Identification and Antibiogram of Klebsiella pneumoniae Isolated from Camels with Molecular Recognition of Some Virulence and Antibiotic Resistance Encoding Genes
Amgad A. Moawad1, Ahmed M. Ammar2, Amany N. Dapgh3 and Dina A.M. Ragab4*
1Department of Bacteriology, Mycology and Immunology, Faculty of Veterinary Medicine, Kafr El Sheikh University.
2Department of Microbiology, Faculty of Veterinary Medicine, Zagazig University.
3Department of Bacteriology, Animal Health Research Institute, Agriculture Research Center, Dokki, Giza, Postal Code 12611.
4Department of Bacteriology, Animal Health Research Institute, Tanta Branch, Agriculture Research Center.
ABSTRACT
Respiratory diseases are emerging concerns of animals including camels which result in considerable loss in production, elevated mortalities and increased cost of treatment. K. pneumoniae is a substantial opportunistic pathogen that induces a wide spectrum of respiratory infections in human and animals. In the present study, a total of 116 nasal swabs and 89 lung tissue samples were collected from 33 apparently healthy and 83 respiratory ill camels. Samples were screened for the isolation of bacteria, and positive samples were subjected to classical and API 20 E biochemical-based characterization of Klebsiella pneumoniae. Additionally, obtained isolates were assessed for antibiotic susceptibility, the existence of antibiotic resistance genes (blaTEM and aadB) and virulence factors (magA, rmpA). Out of 205 examined samples, 15 isolates (7.31%) were culturally and biochemically confirmed as K. pneumonia. All isolates appeared to be resistant to amoxicillin, ampicillin and gentamycin, however, showed variable susceptible to levofloxacin, imipenem (100%), norfloxacin (93.3%) and ceftriaxon (73%). The application of uniplex PCR on the selected K. pneumoniae isolates revealed the detection of antibiotic resistance genes (blaTAM and aadB) in all isolates. The virulence genes including magA and rmpA were found in 40% and 0% of samples, respectively. In conclusion, the data highligh the existence multidrug resistant K. pneumoniae among Egyptian camels and may represent a theat to public health.
Article Information
Received 27 August 2022
Revised 15 July 2023
Accepted 08 August 2023
Available online 26 December 2023
(early access)
Published 21 April 2025
Authors’ Contribution
AAM, AMA, AND and DAMR performed the experimental work. AAM and AMA designated the plan of study and supervised the study steps. DAMR collected the samples and performed the cultural isolation and biochemical identification. AND and DAMR shared in antibiogram, and molecular identification besides writing and publication processes.
Key words
Antibiotic resistance, Camel, Klebsiella pneumoniae, Respiratory, Virulence, Antibiotic resistance genes, blaTAM, aadB, magA, rmpA, Virulence gene
DOI: https://dx.doi.org/10.17582/journal.pjz/20220827150805
* Corresponding author: [email protected]
0030-9923/2025/0003-1059 $ 9.00/00
Copyright 2025 by the authors. Licensee Zoological Society of Pakistan.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
INTRODUCTION
Camelids are unparalleled group of mammals with distinguished physiological and immunological statuses. The members of this family have developed features to accommodate diverse and challenging environments. In Africa and Middle East, camels are nursed, and contribute significantly to the economy of certain communities which rely on camels for meat, milk, sport and transportation (FAOSTAT, 2016). In spite of resilience to the environment, camels are susceptible to numerous bacterial pathogens. A group of the most common infectious diseases affect camels are the respiratory illnesses which are usually attributed to multifactorial etiology (Zhu et al., 2019).
Respiratory sickness in camels is a growing concern and is leading cause for significant production losses, higher mortalities, and costly preventive and curative efforts (Kane et al., 2005). One of the most prevalent bacterial pathogens impact respiratory illnesses is Klebsiella pneumoniae which is a Gram’s negative, facultative anaerobic, nonmotile and opportunistic pathogen belonging to the family Enterobacteriacae. The K. pneumoniae cause a wide range of symptoms in both humans and animals including pneumonia, septicemia, diarrhea, liver abscesses, meningitis and urinary tract infections (Guo et al., 2017; Navon-Venezia et al., 2017).
Recently, mucoid-hypervirulent K. pneumonia (hvKP) strains have emerged worldwide and found to harbor genes that coding several virulence features that help in the microbial pathogenicity (Shon et al., 2013). Two important genes found to be implemented in the virulence of these hvKP include rmpA gene (regulator of mucoid phenotypes) and magA gene which is associated with K1 capsular serotype. Both genes have been reported to enhance the mucoviscosity and pathogenicity, resulting in severe septicemia and death (Yeh et al., 2006; Hsu et al., 2011).
Furthermore, the global concern of increasing antimicrobial resistance among microbes was extended to K. pneumonia strains. Antibiotics of the β-lactam and aminoglycosides groups are broadly prescribed worldwide. The β-lactams which include cephalosporins, carbapenems, penicillin, amoxicillin and ampicillin are mainly neutralized by production of beta-lactamase. K. pneumonia is considered as one of extended-spectrum beta-lactamase (ESBL) producing bacteria (WHO, 2014; Rahman et al., 2018). On other side, aminoglycosides are potent natural or semisynthetic broad-spectrum antibiotics derived from actinomycetes, which act via prohibition of protein synthesis and widely used for treatment of diseases caused by Enterobacteriaceae.
The K. pneumonia strains may harbor genes responsible to establish resistance against many antibiotics. These include blaTEM and aadB which are responsible for amoxicillin and gentamicin/kanamycin/tobramycin resistence, respectivley (Cameron et al., 1986).
In the current study, the living and slaughtered camels in Gharbia Governorate were screened for the prescence of K. pneumoniae by traditional and advanced molecular techniques. The chracterized isolates were analysed for the prescence of virulence associated (rmpA and magA) and antibiotic resistant genes.
MATERIALS AND METHODS
Sample collection
A total of 205 samples (116 nasal swabs and 89 lung tissues) were obtained from apparently healthy (n≈33) as well as respiratory manifested camels (n≈83) from established farms and abattoirs in Gharbia Governorate during 2018. Nasal samples were incubated in nutrient broth while lung tissues were processed for the bacteriological examination.
Isolation of Klebsiella pneumoniae
Bacterial isolation was carried out following standard techniques described by Gundogan and Avci (2013). Nasal swabs and tissue samples were primarily inoculated in to blood agar plates (HiMedia, India) and incubated for 24-48 h at 37oC. Thereafter, the suspected colonies were streaked on MacConkey bile salt lactose agar (Oxoid Basingstoke, UK), XLD agar media (Oxoid Basingstoke, UK) and Eosin methylene blue agar (HiMedia, India) and incubated aerobically at 37oC for 24-48 h. After incubation, the plates were examined for the nature of growth and appearance characters of bacterial colonies. The preliminary morphological identification was performed based on Gram’s staining.
Biochemical identification of Klebsiella spp.
The pure colonies were used for biochemical identification through classical biochemical tests, including catalase, oxidase, indole, methyl-red, Voges-Proskauer, urease production and citrate utilization, string test for mucoviscosity, gelatin liquefaction, hydrogen sulphide production on TSI agar and carbohydrates fermentation. Furthermore, the purified colonies were confirmed by application of API 20E system (BioMerieux, Marcy l’Etoile, France) following manufacturer’s guidelines.
Antimicrobial susceptibility assay
The sensitivity of the obtained isolates to ten commonly used antibiotics was performed using disk diffusion technique on Mueller-Hinton agar (Oxoid Basingstoke, UK) and interpreted accordingly CLSI (2018). Antibiotic discs (Oxoid Basingstoke, UK) listed in the Table III were used to assess antibiotic sensitivity.
Genotypic characterization of K. pneumonia isolates
DNA was extracted from the K. pneumoniae isolates using QIAamp DNA mini kit following the manufacturer’s guidelines. A total of five isolates from pneumonic lung tissues were used for genotyping. The extracted DNA was subjected to uniplex PCR assay using oligonucleotide specific primers for tested genes as mentioned in Table I. PCR master mix and cycling protocol was adapted according to EmeraldAmp GT PCR Master Mix (Takara, Japan). Amplification was carried out using Biometra thermal cycler.
The reaction was performed under different temperature and duration conditions as described in Table II. Aliquots of amplified PCR products were electrophorised on agarose gel of 1.5% (AB gene) in 1x TBE buffer at 25ºC. For gel analysis, 15 µl of PCR products were loaded in each gel slot. A 100 bp DNA ladder (QIAGEN Inc, CA, USA) was used to define the fragment sizes. The gel was photographed using a gel documentation system (Alpha Innotech, Biometra) and the data were analyzed via different softwares.
Results
A total of 8 isolates of K. pneumoniae from pneumonic camels’ nasal swabs, and 5 isolates obtained from pneumonic lung tissues. The overall incidence of
Table I. Primers’ sequences used for amplification of virulence and antibiotic resistance genes.
|
Primer |
Sequence 5`→3` |
Amplified product |
Reference |
|
aadB |
GAGCGAAATCTGCCGCTCTGG |
319 bp |
Frana et al., 2001 |
|
CTGTTACAACGGACTGGCCGC |
|||
|
blaTEM |
ATCAGCAATAAACCAGC |
516 bp |
Colom et al., 2003 |
|
CCCCGAAGAACGTTTTC |
|||
|
magA |
GGTGCTCTTTACATCATTGC |
1282 bp |
Yeh et al., 2007 |
|
GCAATGGCCATTTGCGTTAG |
|||
|
rmpA |
ACTGGGCTACCTCTGCTTCA |
535 bp |
|
|
CTTGCATGAGCCATCTTTCA |
Table II. Cycling condition of the various primers during PCR.
|
Gene |
Primary denaturation |
Secondary denaturation |
Annealing |
Extension |
No. of cycles |
Final extension |
|
aadB |
94˚C 5 min. |
94˚C 0.5 min. |
58˚C 0.5 min. |
72˚C 0.5 min. |
35 |
72˚C 10 min. |
|
blaTEM |
94˚C 5 min. |
94˚C 0.5 min. |
54˚C 40 sec. |
72˚C 45 sec |
35 |
72˚C 10 min. |
|
magA |
94˚C 5 min. |
94˚C 45 sec. |
50˚C 1 min. |
72˚C 1.2 min. |
35 |
72˚C 12 min. |
|
rmpA |
94˚C 5 min. |
94˚C 0.5 min. |
50˚C 40 sec. |
72˚C 45 sec. |
35 |
72˚C 10 min. |
Klebsiella was 8.96%. As regards to apparently healthy camel, one isolate was recovered from nasal swabs and also one isolate from lung tissues. The overall resulting incidence of isolates was 3.33%.
The results were based on the cultural appearance of colonies, Gram’s staining, classical and confirmatory biochemical tests. On blood agar, Klebsiella species appeared as greyish white non hemolytic colonies, whereas on MacConkey’s agar the colonies appeared mucoid, slimy, rose-pink colonies due to lactose fermenter. Furthermore, Klebsiella spp. appeared purple colonies on EMB agar while bright yellow colonies on XLD agar.
All Klebsiella isolates were identified as Klebsiella pneumoniae according to their classical and API 20 E biochemical reactions. The K. pneumoniae shows yellow slants, yellow butt with gas production in triple sugar test. The isolates were negative for oxidase activity, and showed positivity with indole, methyl red and hydrogen sulfide test. The bacterial isolates showed positive results for catalase activity, Voges Proskauer test, Simmons citrate tests, and were found to be positive for urease, lactose, sucrose, maltose, raffinose, trehalose, D-mannitol, D-sorbitol, L-arabinose and L-rhamnose
The in vitro susceptibility of obtained 15 isolates of K. pneumoniae exhibited all the isolates as sensitive to levofloxacin, imipenem (100%) followed by norfloxacin (93.3%) and ceftriaxon (73%). On the other side, all isolates were resistant to amoxicillin, ampicillin and gentamycin (100%) as outlined in Table III.
Table III. Results of antimicrobial susceptibility of recovered Klebsiella pneumonia isolates.
|
Antibiotic |
Sensitive |
Intermediate |
Resistance |
|
No. (%) |
No. (%) |
No.(%) |
|
|
Imipenem (10µg) |
15 (100) |
0 |
0 |
|
Levofloxacin (10µg) |
15 (100) |
0 |
0 |
|
Ampicillin (10µg) |
0 |
0 |
15 (100) |
|
Tobramycin (15µg) |
7 (46) |
0 |
8 (53) |
|
Gentamycin (10µg) |
0 |
0 |
15 (100) |
|
Tetracycline (30µg) |
5 (33.33) |
6 (40) |
4 (26.6) |
|
Kanamycin (30µg) |
9 (60) |
6 (40) |
0 |
|
Imipenem (10µg) |
15 (100) |
0 |
0 |
|
Ceftriaxone (30µg) |
11 (73) |
4 (26.66) |
0 |
|
Norfloxacin (10µg) |
14 (93.33) |
1 (6.66) |
0 |
Uniplex PCR was applied on the selected five K. pneumoniae isolates to detect the virulence genes (magA, rmpA). Analysis indicated a detection of two and zero isolates by a percentage of 40% and 0%, respectively. On the other hand, the both genes responsible for antibiotic resistance (blaTAM, aadB) were found in all five isolates by a percentage rate of 100%.
Discussion
The role of K. pneumoniae as a significant etiological pathogen for causing pneumonia especially interstitial and chonic pleuropneumonia with mortalities in neonatal dromedary camels was reported (Al-Tarazi, 2001; Narnaware et al., 2020).
Our data revealed eight isolates of K. pneumoniae from pneumonic camels’ nasal swabs, and 5 isolates obtained from pneumonic lung tissues. Therefore, the overall incidence of isolates was 8.96%. As regards to apparently healthy camel, one isolate was recovered from nasal swabs and also one isolate from lung tissues, reulting an overall incidence of 3.33%.
Lower similar incidences (6.3%) have also been mentioned by Abubakar et al. (2008) from Nigerian normal and diseased camel lungs and Ismail et al. (2014) from Egypt (0.5%) in apparently healthy camels. Ahmed and Musa (2015) have recorded a lower rate (0.1%) among pneumonic camels in Sudan. Also, the low prevalence of K. pneumonia in camel was noticed as 16 out of 232 camels (6.9%) in Tunisia (Saidani et al., 2019).
On the other side, higher isolation rates (25.0%) were reported by Azizollah et al. (2009) among healthy dromedaries in central Iran. Sharma et al. (2013) have identified K. pneumoniae isolates as high as 26.9% and 49% in nasal swabs obtained from apparent healthy as well as acute respiratory infected camels, respectively. A total of 70 pneumonic lung tissues obtained from abattoirs in Cairo, Egypt revealed isolation of K. pneumoniae in 26.7% of samples (Wareth et al., 2014). A moderate incidence was reported in cross-sectional bacteriological study performed in Afar Region, Ethiopia among 74 examined camels. The K. pneumoniae was isolated from pneumonic tracheas and lungs by 17.3% while the isolation was noticed in 13.5% of samples collected from other normal animals (Gebru et al., 2018).
Antibiotics are being used extensively to inhibit or to treat microbial infections in human and veterinary practices. Therefore, a great concern has been growing pertaining to antimicrobial resistance in recent years included in what is termed as One Health concept (Matar et al., 2020).
Our data revealed that all tested K. pneumoniae isolates were sensitive to both imipenem and levofloxacin (100%), and have also showed considerably high susceptibility against ciprofloxacin (93.3%) and ceftriaxon (73%). On the other hands, it was observed that all recovered isolates were resistant to amoxicillin, ampicillin and gentamycin.
The choice of quinolone group of antibiotics in effective treatment of diseases caused by K. pneumoniae has been observed earlier (Coskun et al., 2020). The resistance of K. pneumoniae to amoxicillin, ampicillin or gentamycin has been reported in several previous reports (El-Mahmood et al., 2009; Moawad et al., 2011; Sharma et al., 2013; Ahmed and Musa, 2015; Borgio et al., 2021; Fouad et al., 2022).
In our study, all the five tested isolates showed presence of blaTEM and aadB genes and interestingly this existence was expressed in all isolates clinically by resistance to amoxicillin, ampicillin or gentamycin in susceptibility test as mentioned before. The high presence of these resistance genes which are responsible for antibiotic resistance among clinical K. pneumoniae isolates have been documented earlier (Stolle et al., 2013; Lev et al., 2018; Sivaraman et al., 2020; Ejikeugwu et al., 2021; Wareth and Neubauer, 2021).
K. pneumonia is characterized by numerous virulence factors which are playing important roles in the microbial pathogenesis. The magA is considered virulence factor encoded for an outer membrane protein, and help in the resistance of phagocytosis. The rmpA is another virulence factor that facilitates the expression of the hypermucoviscous phenotypes (Fang et al., 2004).
In our study, we have found two out of five tested K. pneumoniae harbor magA gene (40%) while no isolate carry rmpA gene. The variation of these two genes’ existence among K. pneumonia clinical isolates has been reported and the absence incidence are documented (Pinsky et al. (2009), Sharma et al. (2013), Wen-Liang et al. (2015)). On the other side, high detection of magA and rmpA (77.8%) was reported by Osman et al. (2014) rmpA (45.7%) and Tan et al. (2019). Hartman et al. (2009), Turton et al (2010) and Lev et al. (2018) have demonstrated a moderate (25%) ratio of rmpA gene detection.
Conclusion
In conclusion, K. pneumoniae may become a significant pathogen among farmed animals such as camels with the emergence of multidrug resistance that may constitute public health concern. A special vigilance is required to avoid camels becoming a possible reservoir for K. pneumonia.
Funding
This research received no external funding.
Ethical statement
As per CPCSEA guidelines, ethical approval was not needed as the study included clinical and postmortem samples.
Statement of conflict of interest
The authors have declared no conflict of interest.
References
Abubakar, M.S., Fatihu, M.Y., Ibrahim, N.D., Oladele, S.B. and Abubakar, M.B., 2008. Camel pneumonia in Nigeria: Epidemiology and bacterial flora in normal and diseased lung. Afr. J. Microbiol. Res., 4: 2479–2483.
Ahmed, M.E. and Musa, M.T., 2015. Characterization of bacteria isolated from dromedary camels affected with pneumonia for the first time in Sudan. Annu. Res. Rev. Biol., 7: 61–67. https://doi.org/10.9734/ARRB/2015/16744
Al-Tarazi, Y.H., 2001. Bacteriological and pathological study on pneumonia in the one-humped camel (Camelusdromedarius) in Jordan. Rev. Elv. Med. Vet., 54: 93-97.
Azizollah, E., Bentol-hoda, M. and Razieh, K., 2009. The aerobic bacterial population of the respiratory passageways of healthy dromedaries in Najaf-abbad abattoir, central Iran. J. Camelid Sci., 2: 26–29.
Borgio, J.F., Rasdan, A.S., Sonbol, B., Alhamid, G., Almandil, N.B. and AbdulAzeez, S., 2021. Emerging status of multidrug-resistant bacteria and fungi in the arabian peninsula. Biology (Basel)., 10: 1144. https://doi.org/10.3390/biology10111144
Cameron, F.H., Obbink, D.J., Ackerman, V.P. and Hall, R.M., 1986. Nucleotide sequence of the AAD (2”) aminoglycoside adenylyl transferase determinant aadB. Evolutionary relationship of this region with those surrounding aadA in R538-1 and dhfrII in R388. Nucleic Acids Res., 14: 8625-8635. https://doi.org/10.1093/nar/14.21.8625
Clinical and Laboratory Standards Institute (2018). Performance standards for antimicrobial susceptibility testing. Supplement M100 –S15. Wayne, Pennsylvania.
Colom, K., Pérez, J., Alonso, R., Fernández-Aranguiz, A., Lariño, E. and Cisterna, R., 2003. Simple and reliable multiplex PCR assay for detection of blaTEM, blaSHV and blaOXA–1 genes in Enterobacteriaceae. FEMS Microbiol. Lett., 223: 147–151. https://doi.org/10.1016/S0378-1097(03)00306-9
Coskun, D., Corum, O. and Yazar, E., 2020. Effect of supportive therapy on the pharmacokinetics of intravenous marbofloxacin in endotoxemic sheep. J. Vet. Pharmacol. Ther., 43: 288-296. https://doi.org/10.1111/jvp.12849
Ejikeugwu, C., Nworie, O., Saki, M., Al-Dahmoshi, H.O.M., Al-Khafaji, N.S.K., Ezeador, C., Nwakaeze, E., Eze, P., Oni, E., Obi, C., Iroha, I., Esimone, C. and Adikwu, M.U., 2021. Metallo-β-lactamase and AmpC genes in Escherichia coli, Klebsiella pneumoniae, and Pseudomonas aeruginosa isolates from abattoir and poultry origin in Nigeria. BMC Microbiol., 21: 124. https://doi.org/10.1186/s12866-021-02179-1
El-Mahmood, A.M., Isa, H., Mohammed, A. and Tirmidhi, A.B., 2009. Antimicrobial susceptibility of some respiratory tract pathogens to commonly used antibiotics. J. clin. med. Res., 2: 135–142.
Fang, C.T., Chuang, Y.P., Shun, C.T., Chang, S.C. and Wang, J.T., 2004. A novel virulence gene in Klebsiella pneumoniae strains causing primary liver abscess and septic metastatic complications. J. exp. Med., 199: 697-705. https://doi.org/10.1084/jem.20030857
FAOSTAT, 2016. Food and agriculture organization corporate statistical database. http://www.fao.org/faostat/en/#data. Accessed 12 Apr 2018.
Fouad, E.A., Khalaf, D.D., Farahat, E. and Hakim, A.S., 2022. Identification of predominant pathogenic bacteria isolated from respiratory manifested small ruminants in western north Egypt with regard to their susceptibility to antibiotics. Int. J. Hlth. Sci., 6(S2): 10818–10828. https://doi.org/10.53730/ijhs.v6nS2.7843
Frana, T.S., Carlson, S.A. and Griffith, R.W., 2001. Relative distribution and conservation of genes encoding aminoglycoside-modifying enzymes in Salmonella enterica serotype Typhimurium phage type DT104. Appl. environ. Microbiol., 67: 445–458. https://doi.org/10.1128/AEM.67.1.445-448.2001
Gebru, M., Tefera, G., Dawo, F. and Tessema, T.S., 2018. Aerobic bacteriological studies on the respiratory tracts of apparently healthy and pneumonic camels (Camelus dromedaries) in selected districts of Afar Region, Ethiopia. Trop. Anim. Hlth. Prod., 50: 603-611. https://doi.org/10.1007/s11250-017-1476-4
Gundogan, N. and Avci, E., 2013. Prevalence and antibiotic resistance of extended spectrum beta-lactamase (ESBL) producing Escherichia coli and Klebsiella species isolated from foods of animal origin in Turkey. Afr. J. Microbiol. Res., 7: 4059– 4064.
Guo, Y., Wang, S., Zhan, L., Jin, Y., Duan, J. and Hao, Z., 2017. Microbiological and clinical characteristics of hypermucoviscous Klebsiella pneumoniae isolates associated with invasive infections in China. Front. Cell. Infect. Microbiol., 7: 24. https://doi.org/10.3389/fcimb.2017.00024
Hartman, L.J., Selby, E.E., Whitehouse, C.A., Coyne, S.R., Jaissle, J.G., Twenhafel, N.A., Burke, R.L. and Kulesh, D.A., 2009. Rapid real-time PCR assays for detection of Klebsiella pneumoniae with the rmpA or magA genes associated with the hypermucoviscosity phenotype: Screening of nonhuman primates. J. mol. Diag., 11: 464-471. https://doi.org/10.2353/jmoldx.2009.080136
Hsu, C.R., Lin, T.L., Chen, Y.C., Chou, H.C. and Wang, J.T., 2011. The role of Klebsiella pneumoniae rmpA in capsular polysaccharide synthesis and virulence revisited. Microbiology, 157: 3446-3457. https://doi.org/10.1099/mic.0.050336-0
Ismail, M., El-Deen, N.E. and El-Hariri, M., 2014. Bacteriological examination of respiratory tract of apparently healthy camels in Egypt. Int. J. Microb. Res., 5: 65–68.
Kane, Y., Kadja, M.C., Bada-Alambedji, R., Bezeid, O.E., Akakpo, J.A. and Kaboret, Y., 2005. Lung lesions and bacteria of the one-humped camel (Camelus dromedarius) at Nouakchott slaughterhouse in Mauritania. Rev. Élev. Méd. Vét. Pays Trop., 58: 145-150. https://doi.org/10.19182/remvt.9926
Krause, K.M., Serio, A.W. and Kane, T.R., 2016. Connolly LE. Aminoglycosides: An overview. Cold Spring Harb. Perspect. Med., 6: a027029. https://doi.org/10.1101/cshperspect.a027029
Lev, A.I., Astashkin, E.I. and Kislichkina, A.A., 2018.Comparative analysis of Klebsiella pneumoniae strains isolated in 2012-2016 that differ by antibiotic resistance genes and virulence genes profiles. Pathog. Glob. Hlth., 112: 142-151. https://doi.org/10.1080/20477724.2018.1460949
Matar, G.M., Andremont, A. and Bazzi, W., 2020. Combating antimicrobial resistance. A one health approach. Front. Cell Infect. Microbiol., 22: 458. https://doi.org/10.3389/978-2-88963-515-3
Moawad, A.A., Ibrahim, H.S. and Elsherbiny, M.M., 2011. Characterization of gram-negative bacteria isolated from lungs of camel. Kafr-Elsheikh Vet. med. J., 9: 98-144. https://doi.org/10.21608/kvmj.2011.113532
Narnaware, S.D., Dahiya, S.S., Ranjan, R. and Tuteja, F.C., 2020. Fatal neonatal infection with Klebsiella pneumoniae in dromedary camels: pathology and molecular identification of isolates from four cases. Trop. Anim. Hlth. Prod., 52: 3923-3929. https://doi.org/10.1007/s11250-020-02421-4
Navon-Venezia, S., Kondratyeva, K. and Carattoli, A., 2017. Klebsiella pneumoniae: A major worldwide source and shuttle for antibiotic resistance. FEMS Microbiol. Rev., 41: 252–275. https://doi.org/10.1093/femsre/fux013
Osman, K.M., Hassan, H.M., Orabi, A. and Abdelhafez, A.S., 2014. Phenotypic, antimicrobial susceptibility profile and virulence factors of Klebsiella pneumoniae isolated from buffalo and cow mastitic milk. Pathog. Glob. Hlth., 108: 191-199. https://doi.org/10.1179/2047773214Y.0000000141
Pinsky, B.A., Baron, E.J., Janda, J.M. and Banaei, N., 2009. Bartholin’s abscess caused by hypermucoviscous Klebsiella pneumoniae. J. Med. Microbiol., 58: 671-673. https://doi.org/10.1099/jmm.0.006734-0
Saidani, M., Messadi, L., Mefteh, J., Chaouechi, A., Soudani, A., Selmi, R., Dâaloul-Jedidi, M., Ben Chehida, F., Mamlouk, A., Jemli, M.H., Madec, J.Y. and Haenni, M., 2019. Various Inc-type plasmids and lineages of Escherichia coli and Klebsiella pneumoniae spreading blaCTX-M-15, blaCTX-M-1 and mcr-1 genes in camels in Tunisia. J. Glob. Antimicrob. Resist., 19: 280-283. https://doi.org/10.1016/j.jgar.2019.05.007
Sharma, S.K., Kataria, A.K., Shingi, B.N., Nathawat, P., Bhati, T. and Mohammed, N., 2013. Detection of hypermucoviscous Klebsiella pneumoniae in camel (Camelus dromedaries) during an outbreak of acute respiratory tract infection. J. Camel Pract. Res., 20: 139–143.
Shon, A.S., Bajwa, R.P. and Russo, T.A., 2013. Hypervirulent (hypermucoviscous) Klebsiella pneumoniae: A new and dangerous breed. Virulence, 4: 107-118. https://doi.org/10.4161/viru.22718
Sivaraman, G.K., Sudha, S., Muneeb, K.H., Shome, B., Holmes, M. and Cole, J., 2020. Molecular assessment of antimicrobial resistance and virulence in multi drug resistant ESBL-producing Escherichia coli and Klebsiella pneumoniae from food fishes, Assam, India. Microb. Pathog., 149: 104581. https://doi.org/10.1016/j.micpath.2020.104581
Stolle, I., Prenger-Berninghoff, E., Stamm, I., Scheufen, S., Hassdenteufel, E., Guenther, S., Bethe, A., Pfeifer, Y. and Ewers, C., 2013. Emergence of OXA-48 carbapenemase-producing Escherichia coli and Klebsiella pneumoniae in dogs. J. Antimicrob. Chemother., 68: 2802-2808. https://doi.org/10.1093/jac/dkt259
Tan, T.Y., Ong, M., Cheng, Y. and Ng, L.S.Y., 2019. Hypermucoviscosity, rmpA, and aerobactin are associated with community-acquired Klebsiella pneumoniae bacteremic isolates causing liver abscess in Singapore. J. Microbiol. Immunol. Infect., 52: 30-34. https://doi.org/10.1016/j.jmii.2017.07.003
Turton, J.F., Perry, C., Elgohari, S. and Hampton, C.V., 2010. PCR characterization and typing of Klebsiella pneumoniae using capsular type-specific, variable number tandem repeat and virulence gene targets. J. med. Microbiol., 59: 541-547. https://doi.org/10.1099/jmm.0.015198-0
Rahman, U.S., Ali, T., Ali, I., Khan, N.A., Han, B. and Gao, J., 2018. The growing genetic and functional diversity of extended spectrum beta-lactamases. Biomed. Res. Int., 26: 9519718. https://doi.org/10.1155/2018/9519718
Wareth, G., Murugaiyan, J., Khater, D.F. and Moustafa, S.A., 2014. Subclinical pulmonary pathogenic infection in camels slaughtered in Cairo, Egypt. J. Infect. Dev. Count., 14: 909-913. https://doi.org/10.3855/jidc.4810
Wareth, G. and Neubauer, H., 2021. The animal-foods-environment interface of Klebsiella pneumoniae in Germany: An observational study on pathogenicity, resistance development and the current situation. Vet. Res., 52: 16. https://doi.org/10.1186/s13567-020-00875-w
Wen-Liang, Y., Mei-Feng, L., Ming-Chung, C. and Yin-Ching, C., 2015. Intrapersonal mutation of rmpA and rmpA2: A reason for negative hypermucoviscosity phenotype and low virulence of rmpA-positive Klebsiella pneumoniae isolates. J. Glob. Antimicrob. Resist., 3: 137-141. https://doi.org/10.1016/j.jgar.2015.03.008
World Health Organization, 2014. Antimicrobial resistance: Global report on surveillance. World Health Organization, Geneva. Available at: http://www.who.int/drugresistance/documents/surveillancereport/en/
Yeh, K.M., Chang, F.Y., Fung, C.P., Lin, J.C. and Siu, L.K., 2006. magA is not a specific virulence gene for Klebsiella pneumoniae strains causing liver abscess but is part of the capsular polysaccharide gene cluster of K. pneumoniae serotype K1. J. med. Microbiol., 55: 803-804. https://doi.org/10.1099/jmm.0.46368-0
Yeh, K.M., Kurup, A., Siu, L.K., Koh, Y.L., Fung, C.P., Lin, J.C., Chen, T.L., Chang, F.Y. and Koh, T.H., 2007. Capsular serotype K1 or K2, rather than magA and rmpA, is a major virulence determinant for Klebsiella pneumoniae liver abscess in Singapore and Taiwan. J. clin. Microbiol., 45: 466-471. https://doi.org/10.1128/JCM.01150-06
Zhu, S., Zimmerman, D. and Deem, S.L., 2019. A review of zoonotic pathogens of dromedary camels. Ecohealth, 16: 356-377. https://doi.org/10.1007/s10393-019-01413-7