30.00 |
26.08 |
26.64 |
- |
21 |
45 |
|
9 |
30.67 |
30.67 |
26.03 |
25.13 |
28.47 |
24.64 |
25.18 |
7.27 |
- |
38 |
|
10 |
27.73 |
27.73 |
27.67 |
26.75 |
31.29 |
26.24 |
26.82 |
16.92 |
14.01 |
- |
OC, O. ceratophthalmus; OR, O. rotundata; AA, Au.
Table VII. Shows the nucleotide percent pairwise divergence (K2P) matrix (lower-left) and number of base pair differences (upper right) between Ocypode species based on 16S rRNA gene between haplotypes.
|
S. |
OR1 |
OR2 |
OR3 |
OC1 |
OC2 |
AA |
AI |
AS |
|
1 |
- |
2 |
1 |
38 |
40 |
77 |
76 |
79 |
|
2 |
0.39 |
- |
1 |
40 |
42 |
78 |
77 |
79 |
|
3 |
0.19 |
0.19 |
- |
39 |
41 |
77 |
76 |
79 |
|
4 |
7.70 |
8.14 |
7.92 |
- |
2 |
78 |
83 |
79 |
|
5 |
8.14 |
8.58 |
8.36 |
0.39 |
- |
78 |
83 |
79 |
|
6 |
16.62 |
16.87 |
16.62 |
16.74 |
16.74 |
- |
37 |
47 |
|
7 |
16.34 |
16.59 |
16.34 |
17.99 |
17.99 |
7.55 |
- |
49 |
|
8 |
17.17 |
17.17 |
17.17 |
17.02 |
17.02 |
9.66 |
10.12 |
- |
OC, O. ceratophthalmus; OR, O. rotundata; AA, Au.
Table VIII. shows the nucleotide percent pairwise divergence (K2P) matrix (lower-left) and number of base pair differences (upper right) between Ocypode species based on COI rRNA gene between haplotypes.
|
S. |
OR1 |
OR2 |
OR3 |
OC1 |
OC2 |
OC3 |
AA |
AI |
AS |
|
1 |
- |
20 |
19 |
93 |
91 |
92 |
123 |
122 |
121 |
|
2 |
3.26 |
- |
3 |
78 |
76 |
77 |
114 |
113 |
110 |
|
3 |
3.09 |
0.48 |
- |
79 |
77 |
78 |
114 |
111 |
110 |
|
4 |
16.75 |
13.84 |
14.03 |
- |
4 |
3 |
107 |
102 |
111 |
|
5 |
16.33 |
13.44 |
13.62 |
0.64 |
- |
3 |
106 |
100 |
109 |
|
6 |
16.56 |
13.65 |
13.84 |
0.48 |
0.48 |
- |
107 |
101 |
111 |
|
7 |
22.91 |
21.01 |
20.99 |
19.53 |
19.32 |
19.52 |
- |
82 |
68 |
|
8 |
22.59 |
20.69 |
20.27 |
18.51 |
18.09 |
18.28 |
14.59 |
- |
82 |
|
9 |
22.53 |
20.20 |
20.19 |
20.46 |
20.02 |
20.44 |
11.95 |
14.58 |
- |
OC, O. ceratophthalmus; OR, O. rotundata; AA, Au.
The combined data set created comprised of total 1994 bp (characters). The alignment comprised 1069 conserved sites and 246 total variable sites; 186 positions were parsimony informative. The alignment showed AT-rich contents (in average: A=28.8%, T=28.9%, G=21.8%, C=20.5%). A phylogenetic tree for the combined data set is shown (Fig. 5) with supported values of ML, MP, and BI analyses besides the nodes. The results show that both species formed a well-supported and distinct clade at the species level.
For nucleotide divergence, both species of ghost crabs showed genetically distinct nucleotide divergence of (5.5%). Although, intra-specific variation has been observed higher at a certain degree in O. rotundata species (6.68%) and 0.64% observed in O. ceratophthalmus. The mean distance within the same species was (0.2%, 0.7%) in O. ceratophthalmus and O. rotundata, respectively. The highest interspecific nucleotide divergence was 16.66%, while the mean distance between the species was (9.8%) Table V.
DISCUSSION
Morphological analysis
The species identification of ghost crabs always remained confusing during the morphological analysis (Sakai and Turkay, 2013; Shih et al., 2016). Total two species were identified through morphological analysis. Although few characters are considered as distinguishing features among the species of ghost crabs such as stridulating ride, carapace structure, body colour and gonopod shape in males. Tirmizi and Ghani (1996) reported these two species from the Pakistani coastal waters. Whereas Yousuf et al. (2007) described the four species of ghost crabs from the Sonmiani Bay. Sakai and Turkay (2013) denied the possible presence of reported species as they were reported from other parts of world. Therefore, the current study was planned on the basis of Isozyme electrophoresis and DNA analysis for the confirmation and identification of ghost crab species from Pakistani coastal waters.
Isozyme analysis
The genetic variation of two species of the genus Ocypode along the sandspit coastal area is measured at the species level. We found lower genetic variation (0.101 and 0.141) in O. ceratophthalmus and O. rotundata. Similar results can also be observed from the previous studies on the family Ocypodidae, such as U. arcuta (0.232) (Huang and Shih, 1995); U. rosea (0.071), U. forciptata (0.025), U. vocans (0.023), U. triangularis (0.031), and Uca lactea (0.111) (Suzawa et al., 1993); U. musica (0.097); U. princeps (0.028); U. speciosa (0.031) and U. spinicarpa (0.029) likewise, other group means of decapods (0.07) (Hedgecock et al., 1982) and other crustacean species such as coconut crab (0.018); Penaeid shrimps (0.006-0.03) (Lavery and Fielder 1993; Mulley and Latter, 1980); Norway lobsters (0.180 –0.187) (Stamatis et al., 2006); Portunid crabs (0.015 –0.0225) (Saher et al., 2016) and invertebrates (0.110) (Nevo, 1978). This value of genetic variation can cause abundant gene flow or by randomly matting individuals within the site (Huang and Shih, 1995; Wright, 1946, 1978). The intra-specific genetic diversity was analysed by polymorphism, the average allele frequency, an adequate number of alleles, and average expected heterozygosity (He). Observed heterozygosity (Ho) calculated directly from observed genotype frequencies resulted from all the species Ho is higher than expected heterozygosity (He) (0.187 and 0.230) in O. ceratophthalmus and O. rotundata, respectively. These results show that observed heterozygosity and expected heterozygosity are not equal; that statement qualifies that these two species are not in HW equilibrium. The observed heterozygosity (Ho) is less valuable for the genetic diversity comparison because it is affected by many environmental factors such as (genetic drift, mutation, gene flow, and natural selection) which may violate the HWE assumptions (Berg and Hamrick, 1997).
The mean number of alleles per locus was relatively higher in O. rotundata (1.41±0.56) than in O. ceratophthalmus (1.22±0.42). For each species diversity, allele frequency and heterozygosity can significantly influence the number of alleles per locus; if the frequency and heterozygosity is a higher number of alleles per locus, it can be informative for establishing the collective strategy to measure the diversity.
The fixation index was analysed to observe the proportional differentiation from HW-Equilibrium (Berg and Hamrick, 1997). The fixation index value (Table V) indicates how much two species are isolated from each other with a more significant difference in allele frequency that they do not share any allele or breed and are completely isolated from one another. The expected heterozygosity 2pq symbolized with He can be compared with Ho, which denotes the proportion of heterozygotes in a population. If expected heterozygosity and observed frequency are not equal (He ≠ Ho), then the population is not in the HW equilibrium, which can be further measured by fixation index (FST). Therefore, the current study showed that He and Ho are not equal other than data further analyzed with fixation index. The current study shows that the level of genetic differentiation value between both species of ghost crabs using multiple enzyme systems is very high, FST = 0.69 (69%), this is higher than the previous studies of the crab species, i.e., U. arcuata (8.5%) (Huang and Shih, 1995); horseshoe crab (Limulus, 7.6%) and Drophilla equinoxialis (10.9%) (Nei, 1975).
DNA analysis
The current study represents the multi-locus phylogeny of ghost crabs from the genus Ocypode. Yousuf et al. (2007) surveyed various coasts of Pakistan to describe the taxonomic structure of ghost crabs. They described a total of four species of ghost crabs (O. rotundata, O. ceratophthalmus, O. macleayana, and O. guadichaudi), but after detailed morphological taxonomy provided by Sakai and Turkay (2013) arguing that Yousuf et al. (2007) has described the pictures of same species with different names meaning that they only reported one species O. rotundata. Hashmi (1962, 1963, 1968) and Tirmizi and Kazmi (1986) first recorded the O. rotundata and O. ceratophthalmus from the Manora island and sandspit beach. After this, no valuable attention has been paid to this genus. The current study is based on a re-description of two species, O. rotundata and O. ceratophthalmus, along the coast of Karachi in detail. During the current study, O. rotundata and O. ceratophthalmus were recorded from two localities of Karachi (Sandspit and Sonari). Both species showed a sympatric relationship, but O. ceratophthalmus remains much lower in abundance comparatively. A relatively higher level of intra-specific divergence within the O. rotundata species suggests that there might be a promising gene flow within this species just because it is widely distributed across the coastal belt of Sandspit.
The phylogenetic analysis with three different methodologies showed that both species of ghost crabs could be well differentiated at the species level yielding only one monophyletic clade with two species of ghost crabs. The inter-specific mean divergence had at least (16S=8.6%, 12S=1.19%, and COI=16.2%) between O. ceratophthalmus and O. rotundata, which can be considered adequate for inter-specific taxonomic identification. These results can be followed by other previous studies on inter-specific species identification among the species of crabs belonging to the family Ocypodidae and concluded an even lower percentage of differences to be valid such as 2.79% between Uca splendida and U. cressipes (Shih et al., 2012), 5.32% between Uca jocelynae and U. neocultrimana (Shih et al., 2010). Even other brachyuran crabs showed a lower percentage of divergences, such as 3.5% between species belonging to the family Galatheidae (Macpherson and Machordom, 2005), 3.62% between Mictyris guinotae and M. brevidactylus (Davie et al., 2010), 4.43% between Scopimera ryukyuensis and S. globose (Wong et al., 2010) and 4.74% between Helice tridens and H. latimera clade (Shih and Suzuki, 2008). Burton and Davie (2007) suggested that at least 2% divergence is sufficient between two lobster species, subsequently supported by allozyme electrophoresis.
Although, intra-specific variation has been observed higher at a certain degree in O. rotundata species (12S=1.3%, and COI=1.8%) which needs further analysis by comparing other populations of the same species. Yeo et al. (2008) suggested that the difference between two species, at least ~1% bp in 16S rRNA, can be considered a significant difference between closely related species. If this criterion is considered within O. rotundata species, the relationship in phylogenetic tree species does not support because the current study shows only a 0.2% bp difference, which does not support distinguishing any hidden species. However, COI is considered more variable than 16S rRNA (Schubart et al., 1998; Shih and Suzuki, 2008).
CONCLUSION
The current study concludes that there are only two species of ghost crabs O. ceratophthamus and O. rotundata from Pakistani coastal waters. During present study no other species were recorded from the Pakistani coastal waters. The genetic differentiation (69%) and Nei’s genetic distance (D=0.98) between two species are very high, and both species can easily be distinguished from each other morphologically by size, color, and stridulating ridge. Besides this, intraspecific variations were relatively higher within the O. rotundata species. Such patter was also observed through DNA analysis in which the current study revealed the average divergence ratio within the O. rotundata species was 1.8% which is at the borderline to distinguish the species. More study is needed to analyze the O. rotundata different locations to resolve such higher intraspecific variation.
ACKNOWLEDGEMENT
The current study has been completed with the support from Higher Education Commission Pakistan through International support initiative program (IRSIP) and School of Life Sciences (SOLS), Arizona State University, Arizona, USA is highly acknowledged. Current study was completed in two phases: Phase-1: Sample Collection, Tissue extraction for isozyme and DNA extraction for PCR amplification was carried out at the Center of Excellence in Marine Biology, University of Karachi, Pakistan, and Phase-2: All the work of PCR amplification and gene sequencing and data analysis was carried at SOLS laboratories with special thanks to Scott Bingham (Manager DNA laboratories).
Funding
Current research is part of my Ph.D research and it does not have any particular funding besides this the Center of Excellence in Marine Biology, University of Karachi is highly acknowledged for supporting and providing the facilities for the current research.
Statement of conflict of interest
The authors have declared no conflict of interest.
References
Aly, In., Abdel-sattar, M.A., Abdel-salam, K.A., Khalil, M.S., Verreet, J.A., Albrechts, C., and Phytopathologie, I., 2003. Comparison of multi-locus enzyme and protein gel electrophoresis in the discrimination of five Fusarium species isolated from Egyptian cottons. Afr. J. Biotechnol., 2: 206-210. https://doi.org/10.5897/AJB2003.000-1043
Barass, R., 1963. The burrows of Ocypode ceratophthalmus (Pallus) (Crustacea, Ocypodidae) on a tidal wave beach at Inhaca Island, Mozambique. J. Anim. Ecol., 32: 73-85. https://doi.org/10.2307/2518
Berg, E.E., and Hamrick, J.L., 1997. Quantification of genetic diversity at allozyme loci. Can. J. For. Res., 27: 415–424. https://doi.org/10.1139/x96-195
Buhay, J.E., 2009. “COI-like” sequences are becoming problematic in molecular systematic and DNA barcoding studies. J. Crust. Biol., 29: 96-110.
Burton, T.E. and Davie, P.J.F., 2007. A revision of the shovel-nosed lobsters of the genus Thenus (Crustacea: Decapoda: Scyllaridae), with descriptions of three new species. Zootaxa, 1429: 1-38.
Castro, P., Davie, P., Guinot, D., Schram, F., and Klein, C.V.V., 2015. Treatise on zoology, anatomy, taxonomy, biology. Crustacea, 9C: Brill, vi, 1, 221. https://doi.org/10.1163/9789004190832_002
Crane, J., 2015. Fiddler crabs of the world: Ocypodidae: Genus Uca. Princeton University Press. 1276. https://doi.org/10.1515/9781400867936
Dahl, E., 1952. Some aspects of the ecology and zonation of the fauna on sandy beaches. Oikos, 4: 1-27. https://doi.org/10.2307/3565072
Davie, P.J., Shih, H.T. and Chan, B.K., 2010. A new species of Mictyris (Decapoda, Brachyura, Mictyridae) from the Ryukyu Islands, Japan. In: Studies on Brachyura: a homage to Danièle Guinot. Brill, pp. 83-106. https://doi.org/10.1163/ej.9789004170865.i-366.61
Hartl, D., and Clark, A., 1997. Principles of population genetics. 3rd edn. Sinauer Associates, Inc. Sunderland, MA.
Hashmi, S.S., 1962. Crab fishery in Pakistan. Agric. Pak., 14: 93–99.
Hashmi, S.S. 1963. Carcinological fauna of Karachi. Agric. Pak., 14: 237– 243.
Hashmi, S.S., 1968. Study on larvae of (Gelasimus) (Ocypodidae) reared in the laboratory (Decapoda, Crustacea). Pak. J. scient. Res., 20: 50–56.
Hedgecock, D., Tracey, M.L. and Nelson, K., 1982. Genetics: In: The biology of crustacea, Vol. 2. Embryology, morphology, and genetics (ed. L.G. Abele). New York: Academic Press, pp. 283-403.
Huang, S., and, and Shih, J.T., 1995. Microgeographic genetic structure of the fidller crab, Uca arcuata De Haan (Ocypodidae) in Taiwan. Hydrobiology, 295: 67–74. https://doi.org/10.1007/BF00029112
Kumar, S., Stecher, G., and Tamura, K., 2016. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol., 33: 1870-1874. https://doi.org/10.1093/molbev/msw054
Lavery, S., and Fielder, D.R., 1993. Low enzyme variation in the coconut crab Birguslatro. Comp. Biochem. Physiol., 2: 353–359. https://doi.org/10.1016/0305-0491(93)90379-J
Lavery, S., and Shaklee, J.B., 1991. Genetic evidence for separation of two sharks, Carcharhinus limbatus and C. tilstoni, from Northern Australia. Mar. Biol., 108: 1–4. https://doi.org/10.1007/BF01313464
Levene, H., 1949. On a matching problem arising in genetics. Annls Math. Statist., 20: 91–94. https://doi.org/10.1214/aoms/1177730093
Macpherson, E. and Machordom, A., 2005. Use of morphological and molecular data to identify three new sibling species of the genus Munida Leach, 1820 (Crustacea, Decapoda, Galatheidae) from New Caledonia. J. Nat. Hist., 39: 819-834.
Mulley, J.C., and Latter, B.D.H., 1980. Genetic variation and evolutionary relationships within a group of thirteen species of penaeid prawns. Evolution, 34: 904–916. https://doi.org/10.1111/j.1558-5646.1980.tb04028.x
Murphy, R.W., Sites, J.W., Buth, D.G., and Haufler, C.H., 1996. Proteins: Isozyme electrophoresis. In: Molecular systematics (eds. D.M. Hillis, C. Moritz and B.K. Mable). Sinauer Associates, Sunderland, MA. pp. 51–120.
Naz, F., Saher, N.U., and Kamal, M., 2017. Isozyme variations in the genus Thalamita of family portunidae from the coastal waters of Pakistan. J. Aquacult. Mar. Biol., 6: 00147. https://doi.org/10.15406/jamb.2017.06.00147
Nei, M., 1973. Analysis of gene diversity in subdivided populations. Proc. natl. Acad. Sci. USA., 70: 3321–3323. https://doi.org/10.1073/pnas.70.12.3321
Nei, M., 1978. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics, 89: 583-590.
Nevo, E., 1978. Genetic variation in natural populations: Patterns and theory. Theoret. Popul. Biol., 13: 121–177. https://doi.org/10.1016/0040-5809(78)90039-4
Odhano, S., Saher, N.U., and Kamal, M., 2018. Studies on isozyme variations and morphometric relationship among three populations of Austruca sindensis (Alcock 1900) from Pakistan. Thalassas Int. J. mar. Sci., 34: 311-322. https://doi.org/10.1007/s41208-018-0066-1
Parker, L.E., Bolen, E., and Baker, R., 1981. Genetic variation in a winter population of Mallard ducks. Southw. Natl., 26: 425–428. https://doi.org/10.2307/3671086
Ronquist, F., Huelsenbeck, J., and Teslenko, M., 2011. Draft MrBayes version 3.2 manual: Tutorials and model summaries. Distributed with the software from http://brahms.biology.rochester.edu/software.html.
Rosenberg, M.S., 2001. The systematics and taxonomy of fiddler crabs: A phylogeny of the genus Uca. J. Crust. Biol., 21: 839-869. https://doi.org/10.1163/20021975-99990176
Rosenberg, J., and Langer, H., 2001. Ultrastructural changes of rhabdoms of the eyes of Ocypode species in relation to different regimes of light and dark adaptation. J. Crust. Biol., 21: 345–353. https://doi.org/10.1163/20021975-99990134
Rosenberg, M.S., 2002. Fiddler crab claw shape variation: A geometric morphometric analysis across the genus Uca (Crustacea: Brachyura: Ocypodidae). Biol. J. Linn. Soc., 75: 147–162. https://doi.org/10.1111/j.1095-8312.2002.tb01419.x
Rosenberg, M.S., 2014. Contextual cross-referencing of species names for fiddler crabs (Genus Uca): An experiment in cyber-taxonomy. PLoS One, 9: e101704. https://doi.org/10.1371/journal.pone.0101704
Saher, N.U., 2008. Population dynamics and biology of fiddler crab in the mangroves area of Karachi coast. PhD thesis, University of Karachi, Karachi, Pakistan.
Saher, N.U., Naz, F., Siddiqa, S.M., and Kamal, M., 2016. Variation of carbonic anhydrase (ca) isozyme in muscles of five species of portunid crabs found in coastal waters of Pakistan. Int. J. Biol. Biotechnol., 13: 335–340.
Sakai, K., and Türkay, M., 2013. Revision of the genus Ocypode with the description of a new genus, Hoplocypode (Crustacea: Decapoda: Brachyura). Mem. Queensl. Museum., 56: 665–793.
Shaklee, J.B., Allendorf, F.W., Morizot, D.C. and Whitt, G.S., 1990. Gene nomenclature for protein-coding loci in fish. Trans. Am. Fish. Soc., 119: 2-15.
Schubart, C.D., Reimer, J., and Diesel, R., 1998. Morphological and molecular evidence for a new endemic freshwater crab, Sesarma ayatum sp. n., (Grapsidae, Sesarminae) from eastern Jamaica. Zool. Scr., 27: 373–380. https://doi.org/10.1111/j.1463-6409.1998.tb00468.x
Shaklee, J.B., Klaybor, D.C., Young, S., and White, B.A., 1991. Genetic stock structure of odd-year pink salmon, Oncorhynchus gorbuscha (Walbaum), from Washington and British Columbia and potential mixed-stock fisheries applications. J. Fish Biol., 39: 21-34. https://doi.org/10.1111/j.1095-8649.1991.tb05064.x
Shih, H.T. and Suzuki, H., 2008. Taxonomy, phylogeny, and biogeography of the endemic mudflat crab Helicel Chasmagnathus complex (Crustacea: Brachyura: Varunidae) from East Asia. Zool. Stud.-Taipei., 47: 114.
Shih, H.T., Naruse, T., and Ng, P.K., 2010. Uca jocelynae sp. nov., a new species of fiddler crab (Crustacea: Brachyura: Ocypodidae) from the Western Pacific. Zootaxa, 62: 47–62. https://doi.org/10.11646/zootaxa.2337.1.4
Shih, H.T., Ng, P.K.L., Davie, P.J.F., Schubart, C.D., Türkay, M., Naderloo, R., and Jones, D., 2016. Systematics of the family Ocypodidae Rafinesque, 1815 (Crustacea: Brachyura), based on phylogenetic relationships, with a reorganization of subfamily rankings and a review of the taxonomic status of Uca Leach, 1814, Sensu lato and its subgenera. Raffles Bull. Zool., 64: 139-175.
Shih, H., Kamrani, E., Davie, P.J.F., and Liu, M., 2009. Genetic evidence for the recognition of two fiddler crabs, Uca iranica and U. albimana (Crustacea: Brachyura: Ocypodidae), from the northwestern Indian Ocean, with notes on the U. lactea species complex. Hydrobiologia, 635: 373–382. https://doi.org/10.1007/s10750-009-9930-6
Sin, F.Y.T., and Jonesf, M.B., 1983. Enzyme variation in marine and estuarine populations of a mud crab, Macrophthalmus hirtipes (Ocypodidae). N. Z. J. Mar. Freshw. Res., 17: 367–372. https://doi.org/10.1080/00288330.1983.9516012
Sneath, P.H.A., and Sokal, R.R., 1973. Numerical taxonomy: The principle and practice of numerical classification. W.F. freeman and Co, San Francisco. pp. 573.
Snider, R.D., 1973. Electrophoresis and the taxonomy of phytopathogenic fungi. Bulletin of the Torrey Botanical Club, pp. 272-276. https://doi.org/10.2307/2484503
Stamatis, C., Triantafyllidis, A., Moutou, K.A., and Mamuris, Z., 2006. Allozymic variation in Northeast Atlantic and Mediterranean populations of Norway lobster, Nephrops norvegicus. ICES J. mar. Sci., 63: 875–882. https://doi.org/10.1016/j.icesjms.2006.01.006
Strachan, P.H., Smith, R.C., Hamilton, D.A.B., Taylor, A.C., and Atkinson, R.J.A., 1999. Studies on the ecology and behaviour of the ghost crab, Ocypode cursor (L.) in northern Cyprus. Sci. Mar., 63: 51-60. https://doi.org/10.3989/scimar.1999.63n151
Sturmbauer, C., Levinton, J.S., and Christy, J., 1996. Molecular phylogeny analysis of fiddler crabs: test of the hypothesis of increasing behavioral complexity in evolution. Proc. natl. Acad. Sci. U.S.A., 93: 10855–10857. https://doi.org/10.1073/pnas.93.20.10855
Suzawa, Y., Yong, H.S., and Murai, M., 1993. Genetic differentiation of Malaysian fiddler crabs (Genus Uca). Comp. Biochem. Physiol., 105: 529-533. https://doi.org/10.1016/0305-0491(93)90084-I
Thorpe, J.P., Solé-Cava, A.M., and Watts, P.C., 2000. Exploited marine invertebrates: genetics and fisheries. Mar. Genet., 144: 165-184. https://doi.org/10.1007/978-94-017-2184-4_16
Tirmizi, N.M., and Kazmi, Q.B., 1986. Marine fauna of Pakistan. 4. Crustacea: Brachyura (Dromaicea, Archaeobrachyura, Ocysomata, Ocyrhyncha). University Grants Commission, University of Karachi, Pakistan.
Tirmizi, N.M. and Ghani, N., 1996. Marine fauna of Pakistan: 5. Crustacea: Brachyura (Brachyrhyncha part 1 (Xanthidae, Goneplacidae, Pinnotheridae, Ocypodidae, Grapsidae). University Grants Commission, University of Karachi, Pakistan.
Harris, H. and Hopkins, D.A., 1976. Handbook of enzyme electrophoresis in human genetics. New York: American Elsevier Publishing Company.
Vecchioni, L., Marrone, F., Deidun, A., Adepo-Gourene, B., Froglia, C., Sciberras, A., and Arculeo, M., 2019. DNA taxonomy confirms the identity of the widely-disjunct mediterranean and atlantic populations of the tufted ghost crab Ocypode cursor (Crustacea: Decapoda: Ocypodidae). Zool. Sci., 36: 322-329. https://doi.org/10.2108/zs180191
Weber, F., 1795. Nomenclator entomologicus secundum Entomologiam Systematicam ill. Fabricii adjectis speciebus recens detectis et varietatibus. C.E. Bohn, Kiel & Hamburg.
Weber, P.J., Weber, G., and Eckerskorn, C., 2003. Isolation of organelles and prefractionation of protein extracts using free-flow electrophoresis. Curr. Prot. Prot. Sci., 32: 22-25. https://doi.org/10.1002/0471140864.ps2205s32
Wong, K.J., Chan, B.K. and Shih, H.T., 2010. Taxonomy of the sand bubbler crabs Scopimera globosa De Haan, 1835, and S. tuberculata Stimpson, 1858 (Crustacea: Decapoda: Dotillidae) in East Asia, with description of a new species from the Ryukyus, Japan. Zootaxa, 2345: 43-59.
Wright, S., 1946. Isolation by distance under diverse mating systems. Genetics, 31: 39–59. https://doi.org/10.1093/genetics/31.1.39
Wright, S., 1978. Evolution and the genetics of populations, variability within and among natural populations. University of Chicago Press, pp. 4.
Yeh, F., Rong-cai, Y., Boyle, T., and Freeware, M.W. 1999. Popgene version 1.31. University of Alberta and Centre for International Forestry Research. Edmonton, Alto, (August), pp. 1–29.
Yeo, D.C.J., Ng, P.K.L., Cumberlidge, N., Magalhães, C., Daniels, S.R., and Campos, M.R., 2007. Global diversity of crabs (Crustacea: Decapoda: Brachyura) in freshwater. In: Freshwater animal diversity assessment (eds. E.V. Balian, C. Lévêque, H. Segers and K. Martens). Dev. Hydrobiol. Springer, Dordrecht, 198: 275-286. https://doi.org/10.1007/978-1-4020-8259-7_30
Yeo, D.C.J., Ng, P.K.L., Daniels, S.R., and Campos, M.R., 2008. Global diversity of crabs (Crustacea: Decapoda: Brachyura) in freshwater. In: Freshwater animal diversity assessment (eds. E.V. Balian and H.S.K.M. Lévêque). Hydrobiologia, pp. 275–286. https://doi.org/10.1007/978-1-4020-8259-7_30
Yousuf, F., Ali, F., and Kazmi, Q.B., 2007. Some ghost crabs of the genus Ocypode (Decapoda: Brachyura: Ocypodidae) from Pakistan’s Waters (Northern Arabian Sea). J. Zool., 31: 107–112.