Research Article

Diagnosis of Sarcocystis spp. in Slaughtered Cattle by Molecular Technique in Babylon Province in Iraq

Wisam Naser Kadhim* and Qassim Gawad Ameer

Department of Parasitology, College of Veterinary Medicine, Al-Qasim Green University, Babylon 51001 Iraq.

Abstract | This study considered the first study in Iraq to determine the Sarcocystis hominis by molecular diagnosis in slaughtered cattle. It is the most important species between humans and animals, causing diseases in humans. This is also determined the Sarcocystis heydorni which is zoonosis disease, and S. cruzi S. hirsute. With the use of (120 slaughtered cattle meat (esophagus) samples and 10 samples from imported meat were compared. In addition, the effect of some certain factors i.e. (age, gender, and months) was undertaken. Samples were collected from July into December 2022. PCR analysis was conducted to confirm presence of Sarcocystis for all samples, and to compare with traditional techniques, the results recorded 106/120 (88.33%) in slaughtered cattle and 7/10 (70%) and an imported beef non-significant difference between male 73/84 (86.9%) and female 33/36 (91.7%) were found. Highly significant differences registered according to age group and the highest infection conducted with age groups than 4 years and above was 59/61 (96.72%). Finally, the study have results of non-significant differences, the infection registered at all months of study and have high rate of infection in December.


Received | December 06, 2024; Accepted | January 14, 2025; Published | February 17, 2025

*Correspondence | Wisam Naser Kadhim, Department of Parasitology, College of Veterinary Medicine, Al-Qasim Green University, Iraq; Email: [email protected]

Citation | Kadhim W.N. and Q.G. Ameer. 2025. Diagnosis of Sarcocystis spp. in slaughtered cattle by molecular technique in Babylon Province in Iraq. Sarhad Journal of Agriculture, 41(1): 330-339.

DOI | https://dx.doi.org/10.17582/journal.sja/2025/41.1.330.339

Keywords | Sarcocystis hominis, Molecular diagnosis, Cattle, Zoonosis infection, Babylon Province, Iraq

Copyright: 2025 by the authors. Licensee ResearchersLinks Ltd, England, UK.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).



Introduction

A particular intracellular parasitic protozoan of the phylum Apicomplexa and family Sarcocystidae is the cause of sarcocystosis (Abdel-Gaber et al., 2020). It is a zoonotic illness that is present all throughout the world (Rosenthal, 2021). When Miescher found white thread-like cysts in a house mouse’s striated muscle in 1843, it was the first time that Sarcocystis had been described scientifically (Dubey et al., 2016) According to Rudaitytė-Lukošienė et al. (2018), Sarcocystis spp. parasite infections are primarily host specific. Hosts may carry many species of the parasite. According to Dubey and Lindsay (2006). The clinical signs and symptoms of acute Sarcocystosis in intermediate hosts include encephalitis, meningitis bleeding diathesis and inflammation of the brain and spinal cord. In most cases, Sarcocystis does not infect the final hosts. Humans can serve as both an intermediate and final host due to their propensity to get intestinal and muscle parasite infections (Fayer, 2004). Sarcocystosis is detected by a variety of diagnostic techniques, including pepsin digestion, muscle squashing, and histological techniques (Metwally et al., 2020). Sarcocystis is diagnosed using molecular biology methods, which is highly beneficial for species identification. These are some of the sophisticated techniques used to find and recognize Sarcocystis species and the genetic diversity of this parasite may be evaluated in relation to various hosts and populations. Sequence analysis is performed to differentiate Sarcocystis spp. using molecular markers based on ribosomal DNA (Chauhan et al., 2020). The purpose of this study was to identify the specific species of Sarcocystis parasites that infect slaughterhouse cow and to ascertain the current prevalence of these parasites in cattle throughout the province of Babylon.

Materials and Methods

Collection of samples

120 sample slaughtered cattle meat and 10 sample from imported meat beef weight 250 gram in labeled clean plastic bags, and carried by cool box to the laboratory of the parasitology Al-Bayati (1993), were collected from different stores, and slaughter house in diverse area of Babylon city, at the start of July 2022 to the end of December 2022.

DNA extraction

Using a tissue DNA extraction kit from Gene aid/USA, the genomic DNA of bradyzoites that were stored and separated from butchered calf flesh isolate was obtained. the extraction made by fellow manufacturers from the digesting test’s tissue cell extraction. Spectrophotometer with nanodrop (ActGene/USA) used to measure the DNA purity and concentration.

PCR amplification

Based on the ITS1 gene on our study was designed as shown in Table 1. Act gene (USA) was supplied the lyophilized primers, which almost amplify at 174 bp segment (SAR), Preparation of primers is performed as described.

Results and Discussion

PCR analyses

The ITS1 internal transcribed spacer gene (PCR amplification results) of Sarcocystis sp.. isolates isolated from slaughtered cattle meat. The bands produced by PCR have a molecular weight of 174 bp are visible in the agarose gel image. PCR was analyzed by electrophoresis of agarose gel (1.5%), stained with ethidium bromide stain and using voltage at 100 volts for 1.5 hours. The positive DNA bands were 174bp shown in (Figure 1).

 

PCR Technique analyses to determine the Sarcocystis sp.

The results of PCR detection 18S rRNA gene for four different species of Sarcocystis isolated from slaughtered cattle meat. A image of The bands of PCR products with various molecular weights are seen on an agarose gel. 500 bp DNA ladder. Sarcocystis hirsute (158 bp), Sarcocystis cruzi (105 bp), Sarcocystis Heydorni (220 bp), and Sarcocystis hominis (190 bp) (Figure 2).

 

Table 1: The primers names and sequences with product size (ITS1 gene).

No

(SAR) Primer sequence 5´ to 3´

Amplicon size

Annealing TM

Genbank

F

ATGGCTAATACATGCGCAAAT

174 bp

49 C

ON209179.1

R

AACTTGAATGATCTATCGCCA

 

Amplification of 18s rRNA region by Primer Sar by Using PCR: The elements of the PCR master mix reaction used by Sar to detect the 18s rRNA gene (Table 2).

 

 

Table 2: Elements of PCR Master Mix Reaction for 18s rRNA gene.

PCR conditions

Amount

Master mix

10 μl

Primers

Forward

1μl

Reversed

1 μl

PCR water

3 μl

DNA template

5 μl

Total volume

20 μl

An amplification mixture of PCR tubes which were put inside Thermal Cycler, then started the amplification program of Sar according Table 3.

 

Table 3: PCR program for detection of 18s rRNA region by primer Sar1.

Step

Temperature (°C)

Time

No. of cycles

Initial denaturation

92

5 Minutes

1

Denaturation

92

30Minutes

40

Annealing

49

25 Minutes

40

Extension

72

45 Minutes

40

Final extension

72

5 Minutes

1

Hold

4

Forever

-

 

Table 4: Infection rate of Sarcocystis in slaughtered cattle and imported beef samples by PCR technique.

Host

No. of samples examined

PCR technique

Slaughtered

cattle meat

120

No. of positive

Percentage (%)

106

88.33

Imported meat

10

7

70

Total

130

113

86.92

X2

11.598667

P value

0.001 **

NS: Non-significant differences at (P≤0.05).

 

Infection rate of Sarcocystis in slaughtered cattle and imported beef samples by PCR technique

After the traditional diagnostic examination, all samples, which were 120 samples from slaughtered cattle and 10 samples from imported meat, were taken to confirm the presence of infection. The results were (88.33%) in slaughtered cattle, while the infection rate in imported meat was (70%). There are no significant differences observed in the rate of infection between both slaughtered cattle and imported beef by PCR technique (Table 4).

These similar (Latif et al., 1999) Sarcocystis infected 97.8% of Iraqi cattle. When researchers in Diala province examined the muscular tissue samples of 179 cattle, they discovered the spread of both macrocystis and microcystis was 2.23% and 81%, respectively and agreement with (Kamil and Faraj, 2020), which, according to a genetic analysis, was found in 72.5% of slaughtered cows and 69% of imported beef samples in Baghdad. Variations in Sarcocystis spp. prevalence rates are caused by a variety of factors, including management practices, the presence of dogs and cats in the vicinity, and the quantity of sporocysts that they spread. Another element influencing the occurrence of Sarcocystis that is influenced by meteorological factors like temperature, humidity, and rainfall is the sarcocysts’ capacity to survive in the environment (El-Dakhly et al., 2011).

Rate of Sarcocystis spp. infection. in slaughtered cattle by PCR technique according to the sex

Comparative between female and male infections showed a non-significant difference (P≤0.05). The rate of infection in females was 91.7%, while in male were 86.9% (Table 5).

 

Table 5: Infection rate of Sarcocystis in slaughtered cattle by PCR technique according to the sex.

Gender

No. of samples examined

PCR technique

Male

84

No. of positive

Percentage (%)

73

86.9

Female

36

33

91.7

X2

0.554486

P value

0.456491 NS

NS: Non-significant differences at (P≤0.05).

 

This was similar as recorded by (Mousa et al., 2012) which showed in females 62.73 % more than in males (0.73 %). For the detection of Sarcocystis followed by molecular detection and identification by PCR and Sequencing of 18S rRNA gene.

Infection rate of Sarcocystis in slaughtered cattle by PCR technique according to age

The samples were collected into four age groups to find out the effect of age on the infection rate above four years old; the infection rate in this group will reach 96.72%. While ≤ 2 years, infection rate was (54.54%). Age groups show a highly significant difference (P≤0.05) between them, (Table 6).

 

Table 6: The infection rate of Sarcocystis spp. in slaughtered cattle by PCR technique according to age.

Age (year)

No. of the exam. samples

Positive samples by PCR technique

No.

%

≤ 2 years

11

6

54.54

2 ≤ 3years

12

7

58.33

3 ≤ 4 years

36

34

94.44

More than 4 years

61

59

96.72

X2

28.134458**

P value

0.000003

*: significant differences at (P≤0.05).

 

Agreement with (Zeng et al., 2021). Which showed effect of age was not significant in male meat (p = 0.872), while the odds of finding sarcocystis significantly increased with age (p = 0.003) within both types of female meat. Disagreement with (Mirzaei-Dehaghi et al., 2013) which recoded 6% and 2.88%, respectively in the oesophagus and diaphragm muscle.

Rate of infection with Sarcocystis in slaughtered cattle by PCR technique according months of study

Samples were collected in six months and the highest infection was in November. That was the infection (95%) From the total number of samples collected, which is 120 samples. While lowest infection was in a October that was the infection (80%). The study showed non-significant difference (P≤0.05) between the months of infection (Table 7).

Disagreement with (Kamil and Faraj, 2020), which showed a high rate of infection registered in both July and September (85%) and the lowest one was in December. The reason is that the infection does not need a specific environment, although there is a varying percentage of infection from one month to another. Sarcocystis spp. differs from the rest of the protozoa because the definitive host sheds the infected stage directly (Fayer, 2004).

 

Table 7: Infection rate with Sarcocystis in slaughtered cattle and imported beef by PCR technique according month of study.

Month

No. of the exam. samples

No. of positive samples by PCR technique

Percentage (%)

July

20

18

90

August

20

17

85

September

20

17

85

October

20

16

80

November

20

19

95

December

30

26

86.7

X2

2.289606

P value

0.807792 NS

NS: Non-significant differences at (P≤0.05).

 

Rate of infection between Sarcocystis spp. in slaughtered cattle and imported meat by PCR technique in all samples

The samples were divided into four groups, and each group was examined in a special primer into four types. This study included the diagnosis of the most important type that causes disease to humans, and the results were as shown in the (Table 8). The study showed a highly significant difference (P<0.05) between Sarcocystis spp. infection.

 

Table 8: The infection rate with Sarcocystis spp. in slaughtered cattle and imported beef by PCR technique.

No. of the exam. samples

Sarcocystis spp.

Positive samples PCR technique

No.

%

130

Sarcocystis cruzi

113

86.9

130

Sarcocystis heydorni

67

51.5

130

Sarcocystis hominis

90

69.2

130

Sarcocystis Hirsuta

2

1.53

X2

71.594734

P value

0.000**

 

Similar results by (Eslami et al., 2015), which recorded highly significant differences in Yazd, Iran.

Rate of infection of Sarcocystis hominis in slaughtered cattle and imported meat by PCR technique according month of study

The diagnosed groups were divided. The date of sample collection was known to compare and know the effect of any month that has an effect on the spread of Sarcocystis spp. The study showed non-significant difference ((P≤0.05) between Sarcocystis spp infection. According to the month of study, the results were as shown in (Table 9).

 

Table 9: Rate of infection of Sarcocystis hominis in slaughtered cattle and imported meat by PCR technique according month of study.

Month

No. of the exam. samples Sarcocystis hominis

No. of positive samples Sarcocystis hominis

Percentage (%)

July

20

13

65

August

20

14

70

September

20

13

65

October

20

14

70

November

20

13

65

December

30

23

76.5

X2

1.293981

0.935550 NS

NS: Non-significant differences at (P≤0.05).

 

Sequencing analysis 18S rRNA gene sequencing for Sarcocystis sample

After running NCBI Blast on these PCR amplicons, the sequencing reactions for the studied samples S1, S2, and S3 revealed the precise locations. Sequence similarities between the sequenced samples and this target have been displayed using the NCBI BLAST engine. Sarcocystis hominis genomic DNA sequences have exceptional similarity with the predicted target, covering a section of the 18S rRNA, according to the NCBI BLAST engine. Local samples monitored DNA sequences were compared with the reference DNA sequences (GenBank Access No. QVPWQ1 QVPWQ2, QVPWQ3). Six mutations are the presence of samples revealed as alignment results of the 199bp. S. cruzi (S4, S5, S6) Local samples DNA sequences were compared within reference DNA sequences (GenBank acc. QVPWQ4, QVPWQ5, and QVPWQ6), the exact positions, with all details were identified. Results of the samples alignment with 105bp, show four mutations when analyzed, and comparison of some samples with the referring 18S rRNA genetic sequences. Four mutations were found in the examined samples that were distributed differently from the corresponding 18S rRNA genetic sequences Within Sarcocystis hirsuta genomic DNA sequences samples (S7, S8, S9). Local samples observed DNA sequences were compared with the reference DNA sequences (GenBank Access No. QVPWQ7 and QVP Q8 QVP W9,). Result of the samples alignment with 158bp; show no mutation found when analyzed, and compared of some samples refereed 18S rRNA genetic sequences. While DNA sequences Sarcocystis heydorni genomic samples (S8, S9, S10) Local samples observed DNA sequences were compared with the reference DNA sequences (GenBank Access No. QVPWQ10, QVPWQ11, QVPWQ12), no mutation found. Within Sarcocystis hirsuta genomic DNA sequences samples (S7, S8, S9). Local samples observed DNA sequences were compared with the reference DNA sequences (GenBank Access No. QVPWQ7 and QVP Q8 QVP W9). Result of the samples alignment with 158bp; show no mutation found when analyzed, and compared of some samples refereed 18S rRNA genetic sequences. While DNA sequences Sarcocystis heydorni genomic samples (S8, S9, S10) Local samples observed DNA sequences were compared with the reference DNA sequences (GenBank Access No. QVPWQ10, QVPWQ11, QVPWQ12), no mutation found.

Phylogenetic tree analysis Phylogenetic tree analysis of samples (S1, S2, S3)

Phylogenetic tree in the present study is comprehensive based on 18S rRNA 199bp amplicons. A nucleic acid sequence that is aligned, for total numbers of the protozoan different, Nine sequences were present in this extensive tree. Investigated S1, S2, S3 Sarcocystis spp. samples were distributed into main species of this genus all over the scanned 18S rRNA-based variants sequence-related organisms (Figure 3). It was found that the studied variants were located in distinct positions within this tree. Three samples of Sarcocystis, namely S1, S2, S3 was found to be positioned within the Sarcocystis hominis phylogenetic portion in the vicinity to accession number (QVC WQ1 QVC WQ2, QVC WQ3). Which belongs to Germany and Netherland Sarcocystis hominis strain also from Thailand, Lithuania and Italy Sarcocystis hominis strain and China Sarcocystis hominis strain.

Phylogenetic tree analysis of samples (S4, S5, S6)

Phylogenetic tree in the present study is comprehensive based on 18S rRNA 105bp PCR amplicons. This phylogenetic tree was incorporated in S4, S5, S6 samples as they have the same PCR primers sequences. An aligned nucleic acid sequence. It was found that the S4, S5, and S6 were located in one distinct position within the tree in the vicinity to strains of S. cruzi, namely the Iran S. cruzi strain and the Japanese S. cruzi strain and turkey strain also China strain. The reason behind this deviation of S4.S5.S6 is attributed to the exclusive presence of four mutations in this isolate. However, these mutations did not change the species definition of this isolate and it was just a minor modification within the same species (Figure 4).

Phylogenetic tree analysis of samples (S7, S8, S9)

Phylogenetic tree in the present study is comprehensive based on 18S rRNA 158bp amplicons. There were nine nucleic acid sequences that matched in this extensive tree, regardless of the protozoan variations. Investigated S7, S8, S9 Sarcocystis hirsuta samples were distributed into main species of this genus all over the scanned 18S rRNA-based variants sequence-related organisms. It was found that the studied variants were located in distinct positions within this tree. Three sample of Sarcocystis hirsuta, namely S7, S8, S9 was found to be positioned within the S. hirsuta phylogenetic portion in the vicinity to accession number (QVPWQ7 and QVPWQ8) which belonged to the Iran S. hirsuta strain and China S. hirsuta strain

 

 

Japan S. hirsuta strain and Germany S. hirsuta strain also Egypt S. hirsuta strai.

Phylogenetic tree in the present study is comprehensive based on 18S rRNA 220bp amplicons. An aligned nucleic acid sequence, for total numbers irrespective of the protozoan variants, in this comprehensive tree was 9 sequences. Investigated S10, S11, and S12 Sarcocystis samples were distributed into main species of this genus all over the scanned 18S rRNA-based variants sequence-related organisms Figure 5.

It was found that the studied variants were located in distinct positions within this tree. Three sample of Sarcocystis, namely S10, S11, S12 was found to be positioned within the Sarcocystis heydorni phylogenetic portion in the vicinity to accession number (QVP Q10 QVC WQ11, QVC WQ12) which belonged to the Iran Sarcocystis heydorni strain and China Sarcocystis heydorni strain Japan Sarcocystis heydorni strain and Germany Sarcocystis heydorni strain also Egypt Sarcocystis heydorni strain.

In order to identify the species of Sarcocystis spp. infection and to compare it with other Sarcocystis spp. in GenBank, which provides information on the novel strain of Sarcocystis spp. in Iraq, DNA sequencing and phylogenetic analysis are thought to be the most essential methods. Babylon province in slaughtered cattle help in the control and of this parasite infection with prevent and control of the zoonosis type (Dubey and Rosenthal, 2023).

 

Phylogenetic tree analysis of samples (S10, S11, S12)

The results of DNA sequencing of slaughtered cattle were collected from different regions of Babylon province which were examined using the 18S rRNA gene (174 bp) of the parasitic Sarcocystis species, which include S. hydroni, S. cruzi, S. homini, and S. hirsuta. The 18S rRNA sequences shared 100% identity with S. cruzi, S. homini, S. hirsuta, and S. hydroni, according to BLAST searches and the phylogenetic topology of 12 bootstraps of our samples, which showed strong sequence similarity to recognized species. The phylogenetic tree’s data revealed the differences and similarities between the Iraqi strain and other strains from across the globe. It was discovered that the S. cruzi phylogenetic region was closely positioned. which belongs to a Chinese strain and Iran and Japan and turkey strain S. homini. With regard to either close positioning was detected beside Thailand strains, Germany strain, Netherland strain, Lithuania strains, Italy strain China strain and Argentina strain. Samples of the investigated Sarcocystis were found to belong to S. hydroni samples were localized relatively close together; they were clustered in the vicinity to a Netherland strain and China strain and Iraq strain. S. hirsuta close positioning was detected beside China strain, Iran strain, Japan strain, Germany strain, Egypt strain and Norway strain.

Conclusions and Recommendations

Isolation and identification of Sarcocystis hominis. As one important zoonotic Sarcocystis species which are important for public health. and high prevalence rate infection by Sarcocystis in both slaughtered cow and imported beef in Babylon province using PCR technique. This means meat must be checked and inspected before use. According to the molecular study this first study revealed S. hominis in Iraq isolate in the slaughtered cattle and imported meat samples in Babylon province.

Novelty Statement

This study aimed to identify the Sarcocystis parasite because it is a common disease. The study aimed to know the rate of infection in animals as well as to know other types that have not been isolated and recorded in Iraq, such as Sarcocystis hirsuta, which was diagnosed using PCR technology and was registered in the Gene Bank in the United States of America. This study is also the first in Babylon Governorate using PCR.

Author’s Contribution

Wisam Naser Kadhim: Helped with the idea, creation, and editing of the manuscript, approved the final version of the manu-script.

Qassim Gawad Ameer: Worked on article drafting and revision statistical analysis.

Conflict of interest

The authors have declared no conflict of interest.

References

Abdel-Gaber, R., S. Al-Quraishy, M. Dkhil, J. Alghamdi and E. Al‐Shaebi. 2020. Molecular phylogeny of sarcocystis fayeri (apicomplexa: sarcocystidae) from the domestic horse equus caballus based on 18s rRNA gene sequences and its prevalence. Letters in Applied Microbio., 71: 377-385. https://doi.org/10.1111/lam.13335

Al-Bayati, S., 1993. Study in the epidemiology of bovine sarcocystosis in Baghdad area. M.Sc. Thesis (arabic). Col. Vet. Med., Univ. Baghdad, Iraq.

Chauhan, R.P., A. Kumari, A.K. Nehra, H. Ram, R. Garg, P. Banerjee, M. Karikalan and A. Sharma. 2020. Genetic characterization and phylogenetic analysis of Sarcocystis suihominis infecting domestic pigs (Sus scrofa) in India. Parasitol. Res., 119: 3347-3357. https://doi.org/10.1007/s00436-020-06857-3

Dubey, J. and B. Rosenthal. 2023. Bovine Sarcocystosis: Sarcocystis species, diagnosis, prevalence, economic and public health considerations, and association of Sarcocystis species with eosinophilic myositis in cattle. Int. J. Parasitol., https://doi.org/10.1016/j.ijpara.2022.09.009

Dubey, J. and D. Lindsay. 2006. Neosporosis, toxoplasmosis and sarcocystosis in ruminants. Vet. Clin. North Am. Fd. Anim. Pract., 22(3): 645-671. https://doi.org/10.1016/j.cvfa.2006.08.001

Dubey, J.P., G. More, E. Van Wilpe, R. Calero‐Bernal, S.K. Verma and G. Schares. 2016. Sarcocystis rommeli, N. Sp. (Apicomplexa: Sarcocystidae) from cattle (Bos taurus) and its differentiation from Sarcocystis hominis. J. Eukaryot. Microbiol., 63: 62-68. https://doi.org/10.1111/jeu.12248

El-Dakhly, K.M., K.A. El-Nesr, E.S. El-Nahass, A. Hirata, H. Sakai and T. Yanai. 2011. Prevalence and distribution patterns of Sarcocystis spp. in buffaloes in Beni-Suef, Egypt. Trop. Anim. Health Prod., 43: 1549-1554. https://doi.org/10.1007/s11250-011-9840-2

Eslami, G., A. Zohourtabar and S. Mehrizi. 2015. First molecular identification of Sarcocystis hirsuta in Iranian beef. J. Food Qual. Hazard. Contr., 1(1): 32-34.

Fayer, R., 2004. Sarcocystis spp. In human infections. Clin. Microbiol. Rev., 17: 894-902. https://doi.org/10.1128/CMR.17.4.894-902.2004

Kamil, J.K. and A.A. Faraj. 2020. Molecular detection of Sarcocystis cruzi in slaughtered cattle at Baghdad city in Iraq. Plant Arch, 20: 1833-1846.

Latif, B., J. Al-Delemi, B. Mohammed, S. Al-Bayati and A. Al-Amiry. 1999. Prevalence of Sarcocystis spp. In meat-producing animals in Iraq. Vet. Parasitol., 84: 85-90. https://doi.org/10.1016/S0304-4017(99)00046-1

Metwally, D.M., T.T. Al-Otaibi, I.M. Al-Turaiki, M.F. El-Khadragy and R.A. Alajmi. 2020. Identification of Sarcocystis spp. in one-humped camels (Camelus dromedarius) from Riyadh and Dammam, Saudi Arabia, via histological and phylogenetic approaches. Animals, 10: 1108. https://doi.org/10.3390/ani10071108

Mirzaei-Dehaghi, M., M. Fallahi, M. Sami and M.H. Radfar. 2013. Survey of Sarcocystis infection in slaughtered sheep in Kerman Abattoir, Kerman, Iran. Comparat. Clin. Pathol., 22: 343-346. https://doi.org/10.1007/s00580-012-1414-9

Mousa, M.M., M.Y. El-Sokkary, W.S.H. Abd-El-Naby and M.A. Hegazy. 2021. The prevalence of sarcocystis affecting slaughtered cattle and buffalo at Sirselian Abattoir in Egypt. Alex. J. Vet. Sci., 69. https://doi.org/10.5455/ajvs.125880

Rosenthal, B.M., 2021. Zoonotic sarcocystis. Res. Vet. Sci., 136: 151-157. https://doi.org/10.1016/j.rvsc.2021.02.008

Rudaitytė-Lukošienė, E., P. Prakas, D. Butkauskas, L. Kutkienė, I. Vepštaitė-Monstavičė and E. Servienė. 2018. Morphological and molecular identification of Sarcocystis spp. from the sika deer (Cervus nippon), including two new species Sarcocystis frondea and Sarcocystis nipponi. Parasitol. Res., 117: 1305-1315. https://doi.org/10.1007/s00436-018-5816-8

Zeng, H., I. Van Damme, T.W. Kabi, B. Šoba and S. Gabriel. 2021. Sarcocystis species in bovine carcasses from a Belgian abattoir: A cross-sectional study. Parasit. Vectors, 14: 1-10. https://doi.org/10.1186/s13071-021-04788-1