AlkB Homolog H5 Attenuates TGF-β1-Induced Epithelial-Mesenchymal Transition of Retinal Pigment Epithelial Cells via Regulating Zinc Finger E-box Binding Homeobox 1
Yunzhi Lin1, Jing He1, Xingwei Wu1* and Qian Shi2*
1Department of Ophthalmology, Shanghai General Hospital of Nanjing Medical University, Shanghai 200080, China.
2Department of Ophthalmology, Yixing Eye Hospital, Yixing 214200, Jiangsu Province, China.
ABSTRACT
There is a relationship between proliferative vitreoretinopathy (PVR) and epithelial-mesenchymal transition (EMT) of Retinal pigment epithelium (RPE). The objective of this study was to investigate the role of AlkB homolog H5 (ALKBH5) in regulating EMT of RPE cells. Reverse transcription polymerase chain reaction (RT-qPCR) was implemented to determine the expression levels of ALKBH5, Zinc finger E-box binding homeobox 1 (ZEB1), insulin-like growth factor-2 mRNA-binding protein-1 (IGF2BP1) and EMT markers. Transwell, and cholecystokinin (CCK)-8 assays were implemented to examine RPE cell migration and proliferation. RNA immunoprecipitation (RIP) assays, and Luciferase reporter and determined the interaction among ZEB1, ALKBH5 and IGF2BP1. MeRIP assay showed m6A modification of ZEB1. ALKBH5 hinders TGF-β1-induced ARPE-19 cells’EMT. Mechanistically, as an m6A demethylase, ALKBH5 suppresses the mRNA stability of EMT-linked transcription factor ZEB1 in an m6A-IGF2BP1-dependent manner. ALKBH5 modulates ZEB1 to affect ARPE-19 cells’EMT. ALKBH5 attenuates TGF-β1-induced EMT of RPE cells via regulating ZEB1. The findings in this study may inspire novel approaches for PVR treatment.
Article Information
Received 03 October 2023
Revised 05 November 2023
Accepted 29 November 2023
Available online 07 March 2024
(early access)
Published 11 November 2024
Authors’ Contribution
YL and JH conducted the experiments in this study. XW and QS contributed to the design and interpretation of the current study and wrote the article. All authors read, revised, and approved the final manuscript.
Key words
PVR, RPE, ALKBH5, ZEB1, EMT, m6A
DOI: https://dx.doi.org/10.17582/journal.pjz/20231003105054
* Corresponding author: [email protected], [email protected]
0030-9923/2024/0000-3389 $ 9.00/0
Copyright 2024 by the authors. Licensee Zoological Society of Pakistan.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
eINTRODUCTION
Being a vitreoretinal fibrosis disease, proliferative vitreoretinopathy (PVR) features the formation of proliferative membranes and can lead to repeated detachment of retina and blindness (Ma et al., 2021). In 1983, PVR was firstly used by Retina Society Terminology Committee for description of a disease process secondary to rhegmatogenous retinal detachment (Dai et al., 2020; Mudhar, 2020). Surgery is the standard treatment for PVR. Nonetheless, the success rate for PVR surgery is only 60–75%, and recurrent retinal traction causes retinal redetachment in over 25% of successful cases (Chen et al., 2021). Hence, it is urgently needed to pay more attention to the pathogenesis of PVR in order to improve its treatment.
During epithelial-mesenchymal transition (EMT), acquiring the phenotypes of mesenchymal cells, encompassing reinforced proliferation, migration and invasiveness (Kalluri and Weinberg, 2019; Bakir et al., 2020). Retinal pigment epithelium (RPE) EMT is regarded to play a key role in PVR pathogenesis (Yang et al., 2021). Former studies about PVR have revealed the several molecular mechanisms underlying EMT of RPE. For instance, miR-29b down-regulates p-p65 level to participates in the modulation of EMT of RPE cells (Li et al., 2021); miR-4516 negatively modulates OTX1 to hamper EMT of RPE cells, thus suppressing the development of PVR (Pao et al., 2022), interfering with KRT8 expression or suppressing its phosphorylation can impair autophagy to modulate EMT of RPE cells (Miao et al., 2020), artesunate reduces Smad3 and p-Smad3 levels to hinder the EMT in RPE cells, thus suppressing PVR incidence and development (Wang et al., 2021). Nevertheless, the mechanisms concerning RPE EMT still remain elusive, and further explorations of novel mechanisms are required.
AlkB homolog H5 (ALKBH5) is a N6-methyladenosine (m6A) demethylase, which has been reported to function as a regulator in multiple diseases. For example, ALKBH5 exerts regulation on tumor immune environment and targets PD-L1 mRNA intrahepatic cholangiocarcinoma (Qiu et al., 2021); ALKBH5 down-regulates LYPD1 expression level through m6A modification, thus hindering malignant progression of hepatocellular carcinoma (Chen et al., 2020). In addition, ALKBH5 also participates in the modulation of EMT (Sun et al., 2022). However, the correlation between ALKBH5 and RPE cells EMT has never been studied before.
Herein, we selected ALKBH5 as our research object and probed into its downstream mechanisms of modulating RPE cells EMT. This study intended to identify a novel mechanism of PVR and deepen our understanding about its pathogenesis.
MATERIALS AND METHODS
Cell culture
Human RPE cell line, ARPE-19, commercially attained from ATCC, kept in DMEM/F-12 added with 10% fetal bovine serum (FBS), and maintained in 5% CO2at 37°C. To induce EMT, 10 ng/mL TGF-β1 was supplemented into the medium and kept for 72 h.
Cell transfection
Short hairpin RNAs (shRNAs) of ALKBH5, ZEB1 and IGF2BP1were established to interfere with ALKBH5, ZEB1 and IGF2BP1 expression levels, with sh-NC being control. In addition, the sequences of ALKBH5, ZEB1 and IGF2BP1 used to establish their overexpression vectors, with empty vector as control. Transfection of plasmids into ARPE-19 cells was implemented by using Lipofectamine 3000.
RT-qPCR
The total RNAs were isolated from ARPE-19 cells, followed by conversion into complementary DNA (cDNA) utilizing reverse transcription. Afterwards, PCR was used to analyze the relative expression levels of E-cadherin, ZO-1, N-cadherin, α-SMA, ALKBH5, ZEB1 and IGF2BP1, standardized to GAPDH (endogenous reference). The results were calculated in accordance with 2-ΔΔCt approach. Primer sequences were reported in Table I. We implemented bio-repeats in triplicate.
CCK-8
ARPE-19 cells were placed into 96-well culture plates, followed by 0, 24, 48 and 72 h of incubation, respectively. After that, incubated 100 μL CCK-8 solution, and the incubation continued for another 4 h. A spectrophotometer was then employed for analysis of the absorbance at 450 nm. We implemented bio-repeats in triplicate.
Table I. The sequences of primers used in this study.
|
Gene |
Sequence (5'-3') |
|
E-cadherin |
F: ACAAGGTGGTCCTGAGAGTTG R: TTTGGAGTTGCTTTTCCTCCG |
|
ZO-1 |
F: CAGCCTGTGAGGCGTAGTAG R: TCCTTCAGCTGGTCCTCCTT |
|
N-cadherin |
F: CAGGGCCCTTTGCATTTGAC R: CGATCCTGTCTACGTCGGTG |
|
α-SMA |
F: TCTGCACAGGTGGCAAAGAT R: GGAACAGAGGTGGTTCCCTG |
|
ALKBH5 |
F: TGCAAGCTCATGCAAACACC R: GACCCAACGTGGCAAGTCTA |
|
ZEB1 |
F: GAGAGGATCATGGCGGATGG R: CTTTCACTGCTCCTCCCTGG |
|
IGF2BP1 |
F: CAGGAGATGGTGCAGGTGTT R: GAGCCTTGAATTGGGCCTCT |
|
GAPDH |
F: GACAGTCAGCCGCATCTTCT R: GCGCCCAATACGACCAAATC |
Transwell assay
In the upper chambers, serum-free medium was added to the ARPE-19 cells. Furthermore, complete medium was supplemented to the upper chambers. Subsequent to 24 h of incubation, the cells left in the upper chambers were abraded. Crystal violet solution was then utilized to stain the migrated cells left in the lower chambers. The stained cells were counted with ImageJ. We implemented bio-repeats in triplicate.
Luciferase reporter assay
The sequences of ZEB1 promoter were subcloned into pGL3 vector for the construction of pGL3-ZEB1 promoter. The reporter vectors were then subjected to co-transfection into ARPE-19 cells with vectors of ALKBH5. The relative luciferase activity was determined, with Renilla luciferase as the internal reference. We implemented bio-repeats in triplicate.
RIP assay
RIPA lysis buffer was applied to lyse ARPE-19 cells. After being conjugated with the antibodies against IGF2BP1 and immunoglobulin G (IgG), the magnetic beads were then incubated with cell lysates. Lastly, RT-qPCR was applied to measure the enrichment of RNAs precipitated by the antibodies-conjugated beads. We implemented bio-repeats in triplicate.
Methylated RNA-binding protein immunoprecipitation (MeRIP) assay
Magna MeRIP m6A Kit (Merck Millipore, USA) was employed for the operation of MeRIP assay. After being extracted from ARPE-19 cells, the total RNAs were fragmented into 100 nucleotides. Subsequently, the samples were subjected to incubation with the m6A antibody for implementation of immunoprecipitation as per the standard instruction of manufacturer. RT-qPCR was conducted to analyze the enrichment of the RNAs containing m6A.
Statistical analysis
With SPSS software used for data analysis, all data from experiments were exhibited as the mean±SD. Student’s t test was used to compare two groups, and ANOVA followed by post-hoc tests (Tukey’s or Dunnett’s correction) was used to compare three groups. When P-value is under 0.05, difference comparisons were considered to be significant.
RESULTS
Cell viability in TGF-β1 group was notably elevated relative to control group (Fig. 1A). Transwell assay uncovered that cell migration was evidently enhanced after TGF-β1 treatment as compared to control group (Fig. 1B). Additionally, the expression levels of EMT markers were determined by RT-qPCR. The outcomes unveiled that E-cadherin and ZO-1 expressions were reduced, and N-cadherin and α-SMA expressions were remarkably increased (Fig. 1C). Taken together, TGF-β1 induces ARPE-19 cells’ EMT.
The results showed that ALKBH5 expression was suppressed subsequent to TGF-β1 treatment (Fig. 2A). Next, we implemented RT-qPCR to detect the interference efficiency of sh-ALKBH5#1/2 in untreated ARPE-19 cells and the overexpression efficiency of overexpression vectors of ALKBH5 in ARPE-19 cells (Fig. 2B). With these vectors, we then conducted gain/loss-of-function experiments to probe the influence of ALKBH5. As displayed in Figure 2C, D, cell viability and migration were up-regulated after ALKBH5 depletion in ARPE-19 cells, while ALKBH5 overexpression impaired cell viability and migration in TGF-β1-treated ARPE-19 cells. Moreover, RT-qPCR was carried out to determine EMT markers after silencing or overexpression of ALKBH5. It was found that interference with ALKBH5 led to significant down-regulation in E-cadherin and ZO-1 expressions and noticeable up-regulation in N-cadherin and α-SMA expressions, while ALKBH5 enhancement exerted the opposite effects (Fig. 2E). Collectively, ALKBH5 inhibits TGF-β1-induced ARPE-19 cells’ EMT.
According to the results, ZEB1 expression was up-regulated by ALKBH5 interference, while that of ZEB1 was down-regulated by ALKBH5 enhancement (Fig. 3A). The results suggested the negative regulation of ALKBH5 on ZEB1. Next, we implemented assays to explore the mechanisms of ALKBH5 underlying ZEB1 regulation. We conducted luciferase reporter assay to investigate whether ALKBH5 can combine with ZEB1 promoter. It was unearthed that the activity of pGL3-ZEB1 promoter wasn’t affected by ALKBH5 (Fig. 3B). After that, RT-qPCR was implemented to examine the impacts of ALKBH5 on ZEB1 mRNA stability after α-amanitin treatment. It was unmasked that the half-life of ZEB1 was prolonged after ALKBH5 interference, while that of ZEB1 was shortened after ALKBH5 overexpression (Fig. 3C). Moreover, MeRIP results disclosed that the abundance of ZEB1 was evidently enhanced subsequent to ALKBH5 silencing in Anti-m6A group relative to Anti-IgG group, whereas that of ZEB1 was evidently attenuated subsequent to ALKBH5 overexpression (Fig. 3D). The results indicated that ALKBH5 might modulate ZEB1 mRNA stability via demethylation of ZEB1 mRNA. Previous research showed that IGF2BP1 can modulate mRNA stability in an m6A-dependent manner (Zhang et al., 2021). Hence, we conjectured that ALKBH5 might modulate ZEB1 mRNA stability through IGF2BP1. After examining the efficiencies of interference and overexpression vectors of IGF2BP1 (Fig. 3E), we then carried out RT-qPCR to test the influence of IGF2BP1 on ZEB1 expression. As displayed in Figure 3F, IGF2BP1 inhibition down-regulated ZEB1 expression and its overexpression up-regulated ZEB1 expression, suggesting that IGF2BP1 might positively regulate ZEB1. RIP assay in Figure 3G proved the interaction between IGF2BP1 and ZEB1. Next, RT-qPCR was conducted to investigate the relationship among ALKBH5, IGF2BP1 and ZEB1. As displayed in Figure 3H, ZEB1 expression affected by ALKBH5 knockdown or overexpression was completely offset by IGF2BP1 silencing or overexpression. Overall, ALKBH5 suppresses ZEB1 mRNA stability in an m6A-IGF2BP1-dependent manner.
As shown in CCK-8 and transwell assays, cell viability and migration enhanced by ALKBH5 knockdown were fully reversed by ZEB1 overexpression, while ZEB1 knockdown completely rescued cell viability and migration hampered by ALKBH5 overexpression (Fig. 4A, B). Additionally, the detection of EMT markers demonstrated that EMT enhanced by ALKBH5 knockdown was fully reversed by ZEB1 overexpression, and ZEB1 silencing could completely rescue EMT hampered by ALKBH5 overexpression (Fig. 4C). To sum up, ALKBH5 modulates ZEB1 to affect ARPE-19 cells’ EMT.
DISCUSSION
According to the previous study, TGF-β1 can be utilized to induce EMT of RPE cells (Ma et al., 2021). In the current study, we also used TGF-β1 to induce ARPE-19 cells’ EMT and the outcomes of CCK-8, transwell and RT-qPCR assays proved the effect of TGF-β1 on EMT. Former studies have unclosed the role of ALKBH5 in modulating EMT. ALKBH5 targets TGF-β/SMAD signaling to hinder TGF-β-induced lung cancer cell EMT (Sun et al., 2022). ALKBH5 facilitates EMT by demethylating FOXM1 mRNA, thus promoting the metastasis of uveal melanoma (Hao et al., 2021). ALKBH5 hampers EMT of trophoblast cells to modulate the occurrence of preeclampsia (He et al., 2020). In line with these findings, our study proved that ALKBH5 is down-regulated in TGF-β1-treated ARPE-19 cells and impairs TGF-β1-induced ARPE-19 cells’ EMT.
As a transcription factor, ZEB1 can induce EMT of cells. DCAF15 hinders EMT of hepatocellular carcinoma cells through modulating ZEB1 (Dong et al., 2021). CircZFPM2 interacts with miR-205-5p to regulate ZEB1, thereby promoting EMT in endometriosis (Wang et al., 2022). ZEB1, miR-200c and AGR2 form a negative feedback loop to regulate EMT in lung adenocarcinoma (Sommerova et al., 2020). Additionally, in the study of PVR, miR-194 can directly target ZEB1 to impair EMT of RPE cells (Cui et al., 2019). Here, we performed rescue experiments using ALKBH5 and ZEB1, proving that ALKBH5 can also target ZEB1 to modulate EMT of RPE cells.
Based on the results in the present study, we proved that ALKBH5 decreases ZEB1 mRNA stability and leads to m6A demethylation of ZEB1 mRNA. Moreover, as evidenced by luciferase reporter assay, ALKBH5 cannot interact with ZEB1 promoter, excluding the possibility of promoter methylation. Recent studies unclosed that ALKBH5 depends on m6A readers to regulate its downstream mRNA (Yang et al., 2022; Guo et al., 2020). We identified IGF2BP1 and wondered whether ALKBH5 regulates ZEB1 mRNA stability in an m6A-dependent manner through this m6A reader. IGF2BP1, as reported previously, can recognize m6A sites in PEG10 mRNA and modulate its stability in endometrial cancer (Zhang et al., 2021). Moreover, IGF2BP1 can enhance m6A modification of MGAT5 mRNA in order to facilitate its stability (Yang et al., 2021). We proved the interaction between ZEB1 and IGF2BP1 and then investigated the correlation among ALKBH, ZEB1 and IGF2BP1. It was validated that ALKBH5 suppresses ZEB1 mRNA stability in an m6A-IGF2BP1-dependent manner.
Owing to the limitation of conditions, the design of assays in our report has several limitations. The functions of ALKBH5 were only investigated at the cellular level. The lack of animal experiments may have undermined the stringency of our report. Furthermore, the upstream mechanisms of ALKBH5 need to be further explored. In the future, we will establish animal models to examine the mechanisms of ALKBH5 in vivo, and supplement the investigation of its upstream targets.
CONCLUSION
ALKBH5 attenuates TGF-β1-induced ARPE-19 cells’ EMT via regulating ZEB1, indicating that m6A demethylase ALKBH5 is implicated in the regulation of PVR. In addition, our data uncovered that ALKBH5, in an m6A-IGF2BP1-dependent manner, suppresses the mRNA stability of ZEB1, an EMT-related transcription factor. Our research deepens the understanding of PVR pathogenesis and provides a theoretical basis for development of novel treatment strategies.
ACKNOWLEDGMENTS
Thanks to the members from Yixing Eye Hospital and Shanghai General Hospital of Nanjing Medical University, the group collected samples, obtained data, and theoretical guidance.
Ethical approval
The study was carried out in compliance with guidelines issued by ethical review board committee of Yixing Eye Hospital, Jiangsu Province, China. The official letter would be available on fair request to corresponding author.
IRB approval
This study was approved by the Advanced Studies Research Board of Yixing Eye Hospital, Yixing 214200, Jiangsu Province, China.
Statement of conflict of interest
The authors have declared no conflict of interest.
REFERENCES
Bakir, B., Chiarella, A.M., Pitarresi, J.R. and Rustgi, A.K., 2020. EMT, MET, plasticity, and tumor metastasis. Trends Cell Biol., 30: 764-776. https://doi.org/10.1016/j.tcb.2020.07.003
Chen, S.H., Lin, Y.J., Wang, L.C., Tsai, H.Y., Yang, C.H., Teng, Y.T. and Hsu, S.M., 2021. Doxycycline ameliorates the severity of experimental proliferative vitreoretinopathy in mice. Int. J. mol. Sci., 22: 11670. https://doi.org/10.3390/ijms222111670
Chen, Y., Zhao, Y., Chen, J., Peng, C., Zhang, Y., Tong, R., Cheng, Q., Yang, B., Feng, X., Lu, Y. and Xie, H., 2020. ALKBH5 suppresses malignancy of hepatocellular carcinoma via m6A-guided epigenetic inhibition of LYPD1. Mol. Cancer, 19: 123. https://doi.org/10.1186/s12943-020-01239-w
Cui, L., Lyu, Y., Jin, X., Wang, Y., Li, X., Wang, J., Zhang, J., Deng, Z., Yang, N., Zheng, Z. and Guo, Y., 2019. miR-194 suppresses epithelial-mesenchymal transition of retinal pigment epithelial cells by directly targeting ZEB1. Ann. Transl. Med., 7: 751. https://doi.org/10.21037/atm.2019.11.90
Dai, Y., Dai, C. and Sun, T., 2020. Inflammatory mediators of proliferative vitreoretinopathy: Hypothesis and review. Int. Ophthalmol., 40: 1587-1601. https://doi.org/10.1007/s10792-020-01325-4
Dong, X., Han, Y., Zhang, E., Wang, Y., Zhang, P., Wang, C., Zhong, L. and Li, Q., 2021. Tumor suppressor DCAF15 inhibits epithelial-mesenchymal transition by targeting ZEB1 for proteasomal degradation in hepatocellular carcinoma. Aging (Albany NY), 13: 10603-10618. https://doi.org/10.18632/aging.202823
Guo, X., Li, K., Jiang, W., Hu, Y., Xiao, W., Huang, Y., Feng, Y., Pan, Q. and Wan, R., 2020. RNA demethylase ALKBH5 prevents pancreatic cancer progression by posttranscriptional activation of PER1 in an m6A-YTHDF2-dependent manner. Mol. Cancer, 19: 91. https://doi.org/10.1186/s12943-020-01158-w
Hao, L., Yin, J., Yang, H., Li, C., Zhu, L., Liu, L. and Zhong, J., 2021. ALKBH5-mediated m6A demethylation of FOXM1 mRNA promotes progression of uveal melanoma. Aging (Albany NY), 13: 4045-4062. https://doi.org/10.18632/aging.202371
He, J., Li, X., Lü, M., Wang, J., Tang, J., Luo, S. and Qian, Y., 2020. ALKBH5 suppresses migration and invasion of human trophoblast cells by inhibiting epithelial-mesenchymal transition. Nan Fang yi ke da xue xue bao, 40: 1720-1725.
Kalluri, R. and Weinberg, R.A., 2009. The basics of epithelial-mesenchymal transition. J. Clin. Invest., 119: 1420-1428. https://doi.org/10.1172/JCI39104
Li, M., Li, H., Yang, S., Liao, X., Zhao, C. and Wang, F., 2021. MicroRNA-29b participates in the epithelial-mesenchymal transition of retinal pigment epithelial cells through p-p65. Exp. Ther. Med., 22: 868. https://doi.org/10.3892/etm.2021.10300
Ma, X., Long, C., Wang, F., Lou, B., Yuan, M., Duan, F., Yang, Y., Li, J., Qian, X., Zeng, J. and Lin, S., 2021. METTL3 attenuates proliferative vitreoretinopathy and epithelial-mesenchymal transition of retinal pigment epithelial cells via wnt/β-catenin pathway. J. cell. mol. Med., 25: 4220-4234. https://doi.org/10.1111/jcmm.16476
Miao, Q., Xu, Y., Yin, H., Zhang, H. and Ye, J., 2020. KRT8 phosphorylation regulates the epithelial-mesenchymal transition in retinal pigment epithelial cells through autophagy modulation. J. cell. mol. Med., 24: 3217-3228. https://doi.org/10.1111/jcmm.14998
Mudhar, H.S., 2020. A brief review of the histopathology of proliferative vitreoretinopathy (PVR). Eye, 34: 246-250. https://doi.org/10.1038/s41433-019-0724-4
Pao, S.I., Lin, L.T., Chen, Y.H., Chen, C.L. and Chen, J.T., 2022. MicroRNA-4516 suppresses proliferative vitreoretinopathy development via negatively regulating OTX1. PLoS One, 17: e0270526. https://doi.org/10.1371/journal.pone.0270526
Qiu, X., Yang, S., Wang, S., Wu, J., Zheng, B., Wang, K., Shen, S., Jeong, S., Li, Z., Zhu, Y. and Wu, T., 2021. M6A demethylase ALKBH5 regulates PD-L1 expression and tumor immunoenvironment in intrahepatic cholangiocarcinoma. Cancer Res., 81: 4778-4793. https://doi.org/10.1158/0008-5472.CAN-21-0468
Sommerova, L., Ondrouskova, E., Martisova, A., Zoumpourlis, V., Galtsidis, S. and Hrstka, R., 2020. ZEB1/miR-200c/AGR2: A new regulatory loop modulating the epithelial-mesenchymal transition in lung adenocarcinomas. Cancers, 12: 1614. https://doi.org/10.3390/cancers12061614
Sun, Z., Su, Z., Zhou, Z., Wang, S., Wang, Z., Tong, X., Li, C., Wang, Y., Chen, X., Lei, Z. and Zhang, H.T., 2022. RNA demethylase ALKBH5 inhibits TGF-β-induced EMT by regulating TGF-β/SMAD signaling in non-small cell lung cancer. FASEB J., 36: e22283. https://doi.org/10.1096/fj.202200005RR
Wang, D., Cui, L., Yang, Q. and Wang, J., 2022. Corrigendum to’Circular RNA circZFPM2 promotes epithelial-mesenchymal transition in endometriosis by regulating miR-205-5p/ZEB1 signalling pathway’[Cellular Signalling, 87 (2021), 110145]. Cell. Signal., 91: 110182. https://doi.org/10.1016/j.cellsig.2021.110182
Wang, Z.Y., Zhang, Y., Chen, J., Wu, L.D., Chen, M.L., Chen, C.M. and Xu, Q.H., 2021. Artesunate inhibits the development of PVR by suppressing the TGF-β/Smad signaling pathway. Exp. Eye Res., 213: 108859. https://doi.org/10.1016/j.exer.2021.108859
Yang, S., Li, H., Yao, H., Zhang, Y., Bao, H., Wu, L., Zhang, C., Li, M., Feng, L., Zhang, J. and Zheng, Z., 2021. Long noncoding RNA ERLR mediates epithelial-mesenchymal transition of retinal pigment epithelial cells and promotes experimental proliferative vitreoretinopathy. Cell Death Differ., 28: 2351-2366. https://doi.org/10.1038/s41418-021-00756-5
Yang, Y., Wu, J., Liu, F., He, J., Wu, F., Chen, J. and Jiang, Z., 2021. IGF2BP1 promotes the liver cancer stem cell phenotype by regulating MGAT5 mRNA stability by m6A RNA methylation. Stem Cells Dev., 30: 1115-1125. https://doi.org/10.1089/scd.2021.0153
Yang, Z., Cai, Z., Yang, C., Luo, Z. and Bao, X., 2022. ALKBH5 regulates STAT3 activity to affect the proliferation and tumorigenicity of osteosarcoma via an m6A-YTHDF2-dependent manner. EBio Med., 80: 104019. https://doi.org/10.1016/j.ebiom.2022.104019
Zhang, L., Wan, Y., Zhang, Z., Jiang, Y., Gu, Z., Ma, X., Nie, S., Yang, J., Lang, J., Cheng, W. and Zhu, L., 2021. IGF2BP1 overexpression stabilizes PEG10 mRNA in an m6A-dependent manner and promotes endometrial cancer progression. Theranostics, 11: 1100-1114. https://doi.org/10.7150/thno.49345