Occurrence of Borrelia burgdorferi Sensu Lato in Ticks on Camels, along with Risk Factors Analysis in Punjab, Pakistan
Nadeem Raza1, Aneela Zameer Durrani1, Muhammad Hassan Saleem1,
Ali Ahmed Sheikh2, Muhammad Usman1*, Quratulain Mujahid3,
Muhammad Zahid Iqbal1, Muhammad Rizwan4 and Muhammad Husnain Ali Alvi1
1Department of Veterinary Medicine, University of Veterinary and Animal Sciences, Lahore
2Institute of Microbiology, University of Veterinary and Animal Sciences, Lahore
3Department of Pathology, University of Veterinary and Animal Sciences, Lahore
4Department of Veterinary Surgery and Pet Sciences, University of Veterinary and Animal Sciences, Lahore
ABSTRACT
Lyme borreliosis is multisystemic disease caused by Borrelia burgdorferi spirochete, which is tick-borne zoonotic disease of animals and human. It has worldwide circulation including Pakistan. The current study was designed to detect, the B. burgdorferi sensu lato in ticks on camels. Two hundred ticks collected (Bhakkar=100, Bahawalpur=100) from camel in Punjab were examined for potential risk factors, morphological identification, and molecular characterization by using polymerase chain reaction targeting 16S rRNA gene and phylogenetic analysis. Hyalomma dromedarii and Rhipicephalus were found to be 76% (152/200) and 24% (48/200), respectively. Molecular study showed the 10.5% (21/200) prevalence of B. burgdorferi sensu lato in ticks. Phylogeny showed that our isolates branched with isolates from tick (USA) and camel blood (China) with >80% bootstrap consensus. Risk factors examination showed that season, tick infestation and gender are highly significantly (p < 0.05) connected with the presence of B. burgdorferi sensu lato in ticks from camels during field study.
Article Information
Received 17 August 2021
Revised 21 November 2021
Accepted 07 December 2021
Available online 09 September 2023
(early access)
Published 16 January 2025
Authors’ Contribution
NR and AZD concieved the idea and conducted reseach. MHS, AAS, MU, QM, MZI, MR and MHA helped in
manusript writing.
Key words
Ticks, Borrelia burgdorferi, Lyme borreliosis, Hyalomma dromedarii, Rhipicephalus
DOI: https://dx.doi.org/10.17582/journal.pjz/20210817090806
* Corresponding author: [email protected]
0030-9923/2025/0001-0497 $ 9.00/00
Copyright 2025 by the authors. Licensee Zoological Society of Pakistan.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
The dromedary camels are commonly prevalent in desert and semi desert area in Asia and North Africa (Ali et al., 2019). Population of camel all over the world is about 30 million (Zhu et al., 2019), and about 1.2 million camels in Pakistan (Pasha et al., 2013). Lyme borreliosis is recognize as a significant emerging tick-borne disease and is considered as plague of the 21st century. Lyme borreliosis is caused by various species of the B. burgdorferi sensu lato complex including Borrelia afzelii, B. bavariensis, B. garinii and B. spielmanii in Europe while it is caused by Borrelia burgdorferi sensu stricto in America (Perveen et al., 2021). This spirochete is transferred from ticks to camel, horse, human, and dog (Bhide et al., 2004; Torina et al., 2020).
Pakistan, being a semi-arid country, has a variety of different ticks. In camels, many hard ticks belonging to genera Ixodes have been reported including Rhipicephalus,
Argas, Amblyomma, Hyalomma, Ornithodoros and Dermacentor. B. burgdorferi has been reported in ticks in many neighboring states including China, India, Iran and in United Arab Emirates (Tigani-Asil et al., 2021; Zhai et al., 2018; Kshirsagar and Ingale, 2014). Abundance of ticks, arid climate, maximum movement of camel and other animals between neighboring countries make the area vulnerable to transboundary tick-borne diseases like Lyme borreliosis. These diseases cause huge production and economic losses by compromising health of affected camels. Lyme borreliosis is one such tick-borne disease, which is neglected in Pakistan.
There is a lack of data on presence of B. burgdorferi sensu lato from ticks in Pakistan. Camel and ticks have a potential to transmit this pathogen to human population as well as other animals in Pakistan. In this background, the current study was planned to detect the B. burgdorferi sensu lato in ticks on camels in Punjab, Pakistan.
Materials and methods
The current study was conducted in two districts (Bhakkar and Bahawalpur) of Punjab, Pakistan. District Bhakkar, district has four tehsils, Darya khan, Kaloorkot, Mankera and Bhakkar. Two hundred ticks were collected, 100 from Bhakkar and 100 from Bahawalpur) from camel by using forceps and stored in absolute ethanol. Ticks were identified by standard key (Taylor et al., 2013; Alanazi et el., 2020) The study was conducted as per guidelines of Ethical Committee, University of Veterinary and Animal Sciences, Lahore, Punjab, Pakistan (wide letter NO. 894, dated, 22-08-2017).
Ticks were homogenized in phosphate buffered solution (200μl) with micro pestle. Then homogenate was passed through a needle (27 guage) attached to 1ml syringe. Then DNA was extracted by using commercial QIAamp DNeasy Blood and tissue kit (QIAGEN, Maryland, and USA) from each homogenate.
The conserved 16s RNA gene was amplified using the following primers Forward 5′ AATAGGTTCTAATAATAGCCTTAATAGC 3′, and Reverse 5′ CTAGTGTTTTGCCATCTTCTTTGAAA 3′ (Zhai et al., 2018). Amplirun Borrelia burgdorferi DNA® control for optimization of assay was used (catalogues number MB076). The 30 μl PCR reaction mixture comprised forward Primer 3 μl, reverse primers 3 μl, 2X Master Mix (Thermo Scientific®) 15 μl, DNA sample 1.5 μl and then 7.5 μl water. The thermal cycle: Initial temperature 95 oC for 3 min followed by 32 cycles, each of denaturation at 95 oC for 3 seconds, annealing at 56 oC for 30 min, extension at 72 oC for 1 min, final extension at 72 oC for 15 min.
The PCR product was sequenced by Applied Biological Sciences. The DNA sequencings were compared with B. burgdorferi reference sequences through NCBI BLAST. BioEdit software were using for sequences alignment. In alignment, if sequences were similar then one of these sequences for phylogeny was processed. The phylogenetic tree was constructed with the already B. burgdorferi strains reported on GenBank NCBI by using MEGA6 software.
The qualitative data related to risk factors generated in the study was assessed using Chi Square test and odds ratio was calculated with IBM SPSS software version 20.
Results and discussion
The overall positive percentage of this pathogen was 10.5% in tick samples (21/200). In Bhakkar 7% (7/100) ticks while in Bahawalpur 14% (14/100) were found positive for B. burgdorferi. Many other scientists investigated presence of B. burgdorferi in Hyalomma, Rhipicephalus and Ixodes on camels (Adham et al., 2010; Elhelw et al., 2014; Alanazi et al., 2020; Perveen et al., 2021) and reported its prevalence from 1.8% to as high as 24% (Sarih et al., 2004; Said et al., 2016; Blazejak et al., 2018; Tigani-Asil et al., 2021; Michalski et al., 2021). The reason for this varied prevalence lies in the area of sampling. Grochowska et al. (2020) showed that infection with B. burgdorferi has higher rate of incidence in subtropical zones in hard ticks. Since Pakistan also occurs in subtropical region the prevalence of B. burgdorferi was found higher in ticks on camels.
Table I shows the potential risk factors analyzed during field study for the detection of B. burgdoferi sensu lato in ticks on camels. Adult ticks were 4.89 time more positive for B. burgdorferi sensu lato than nymphal stage of ticks. Out of thirty-five nymphs, only one nymph (2.85%) was found positive for B. burgdorferi sensu lato from camel while out of one hundred and sixty-five adult ticks, 12.12% (20/165) were found positive. This finding of current study coincides with that of Fatma et al. (2010). Positivity ratio in nymphs was low due to less sucking of blood from host at this stage. Adult ticks showed high detection rate for B. burgdorferi sensu lato because they suck more blood than nymph. Out of 270 camels from Bhakkar, 66.67% (180/270) camels while 135 camels from Bahawalpur, 91.11% (123/135) camels were infested. Out of 151 female ticks, 13.25% (20/151) ticks were positive for B. burgdorferi sensu lato from camels while out of 49 male ticks, only one tick was positive. This outcome of our study is in line with Kshirsagar and Ingale (2014).
Table I. Risk factors analysis during field study in ticks.
|
Risk factors |
Total |
Positive |
OD |
P value |
|
Male |
49 |
1(2.04%) |
---- |
0.03 |
|
Female |
151 |
20(13.25% |
7.328 |
|
|
Hyalomma |
146 |
19(13.01%) |
3.89 |
0.07 |
|
Rhipicephalus |
54 |
2(3.70%) |
---- |
|
|
Nymph |
35 |
1(2.85%) |
---- |
0.0776 |
|
Adult |
165 |
20(12.12%) |
4.89 |
|
|
Summer |
77 |
3(3.90%) |
---- |
0.04 -- |
|
Spring |
43 |
5(11.635) |
2.959 |
|
|
Fall |
80 |
13(16.25%) |
3.541 |
|
|
Infestation |
infested |
<0.0001 |
||
|
Bhakkar |
270 |
180(66.67%) |
---- |
|
|
Bahawalpur |
135 |
123(91.11%) |
5.125 |
Out of 146 Hyalomma, 13.01% (19/146) were positive for B. burgdorferi sensu lato from camels while out of 54 Rhipicephalus, only two ticks were positive for B. burgdorferi sensu lato. Presence of B. burgdorferi sensu lato was significantly (p < 0.04) associated among different season. 3.90% (3/77) ticks were found positive for B. burgdorferi sensu lato in summer, 11.635% (5/43) in spring, while 16.25% (13/80) in fall season. These findings of the current study agreed by Roome et al. (2018) who found that, higher prevalence of B. burgdorferi in ticks in spring than in summer.
These isolates already described sequences on the NCBI-GenBank database. The data on IDs showed that accession number, country of origin and source of sample. Our sequences alignment based on their representation from ticks on camel. The isolated sequences from the ticks were 100% similar. Therefore, one sequence was included to measure the phylogeny of B. burgdorferi isolated from tick on camel in study area. Phylogeny showed that our isolates branched with isolates from tick (accession number. JF911486.1) and camel blood (accession numbers KY284020.1 and KY284015.1) with >80% bootstrap consensus. The analysis used nineteen sequences, including our sequence. A sequence of B. turicatae (accession number AY934610.1) was used as an outer group. In phylogenetic analysis, our sequences showed 100 percent similarity which may be due to circulation of a single strain of Borrelia in the study area and no mutation. So, there is a chance that this spirochete transferred from China to Iran from where it transferred to Pakistan. Another probability is that this pathogen transferred from India as it is a neighboring country.
Several methods are used for identifying the B. burgdorferi sensu lato complex. ELISA and culturing techniques cannot detect this pathogen in ticks because serum or body fluids are required for its detection in these methods. For accurate detection of B. burgdorferi. Polymerase chain reaction is used (Sazmand et al., 2019).
Conclusion
This is the first documented report of B. burgdorferi sensu lato spirochaetes in ticks on camels from Pakistan. B. burgdorferi sensu lato was detected in 10.5% (21/200) ticks collected from camels. Hyalomma and Rhipicephalus were found as greatest incriminated species of hard ticks in the transmission of spirochete B. burgdorferi sensu lato in Punjab, Pakistan. Risk factor analyses showed that gender, tick infestation and season were significantly (p <0.05) associated with B. burgdorferi sensu lato in ticks. Further studies are required to observe the role of hard ticks and camels in the transmission of this pathogen to definitive hosts in Pakistan, and to classify the different genospecies of B. burgdoferi sensu lato in ruminant, canine, equine and human population in Pakistan.
Acknowledgement
The authors acknowledge the support of PAK-US SandT project no. 1122 titled Capacity Building for Vector Born Neglected Diseases of Livestock.
Statement of conflict of interest
The authors have declared no conflict of interest.
References
Adham, F.K., Abdel-samie, E., Gabre, R.M. and Hala, E.H., 2010. J. Egypt. Soc. Parasitol., 40: 553–564.
Alanazi, A.D., Nguyen, V.L., Alyousif, M.S., Manoj, R.R.S., Alouffi, A.S., Donato, R., Sazmand, A., Mendoza-Roldan, Dantas-Torres, F. and Otranto, D., 2020. Parasit. Vectors, 13: 2-9. https://doi.org/10.1186/s13071-020-3973-y
Alanazi, A.D., Swaid, A., Chris, H., Richard, W., Robert, P., Samir, A.A.H., Abdel-Shafy, S. and Shaapan, R.M., 2018. Int. J. Zool. Res., 14: 30-36.
Ali, A., Baby, B. and Vijayan, R., 2019. Front. Genet., 10: 17-23. https://doi.org/10.3389/fgene.2019.00017
Bacon, R.M., Kugeler, K.J. and Mead, P.S., 2008. MMWR Surveill Summ., 57: 1-9.
Bhide, M., Travnicek, M. and Curlick, J., 2004. Vet. Med. Czech., 49: 135–142. https://doi.org/10.17221/5687-VETMED
Blazejak, K., Marie-Kristin, R., Elisabeth, J., Daniela, J., Volker, F. and Christina, S., 2018. Parasit. Vectors, 11: 2-10.
Brona, G.M., Maria, D.P.F., Scott, R.L., Adam, M., Dave, G., Jean, I.T., Lyric, C.B. and Susan, M.P., 2020. Ticks Tick Borne Dis., 11: 1-10.
Capek, M., Literak, I., Kocianova, E., Sychra, O. and Najer, T., 2014. Ticks Tick Borne Dis., 5: 489-493. https://doi.org/10.1016/j.ttbdis.2014.03.002
Diab, F.M., El-Kady, G.A. and Shoukry, A., 2001. J. Egypt Soc. Parasitol., 31: 479-489.
Eisen, L., 2020. Ticks Tick Borne Dis., 11: 1-26. https://doi.org/10.1016/j.ttbdis.2019.101359
Elhelw, R.A., El-enbaawy, M.I. and Samir, A., 2014. Acta Trop., 140: 188–192. https://doi.org/10.1016/j.actatropica.2014.09.005
Fatma, K., Adham, Emtitha, M., Abd- El-Samie, Refaat, M., Gabre. and Hala, E.L.H., 2010. J. Egypt. Soc. Parasitol., 40: 553-564.
Ghafar, A., Alejandro, C.C., Clemence, G., Dasiel, O., Robin, B.G., Sara, M. and Abdul, J., 2020. Parasit. Vectors, 13: 2-15. https://doi.org/10.1186/s13071-019-3862-4
Grochowska, A., Robert, M., Sławomir, P., Justyna, D., Piotr, C., Anna, J., Milewska, Róg-Makal, M., Sambor, G. and Moniuszko-Malinowska, A., 2020. Sci. Rep., 10: 1-9. https://doi.org/10.1038/s41598-020-63883-y
Iqbal, A., Sajid, M.S., Khan, M.N. and Khan, M.K., 2013. Parasitol. Res., 112(2): 535–541. https://doi.org/10.1007/s00436-012-3164-7
Kshirsagar, D.P. and Ingale, A.M., 2014. J. Anim. Res., 4: 39-51. https://doi.org/10.5958/2277-940X.2014.00074.6
Mazyad, S.A. and Khalaf, S.A., 2002. J. Egypt. Soc. Parasitol., 32: 601-610.
Mendoza-Roldan, J.A., Vito, C., Riccardo, P.L., Viet, L.N., Darci, M.B.B., Roberta, I., Filipe, D.T. and Domenico, O., 2019. Parasit. Vectors, 12: 2-9. https://doi.org/10.1186/s13071-019-3286-1
Michalski, M.M., Katarzyna, K., Magdalena, S. and Małgorzata, D., 2021. Pathogens, 10: 2-14.
Nazifi, S., Tamadon, A., Behzadi, M.A., Haddadi, S. and Raayat-Jahromi, A.R., 2011. Vet. Res. Forum, 2: 135-138.
Pasha, R.H., Qureshi, A.S. and Khamas, W.A., 2013. Int. J. Agric. Biol., 15: 62‒68.
Perveen, N., Muzaffar, S.B. and Al-Deeb, M.A., 2021. Insects, 12: 2-35. https://doi.org/10.3390/insects12010083
Rollins, R.E., Zehra, Y., Maja, W., Nikolas, A., Sabrina, H., Fingerle, V., Margos, G. and Becker, N.S., 2021. Ticks Tick Borne Dis., 12: 1-5. https://doi.org/10.1016/j.ttbdis.2020.101589
Roome, A., Rita, S., Leah, H., John, M.D. and Ralph, M.G., 2018. Healthcare, 6: 2-12. https://doi.org/10.3390/healthcare6030084
Said, M.B., Hanene, B., Alberto, A., Khaoula, A., Manel, Z., Monia, D.J. and Lilia, M., 2016. Annls. Agric. Environ. Med., 3: 442-447.
Sarih, M.H., Fatima, J., Lise, G. Daniele, P., 2004. Vector Borne Zoonot. Dis., 3: 133-139. https://doi.org/10.1089/153036603768395834
Sazmand, A., Harl, J., Eigner, B., Hodzic, A., Beck, R., Hekmatimoghaddam, S., Mirzaei, M., Fuehrer, H.P. and Joachim, A., 2019. Comp. Immunol. Microbiol. Infect. Dis., 65: 48–53. https://doi.org/10.1016/j.cimid.2019.04.004
Tabbasam, F., Malik, M.F., Asghar, U., Pracha, K.S. and Nazir, T., 2016. Advan. Ent., 4: 249-259. https://doi.org/10.4236/ae.2016.45026
Taylor, M.A., Coop, R.L. and Richard, L.W., 2013. Taylor veterinary parasitology. Wiley-Blackwell. 3rd ed, pp. 1-600.
Tigani-Asil, E.T.A.E., Blanda, V., Abdelwahab, G.E., Hammadi, Z.M.A., Habeeba, S., Khalafalla, A.I., Alhosani, M.A., Russa, F.L., Migliore, S., Torina, A., Loria, G.R. and Muhairi, S.S.A., 2021. Animals, 11: 2-12. https://doi.org/10.3390/ani11030666
Torina, A., Villari, S., Blanda, V., Vullo, S., Manna, M.P.L., Azgomi, M.S.S., Liberto, D.D.D., Fuente, D.L.J. and Sireci, G., 2020. Int. J. mol. Sci., 21: 5437-5445. https://doi.org/10.3390/ijms21155437
Younsi, H., Postic, D., Baranton, G. and Bouattour, A., 2001. Eur. J. Epidemiol., 17: 53–56. https://doi.org/10.1023/A:1010928731281
Zhai, B., Niu, Q., Liu, Z., Yang, J., Pan, Y., Li, Y., Zhao, H., Luo, J. and Yin, H., 2018. Infect. Genet. Evol., 64: 149–155. https://doi.org/10.1016/j.meegid.2018.06.028
Zhu, S., Zimmerman, D. and Deem, S.L., 2019. Eco Hlth., 16: 356–377. https://doi.org/10.1007/s10393-019-01413-7
Zintl, A., Taher, Z., Fiona, M., Naranjo-Lucena, A., Jeremy, G., Sorcha, B., John, B., Jack, O.C., John, F.M., Barbara, G., Emma, L.G., Alexander, G.C.V. and Jolyon, M., 2020. Ticks Tick Borne Dis., 11: 2-9. https://doi.org/10.1016/j.ttbdis.2020.101518