Molecular Identification and Prevalence of Fasciola gigantica in Cattle and Buffaloes of Punjab, Pakistan

Maria Komal1, Kiran Afshan1*, Hafiz Syed Zain Ul Hassan1, Salman Farsi1, Ghulam Narjis2 and Sabika Firasat1

1Department of Zoology, Faculty of Biological Sciences, Quaid-i-Azam University, Islamabad, 45320, Pakistan

2Department of Statistics, Rawalpindi Women University, 6th Road, Satellite Town, Rawalpindi, Punjab, Pakistan

ABSTRACT

Fasciolosis is a food- and water-borne trematodiosis caused by Fasciola hepatica and F. gigantica. Hybridization between the two species has been reported in Punjab. Therefore, this study aimed at morphological and molecular characterization of Fasciola gigantica and its prevalence in cattle and buffaloes of Punjab province, Pakistan. A total of 100 fluke specimens were collected from cattle and buffaloes slaughtered at abattoirs and were classified as Fasciola spp. using morphological characters. Of these species, 62 flukes of 31 populations were identified with molecular analysis using the ITS-I marker. Copro-ELISA assay was performed to find the prevalence of fasciolosis. Morphological and molecular analysis showed that Fasciola spp. species formed a moderately supported monophyletic clade with F. gigantica. The phylogenetic analysis showed conclusive evidence for the clade containing Indian and Chinese F. gigantica. The copro-ELISA result showed that the diagnostic accuracy of the test was 89.22% with 100% sensitivity and 82% specificity. The overall prevalence of fasciolosis was 42.7%, and infection was significantly (p<0.001) higher in cattle 25.3%, as compared to 17.4% in buffaloes. The fasciolosis was significantly (p=0.02) higher in females (24.6%) compared to males (18.0%), and animals belonging to >3-6 years of age group showed the highest prevalence of 30.3% than other age groups. In conclusion, the use of morphological techniques, complemented by molecular techniques is recommended, in endemic areas where the two species are co-endemic. Furthermore, the immunodetection assays are more sensitive to find the epidemiological status of disease as compared to conventional microscopic fecal examination.


Article Information

Received 16 April 2022

Revised 20 July 2023

Accepted 18 August 2023

Available online 31 January 2024

(early access)

Published 01 May 2025

Authors’ Contribution

KA presented the concept. MK, HSZH and SF curated data. GN and KA performed formal analysis and software. MK, KA and SF planned methodology. KA, MK, SF and GN validated the study. KA, MK, HSZH and SF wrote the manuscript.

Key words

Molecular characterization, Morphology, ITS-I, Copro-ELISA, Fasciolosis, Pakistan

DOI: https://dx.doi.org/10.17582/journal.pjz/20220416180444

* Corresponding author: [email protected]

0030-9923/2025/0003-1179 $ 9.00/00

Copyright 2025 by the authors. Licensee Zoological Society of Pakistan.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).



INTRODUCTION

Fasciolosis is a parasitic zoonosis resulting from exposure to Fasciola hepatica or F. gigantica liver flukes. Fasciolosis is endemic throughout the world infecting 600 million domestic ruminants, causing major economic losses estimated to be US$3 billion per annum; some 17 million people are also infected in 61 countries with 180 million at risk of infection and the burden of disease due to fasciolosis is estimated at 90,000 disability-adjusted life years (Mas-Coma et al., 2019). Fasciolosis has also been reported in all part of Pakistan, with an overlap of the two species F. gigantica and F. hepatica (Afshan et al., 2014a). The climate change and anthropogenic environment modifications are influencing the fascioliasis risk by anthropogenic activities and climate change (Afshan et al., 2014b, 2022). The prevalence of helminthes in different species of animals has been reported ranging from 21.41 to 92% in Pakistan. The problem of fascioliasis has been diagnosed in all areas of the Punjab but is a main problem in swampy areas enriched with the intermediate hosts, like snails and is one of the main constraints in development of a profitable livestock industry (Farooq et al., 2015; McManus, 2020).

Fasciola species tend to be sympatric in several sub-tropical and hot temperate climes, particularly in Asia and Africa (Kalu, 2015). This overlapping prevalence has resulted in disagreements over the taxonomic differentiation of Fasciola species in Far Eastern countries, where the exitance of intermediate form of Fasciola has been documented (Seid and Melese, 2018), and frequent in Asiatic countries (Yakhchali et al., 2015). Morphological criteria such as body size and shape are among the traditional and important methods to distinguish between the 2 species (Rouhani et al., 2017). However, relying just on morphometry is insufficient because the morphological characteristics of adult worms and eggs are impacted by a variety of parameters, including the host type, parasite age, sample fixation, and infection severity.

However, because of considerable variation and overlap in measurements between Fasciola species such phenotypic criteria are unreliable for specific identification and differentiation between Fasciola species (Ahmad et al., 2021). Both species were shown to be spermic diploid and capable of meiosis. Flukes which have intermediate morphological properties of both F. hepatica and F. gigantica have created uncertainty, provoking a rise in the cumulative usage of molecular (Villa-Mancera et al., 2021) and morphometric methods to differentiate the species. Because morphological methods have limits, numerous molecular approaches based on different molecular targets have been developed to differentiate Fasciola species. Because of the repeated sequence and the existence of variable sections flanked by more conserved region, nuclear rDNA is particularly relevant for molecular investigations. The nuclear rDNA sequences of ITS-I and II, which are found between the 18S, 5.8S, and 28S coding areas, have been employed for species-level molecular identification (Amer et al., 2016).

Epidemiological studies on fasciolosis mainly relay on fecal examination or on inspecting animal directly at slaughterhouses, which is time consuming and laborious process and is insensitive in case of low parasite burden. Recent approaches are based on immunological techniques that tend to improve the accuracy and sensitivity of fluke detection in feces of livestock (Martinez-Sernandez et al., 2016). The potential usage of a Fasciola coproantigen test has been described by its virtue to detect very low number flukes burden, for example, by one fluke, or five metacercarial cysts. Moreover, copro-ELISA is more sensitive in recognizing active fasciolosis than of methods used for detecting excretory/secretory antigens in serum. The experimental infection has investigated the high sensitivity and specificity of coproantigen-based ELISA (Cwiklinski et al., 2019).

However, a very few researchers tend to use immune-serological techniques (Afshan et al., 2014b, 2017, 2022). Lack of widely accepted and sensitive diagnostic tool is reason behind the underestimation of these trematodiases incidence. There is a scarcity of useful data on the phenotyping and the molecular characterization of Fasciola spp. in Pakistan’s large ruminants. Therefore, the present study aimed to identify accurate fasciolids species based on morphological and molecular markers and to determine the distribution of fasciolosis by copro-ELISA in Punjab, Province Pakistan.

MATERIALS AND METHODS

Study area

The Punjab province of Pakistan was the subject of research and accounts for 25.8% of Pakistan’s total land area. Adult and mature liver flukes were obtained from the bile duct of buffaloes and cattle of either sex that were slaughtered at the Rawalpindi, Gujrat, Khushab and Kharian slaughterhouses between June 2019 to April 2020. Bovines are brought in from across the Punjab province to these slaughterhouses. This research included Sahiwal cattle, Nili Ravi, and Azi-kheli buffaloes of various ages and genders, mostly those kept on natural grazing and other seasonal fodders by using a random sampling procedure.

Collection of adult flukes

This study included 170 adult liver flukes from 130 infected cattle and buffaloes. The livers, gall bladders, and bile ducts of the slaughtered animals were inspected. The bile ducts were incised longitudinally through the gall bladder into the liver, and the parasites were extracted using fine forceps, taking all essential measures to prevent parasite damage. Only adult flukes from the collection were selected for further analysis, and they were determined as gravid due to the presence of many eggs in the uterus. To remove debris, each worm was rinsed twice in a 0.85% saline solution. Fasciola samples were transported to the laboratory and stored in 70% ethyl alcohol at room temperature for further analysis.

Morphometric analysis

A total 100 adult flukes from cattle (n=50) and buffaloes (n=50) were stained. Briefly, worms were washed with tap water for the removal of debris and fixed in Bouin’s solution between two slides and stained with Grenacher’s borax carmine and subsequently differentiated, dehydrated, and mounted in Canada balsam. Standard morphometric measurements were taken under the microscope as described by Periago et al. (2006).

Molecular analysis

The DNA was extracted from 31 populations (n=62) with the phenol chloroform technique (Sambrook et al., 1989). The ITS-I region of rDNA was amplified with a set of primers ITS-I Forward 5’ GCGACCTGAAAATCTACTCTTACACAAGCG 3’ and ITS-I-Reverse 5’ GACGTACGTATGGTCAAAGACCAGGTT 3’. The 25 μl PCR reaction mixtures consisted of 2 μl of PCR buffer (1×), 2 μl MgCl2 (25 mM), 2 μl of 2.5 mM dNTPs, 0.7 μl of primer mix (10 pmol/μl final concentration of each primer), 2 μl of gDNA, and 0.3 μl of Taq DNA polymerase (5 U/μl) and 16 μl ddH20. The thermo cycling conditions were 96 °C for 8 min followed by 39 cycles of 96 °C for 1 min, 54 °C for 1 min and 72 °C for 1 min, with a final extension of 72 °C for 8 min. Aliquots (5 µl) of individual amplicons were examined on 1.5% (w/v) agarose gels and photographed using a GelDoc system.

PCR products were purified with WizPrepTM Gel/PCR Purification Mini kit (South Korea) and sequenced from DNA sequencing facility eurofins genomics (USA). Sequencer 5.4.6, Bio Edit software’s were used to edit and align the ITS-I region of the Fasciola flukes. The unique sequences were submitted to GenBank, accession numbers were obtained and aligned with previously published NCBI GenBank rDNA reference sequences. The evolutionary history was inferred by using the Maximum Likelihood method and Kimura 2-parameter model. This analysis involved 21 nucleotide sequences. All positions containing gaps and missing data were eliminated (complete deletion option). There was a total of 409 positions in the final dataset. The evolutionary distances were computed with Maximum Composite Likelihood method by using MEGA X (Kumar et al., 2018).

Copro-ELISA detection of fasciolosis

The fecal samples form from naturally infected cattle and buffaloes (n=499) grazing in the fields were collected. The liver and bile ducts of slaughtered animals were examined for Fasciola (gold standard of infection), and feces were collected from rectum. The positive (n=85) and negative (n=119) control fecal samples were collected. All fecal samples were mixed in distilled water at 1:1 ratio (3 g + 3mL) and subjected to centrifuge at 1,000g for 15 min. The supernatants were collected and analyzed for the presence of Fasciola coproantigens by ELISA.

ELISA was performed according to method described by Ahmad and Nizami (Ahmad and Nizami, 1998) with slight modifications. Fecal supernatant (50 µl/well) were coated in microtiter plates in a coating buffer, washed with PBS containing 0.1% Tween. Blocked with 150 µl of bovine serum albumin for 1hr and washed. Serially diluted 100 µl of Fasciola somatic antigen polyclonal antibodies (Afshan et al., 2021) were incubated for 2 h and washed. The alkaline phosphatase conjugated anti-rabbit IgG is diluted at 1:5000 dilution (Invitrogen Corporation, California, USA) and 100 µl of it was added to each well and incubated at room temperature for 2 h. The plates were washed, and reaction was developed by adding 100 µl of the substrate, para-nitrophenyle phosphate (PNPP) (Thermo Fisher Scientific Inc. Rockford, lL, USA). After 15-20 min the 50 µl of 3N NaOH was added to stop the reaction and OD was recorded at 405nm.

Statistical analysis

The diagnostic sensitivity, specificity, accuracy, and predictive values were calculated by using the online statistical software MedCalc (https://www.medcalc.org/calc/diagnostic_test.php). To compare prevalence among breed, age and sex categories Chi-square test were performed by using SPSS 22.0 statistical software. Significance was defined as P < 0.05. ROC curve values were computed by using GraphPad Prism (version 9).

 

Table I. Morphological measurements with descriptive statistical analysis of the F. gigantica collected from cattle (n=50) and buffaloes (n=50) of Punjab, Pakistan. The data shows range, mean and standard deviation values. All measurements are taken in millimeters (mm).

Parameters (mm)

F. gigantica

buffaloes

F. gigantica cattle

Body length

34.46±0.51

20.1-41.3

Body width

5.84±0.09

6.01±0.17

Maximum diameter of oral sucker (OS max)

0.69 ± 0.14

0.84±0.02

Minimum diameter of oral sucker (OS min)

0.58±0.00

0.69±0.0

Maximum diameter of

ventral sucker (VS max)

1.53±0.02

1.62±0.02

Minimum diameter of

ventral sucker (VS min)

1.45±00

1.52±0.03

Distance between anterior end of body & VS(A-VS)

2.35±0.11

2.42±0.18

Distance between VS and posterior end of body (VS-P)

30.71±0.48

30.37±0.75

Body area (BA)

204.87±5.29

0.52±0.02

Oral sucker area (OSA)

0.49±0.01

207.29±9.0

Ventral sucker (VSA)

1.76±0.06

2.51±0.10

BL/BW ratio (BL/BW)

6.01±0.09

5.78±0.13

 

RESULTS

Morphometric analysis of F. gigantica

The morphological measurements of liver flukes from cattle and buffaloes slaughtered at different abattoirs of Punjab are grouped into F. gigantica like (Table I). The body length to width was 20.1 x 6.01 mm in cattle, and 34.46 x 5.84 mm in buffaloes. While the ratio of body length to width was 5.78±0.13 and 6.01±0.09 for cattle

 

Table II. Nucleotide variations in F. gigantica isolate A and B at fifteen different base positions collected from cattle and buffaloes of Punjab, Pakistan.

Fasciola gigantica Pakistan

Variable positions

154

164

168

172

173

180

183

184

185

190

193

195

196

364

394

Fasciola gigantica isolate A (OM212803)

C

A

G

T

C

G

A

G

A

C

C

C

G

G

T

Fasciola gigantica isolate B (OM212804)

G

C

T

A

G

C

G

A

T

A

G

A

A

T

A

 

and buffaloes, respectively. The size of the fasciolids in buffaloes was found higher than cattle in most of the morphological measurements, however, the difference was not significant (P>0.05).

 

 

Molecular identification of F. gigantica

Adult fasciolids from 31 populations were sequenced and a 445-448 bp sequence of ITS-1 region of Fasciola species was obtained aligned for intraspecific variation. The intraspecific comparison of Fasciola sequences confirmed the existence of two genotypes i.e., which differed from each other at 15 base positions in the ITS-1 region (Table II). A summary of interspecific variations with nine reference sequences acquired from GenBank is given in Supplementary Table I.

The phylogenetic tree showed Fasciola haplotypes from geographically linked areas are close to each other (Fig. 1). F. gigantica isolate A (OM212803) and F. gigantica isolate B (OM212804) under the current study, fells in a clade with Fasciola species from China and Vietnam. The next clade belongs to F. gigantica from India and Iran. while Egypt and Kenya fluke groups are most distant. Paramphistomum cervi (MW567217) was selected as an outgroup, and the estimates of evolutionary divergence between sequences were 1.37-5.61 (Supplementary Table II).

Table III shows summary of indirect ELISA performed on samples using coproantigens. The copro-ELISA was performed on 85 true positive and 97 true negative coprological samples, and 22 coprological samples were detected false positive (79.44% positive predictive value). The area under curve (AUC) values was 0.991 (95% CI: 0.98-0.99; P<0.0001). A direct relation was observed between false positive (1-specificity) and true positive (sensitivity), further emphasizing the inverse relationship between sensitivity and specificity (Fig. 2A, B). The results showed a diagnostic accuracy of test 89.22% with 100% sensitivity and 82% specificity. The absorbance values denoted the specificity and sensitivity in the form of frequency and a large spread of positive controls was observed when negative and positive controls were plotted on a histogram (Fig. 2C, D).

Prevalence of fasciolosis

The overall prevalence of fasciolosis was 42.7%. The fasciolosis was found significantly (x2 = 12.18, p<0.001) higher in cattle 25.3%, as compared to 17.4% in buffaloes. Similarly, the results showed fasciolosis was significantly (x2 = 5.36, p=0.02) higher in female animals 24.6% compared to males 18.0%. Age-wis results showed the highest infection in >3-6 years of age group was 30.3%, while the 12.4% was found in 1–3 years age group, respectively. However, the association was not statistically significant (x2 =1.49; p>0.05). The scatter graph of individual OD values and cross-reactivity of the assay with other trematode parasites is plotted (Fig. 3A, B) and the association of disease risk factors is given in Supplementary Table III.

 

Table III. Diagnostic test performance by ROC curve and sensitivity and specificity values.

Parameters

Values

95% CI

P value

Copro-ELISA test true positive

85

Copro-ELISA test true negative

97

Copro-ELISA test false positive

22

Copro-ELISA test false negative

0

Area under the ROC curve

Area under curve (AUC)

0.991

0.98-0.99

<0.0001

Std. Error

0.0044

Diagnostic test evaluation 

Sensitivity

100%

95.68-100

<0.0001

Specificity

82%

73.59-87.46

Positive predictive value

79.44%

70.83-86.01

Negative predictive value

100%

96.19-100

Positive likelihood ratio

5.41

3.71-7.89

Accuracy of diagnostic test

89.22%

84.13-93.12

 

 

 

 

DISCUSSION

Fascioliasis is a major veterinary disease all over the world, causing incalculable economic losses in livestock (Menkir et al., 2007). Faeces and liver samples examination recorded a prevalence rate of 28.4-78.0% in tropical countries (Keyyu et al., 2006). Globally, morphological traits and molecular approaches are utilized to distinguish adult trematodes species. The present study shows that the morphological parameters can be used for the differentiation of Fasciola specimens. External morphometric factors, particularly body size and shape, are among these indices. Other researchers have provided useful morphometric descriptions for distinguishing both species (Rouhani et al., 2017).

The current morphometrical analysis showed variations between the Fasciola species obtained from Pakistan with pure standards of F. hepatica from Iran and F. gigantica from Egypt. Considering the measurement and changes observed within the parameters like BL, BW and VS-P in the studied samples, they are likely to be grouped into F. gigantica like species. Because historically it has been suggested that F. gigantica might originate and spread by zebu cattle (Bos indicus) and water buffalo (Bubalus bubalis) in the Indian subcontinent (Amer et al., 2016). These results are in correspondence with the studies conducted by Chaudhry et al. (2020) in Punjab Pakistan. The measurement results agree with Fasciola species identified by Shafiei et al. (2014) in Iran, and Mufti et al. (2011) in Pakistan. In addition, previous studies showed that the incidence of F. gigantica is predominant in Punjab Province (Khan et al., 2009), just like in northern Iran (Ashrafi et al., 2004) due to its tropical and humid rainy climatic conditions where a large livestock industry exists. As most of infection with F. gigantica, found more commonly in tropical and subtropical regions of the world (Mas-Coma et al., 2014). BL, BW, VS-P, indices, and BL/BW ratios were used to identify species in the current investigation, as proposed by prior studies (Lotfy et al., 2002). Fasciola in this study was found to be like Fasciola gigantica from Iran, India, and Egypt, as it shared the common phylogenetic origin and due to the movement of infected animals across the neighboring countries (Periago et al., 2006). F. gigantica has also been found in India and Mauritania (Raina et al., 2015). They have a lot in common with those from Thailand (Srimuzipo et al., 2000). The size of Fasciola adults varies according on the definitive host (Lotfy et al., 2002). F. gigantica in Pakistan is smaller than F. gigantica in Iran (Shafiei et al., 2014) due to the differences in geographical, ecological and other factors effecting parasite morphology. The variations in body length and width of the F. gigantica between the current and previous efforts could be impacted by geography. Despites other factors, the fixing and mounting of the specimens can be compromised too that may also have an impact on some metrics. In the earlier surveys besides, the fixation of single worm between glass slides or between a glass slide and cover slip as against the use of a relaxant in the other studies may have also unnaturally overstretched or distended the flukes (Srimuzipo et al., 2000).

The rDNA ITS-1 and ITS-2 have been used successfully to make an accurate diagnosis (Kostadinova et al., 2003). ITS-1 sequences have been utilized more frequently than any other marker for molecular identification of flukes. Its sequences are extremely reproducible making it very useful in molecular investigations. Although the ITS-I region is considered highly variable for higher-order phylogenetic analysis, the literature suggests that the 3′ end of the ITS-I region is a suitable marker for phylogenetic analysis for all members of the digenetic trematode genus, particularly the Fasciola genus, because this region is highly conserved within species (Hossain et al., 2011). The present study confirmed the existence of two F. gigantica genotypes (accession no. OM212803; OM212804) varied from each other at 15 base positions. Identified F. gigantica ITSI region exhibited close phylogenetic similarities to Chinese and Indian flukes, implying that they may have shared a common phylogenetic relationship. The present F. gigantica ITS-1 showed remarkable similarity 96-100% with F. gigantica ITS1 region from Iran, Vitenam and Kenya. On the other hand, the variation was seen in F. gigantica from Egypt (KF425321) at thirteen distinct nucleotide positions. However, there are hybrid and/or introgressed liver flukes that contain genetic material from both species in ruminants from Vietnam (Seid and Melese, 2018). The findings revealed a high degree of variation in present F. gigantica ITSI region are due to transversion and transition at multiple sites, which could be related to evolutionary pressure and aid in fluke evolution in geographically isolated regions.

The phylogeny backs up the BLAST results (Holder and Lewis, 2003). The current phylogenetic analysis of the ITSI region of F. gigantica shows that they belong to a clade with flukes from neighboring nations, which could explain parasite transmission by infected hosts moving between countries. These resemblances also suggest that they may have had a common evolutionary history. Buffalo and cattle fasciolids had the same base pairs and similar sequences in this study. The Pakistani Fasciola has BLAST results that are like Fasciola from other geographical isolates, indicating that it is related to F. gigantica. Molecular approaches have validated this from Japan, Korea, China, Spain, India, and Turkey based on their ITS-1 sequences distinguishes F. hepatica and F. gigantica (Alasaad et al., 2007). Investigations on ITS-1 and mitochondrial NDI gene sequences in Korea were made to differentiate aspermic Fasciola spp. (Rouhani et al., 2017). These flukes were divided into three haplotypes (Kor1, Kor2, and Kor1/2) based on ITS-1 rDNA, with similar nucleotides to F. hepatica, F. gigantica, and intermediate form, respectively.

Several investigations have been conducted on detection of coproantigen in feces for several helminthes (Lagatie et al., 2020). High level of sensitivity is an essential characteristic of ELISA based assays. In the present study the area under curve values was 0.991 (95% CI: 0.98-0.99; P<0.0001) which showed diagnostic accuracy of test 89.22% with 100% sensitivity and 82% specificity consistent with previous studies (Kowalczyk et al., 2018).

In present investigation, the overall prevalence of fasciolosis was found 42.7% with more infection in cattle as compared to buffaloes, consistent with previous study (Mufti et al., 2011). Different factors such as seasons, precipitation, and soil’s structure are responsible for variable disease prevalence across different regions. However, higher humidity and increased population of snails may result higher prevalence of fasciolosis (Cruz-Mendoza et al., 2011). Significantly higher infection in females 24.6% compared to males 18.0% was obtained, consistent with Phiri et al. (2007). The reason could be higher stress and hormonal influence culminating in immune suppression and increased infection (Rezaul et al., 2015). Age-wise result showed the highest infection in >3-6 years as compared to 1-3 years age group. Similarly, it was recorded that the infection risk varies depending on the age factor as younger animals are less vulnerable to fasciolosis as compared to advanced age cattle (Mufti et al., 2011; Rezaul et al., 2015). This might be the result of higher parasitic access to older animals during grazing as youngers are not allowed to go out for grazing (Mufti et al., 2011).

Conclusion

In conclusion, the morphological and molecular investigations based on the ITS-1 sequences showed Fasciola seen in the Punjab area is like F. gigantica found in China and India. Overall prevalence of fasciolosis was 42.7% with coproantigen ELISA. The assay showed a diagnostic potential of 89.22% and was found suitable for our local setting to find the prevalence of suspected fasciolosis among livestock.

Acknowledgment

Authors would like to thank workers at Abattoir for their help during the sampling period.

Funding

The research work presented in this article is under funding provided by Higher Education Commission of Pakistan under the project grant No: 7402/Federal/NRPU/R&D/HEC/2017.

IRB approval

The study protocol was approved No: BEC-FBS-QAU2017 by Bio Ethical Committee of Quaid-i-Azam University- Islamabad, Pakistan.

Ethical statement

The animals included in the study were slaughtered for other purposes to fulfill the protein demand of the population.

Supplementary material

There is supplementary material associated with this article. Access the material online at: https://dx.doi.org/10.17582/journal.pjz/20220416180444

Statement of conflict of interest

The authors have declared no conflict of interest.

REFERENCES

Afshan, K., Ahmad, I., Komal, M., Firasat, S., Khan, I.A. and Qayyum, M., 2021. Diagnostic efficacy of copro-Elisa for detection of fasciolosis in cattle and buffaloes in Punjab Province, Pakistan. Kafkas Üniv. Vet. Fak. Derg.27: 533-538.

Afshan, K., Valero, M.A., Qayyum, M., Peixoto, R.V., Magraner, A. and Mas-Coma, S., 2014a. Phenotypes of intermediate forms of Fasciola hepatica and F. gigantica in buffaloes from Central Punjab, Pakistan. J. Helminthol.88: 417-426. https://doi.org/10.1017/S0022149X13000369

Afshan, K., Fortes-Lima, C.A., Artigas, P., Valero, M.A., Qayyum, M. and Mas-Coma, S., 2014b. Impact of climate change and man-made irrigation systems on the transmission risk, long-term trend and seasonality of human and animal fascioliasis in Pakistan. Geospat. Hlth.8: 317-334. https://doi.org/10.4081/gh.2014.22

Afshan, K., Jahan, S. and Qayyum, M., 2017. Assessing the validity of Fasciola hepatica ELISA test for immunodiagnosis of small ruminant fasciolosis in Pothwar Region, Pakistan. Pakistan J. Zool.49: 1-5. https://doi.org/10.17582/journal.pjz/2017.49.2.sc5

Afshan, K., Sajid, M., Komal, M., ul Hassan, H.S.Z., Narjis, G. and Firasat, S., 2022. Diagnostic potential of 36-55 kDa somatic antigens of Fasciola gigantica for bovine fasciolosis. Buffalo Bull., 41:49-61.

Ahmad, G. and Nizami, W.A., 1998. Coproantigens: Early detection and suitability of an immunodiagnostic method for echinococcosis in dogs. Vet. Parasitol., 77: 237-244. https://doi.org/10.1016/S0304-4017(98)00124-1

Ahmad, H.I., Majeed, M.B.B., Ahmad, M.Z., Jabbar, A., Maqbool, B., Ahmed, S., Mustafa, H., Simirgiotis, M.J. and Chen, J., 2021. Comparative analysis of the mitochondrial proteins reveals complex structural and functional relationships in Fasciola species. Microb. Pathog.152: 104754. https://doi.org/10.1016/j.micpath.2021.104754

Alasaad, S., Huang, C.Q., Li, Q.Y., Granados, J.E., García-Romero, C., Pérez, J.M. and Zhu, X.Q., 2007. Characterization of Fasciola samples from different host species and geographical localities in Spain by sequences of internal transcribed spacers of rDNA. Parasitol. Res.101: 1245-1250. https://doi.org/10.1007/s00436-007-0628-2

Amer, S., El-Khatam, A., Zidan, S., Feng, Y. and Xiao, L., 2016. Identity of Fasciola spp. in sheep in Egypt. Parasit. Vectors, 9: 1-8. https://doi.org/10.1186/s13071-016-1898-2

Ashrafi, K., Massoud, J., Holakouei, K., Mahmoudi, M., Jouafshani, M., Valero, M.A., Fuentes, M.V., Khoubbane, M., Artigas, P., Bargues, M.D. and Mas, C.S., 2004. Evidence suggesting that Fasciola gigantica might be the most prevalent causal agent of fascioliasis in northern Iran. Iran. J. Publ. Hlth., 33: 31-37.

Chaudhary, A., Shinad, K., Prasadan, P.K. and Singh, H.S., 2020. Phylogenetic position of Pleurogenoides species (Plagiorchiida: Pleurogenidae) from the duodenum of Indian skipper frog, Euphlyctis cyanophlyctis (Amphibia: Dicroglossidae) inhabiting the Western Ghats, India. Helminthologia, 57: 71. https://doi.org/10.2478/helm-2020-0006

Cruz-Mendoza, I., Quiroz-Romero, H., Correa, D. and Gómez-Espinoza, G., 2011. Transmission dynamics of Fasciola hepatica in the Plateau Region of Mexico. Effect of weather and treatment of mammals under current farm management. Vet. Parasitol. 175: 73-79. https://doi.org/10.1016/j.vetpar.2010.09.034

Cwiklinski, K., Donnelly, S., Drysdale, O., Jewhurst, H., Smith, D., Verissimo, C.D.M., Pritsch, I.C., O’Neill, S., Dalton, J.P. and Robinson, M.W., 2019. The cathepsin-like cysteine peptidases of trematodes of the genus FasciolaAdv. Parasitol.104: 113-164. https://doi.org/10.1016/bs.apar.2019.01.001

Farooq, A.A., Lashari, M.H., Akhtar, M.S., Awais, M.M., Inayat, S. and Akhtar, M., 2015. Prevalence of bovine fascioliasis in different commercial and non-commercial dairy farms of District Rajanpur, Punjab, Pakistan. Pak. J. Life Soc. Sci.13: 8-11.

Holder, M. and Lewis, P.O., 2003. Phylogeny estimation: traditional and Bayesian approaches. Nat. Rev. Genet., 4: 275-284. https://doi.org/10.1038/nrg1044

Hossain, M.M., Paul, S., Rahman, M.M., Hossain, F.M.A., Hossain, M.T. and Islam, M.R., 2011. Prevalence and economic significance of caprine fascioliasis at Sylhet district of Bangladesh. Pak. Vet. J., 31: 113–116.

Kalu, E., 2015. Bovine fascioliasis: A review. J. Agric. Vet. Sci., 8: 23-26.

Keyyu, J.D., Kassuku, A.A., Msalilwa, L.P., Monrad, J. and Kyvsgaard, N.C., 2006. Cross-sectional prevalence of helminth infections in cattle on traditional, small-scale and large-scale dairy farms in Iringa district, Tanzania. Vet. Res. Commun., 30: 45-55. https://doi.org/10.1007/s11259-005-3176-1

Khan, M.K., Sajid, M.S., Khan, M.N., Iqbal, Z. and Iqbal, M.U., 2009. Bovine fasciolosis: Prevalence, effects of treatment on productivity and cost benefit analysis in five districts of Punjab, Pakistan. Res. Vet. Sci.87: 70-75. https://doi.org/10.1016/j.rvsc.2008.12.013

Kostadinova, A., Herniou, E.A., Barrett, J. and Littlewood, D.T.J., 2003. Phylogenetic relationships of Echinostoma rudolphi, 1809 (Digenea: Echinostomatidae) and related genera re-assessed via DNA and morphological analyses. Syst. Parasitol.54: 159-176. https://doi.org/10.1023/A:1022681123340

Kowalczyk, S.J., Czopowicz, M., Weber, C.N., Müller, E. and Kaba, J., 2018. Accuracy of a diagnostic model based on serum biochemical parameters in detecting cows at an increased risk of chronic fascioliasis. Vet. Parasitol.254: 15-20. https://doi.org/10.1016/j.vetpar.2018.02.038

Kumar, S., Stecher, G., Li, M., Knyaz, C. and Tamura, K., 2018. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol.35: 1547-1549. https://doi.org/10.1093/molbev/msy096

Lagatie, O., Verheyen, A., Van Hoof, K., Lauwers, D., Odiere, M.R., Vlaminck, J., Levecke, B. and Stuyver, L.J., 2020. Detection of Ascaris lumbricoides infection by ABA-1 coproantigen ELISA. PLoS Negl. Trop. Dis., 14: e0008807. https://doi.org/10.1371/journal.pntd.0008807

Lotfy, W.M., El-Morshedy, H.N., El-Hoda, M.A., El-Tawila, M.M., Omar, E.A. and Farag, H.F., 2002. Identification of the Egyptian species of Fasciola. Vet. Parasitol., 103: 323–332. https://doi.org/10.1016/S0304-4017(01)00613-6

Martinez-Sernandez, V., Orbegozo-Medina, R.A., Gonzalez-Warleta, M., Mezo, M. and Ubeira, F.M., 2016. Rapid enhanced MM3-COPRO ELISA for detection of Fasciola coproantigens. PLoS Negl. Trop. Dis., 10: e0004872. https://doi.org/10.1371/journal.pntd.0004872

Mas-Coma, S., Agramunt, V.H. and Valero, M.A., 2014. Neurological and ocular fascioliasis in humans. Adv. Parasitol., 84: 27–149. https://doi.org/10.1016/B978-0-12-800099-1.00002-8

Mas-Coma, S., Valero, M.A. and Bargues, M.D., 2019. Fascioliasis. Adv. exp. Med. Biol., 1154: 71–103. https://doi.org/10.1007/978-3-030-18616-6_4

McManus, D.P., 2020. Recent progress in the development of liver fluke and blood fluke vaccines. Vaccines8: 553. https://doi.org/10.3390/vaccines8030553

Menkir, M.S., Uggla, A. and Waller, P.J., 2007. Prevalence and seasonal incidence of nematode parasites and fluke infections of sheep and goats in eastern Ethiopia. Trop. Anim. Hlth. Prod., 39: 521-531. https://doi.org/10.1007/s11250-007-9035-z

Mufti, S., Ahmad, M.M., Zafar, Y. and Qayyum, M., 2011. Phenotypic analysis of adult Fasciola spp. from Potohar Region of Northern Punjab, Pakistan. Pakistan J. Zool.43: 1069-1077.

Periago, M.V., Valero, M.A., Panova, M. and Mas-Coma, S., 2006. Phenotypic comparison of allopatric populations of Fasciola hepatica and Fasciola gigantica from European and African bovines using a computer image analysis system (CIAS). Parasitol. Res., 99: 368–378. https://doi.org/10.1007/s00436-006-0174-3

Phiri, A.M., Phiri, I.K., Chota, A. and Monrad, J., 2007. Trematode infections in freshwater snails and cattle from the Kafue wetlands of Zambia during a period of highest cattle–water contact. J. Helminthol., 81: 85-92. https://doi.org/10.1017/S0022149X07387786

Raina, O.K., Jacob, S.S., Sankar, M., Bhattacharya, D., Bandyopadyay, S., Varghese, A., Chamuah, J.K. and Lalrinkima, H., 2015. Genetic characterization of Fasciola gigantica from different geographical regions of India by ribosomal DNA markers. J. Parasit. Dis.39: 27-32. https://doi.org/10.1007/s12639-013-0276-7

Rezaul, K., Mohammad, S.M. and Giasuddin, M.D., 2015. Epidemiological study of ovine fasciolosis: Prevalence and risk factor assessment at Shahjadpur Upazila of Bangladesh. Immunol. Infect. Dis., 3: 25-29. https://doi.org/10.13189/iid.2015.030301

Rouhani, S., Raeghi, S., Mirahmadi, H., Harandi, M.F., Haghighi, A. and Spotin, A., 2017. Identification of Fasciola spp. in the east of Iran, based on the spermatogenesis and nuclear ribosomal DNA (ITS1) and mitochondrial (ND1) genes. Arch. Clin. Infect. Dis.12: e57283. https://doi.org/10.5812/archcid.57283

Sambrook, J., Fritsch, E.F. and Maniatis, T., 1989. Molecular cloning. A laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, NY.

Seid, U. and Melese, M., 2018. Review on prevalence, distribution and economic significance of liver fluke in Ethiopia. ARC J. Anim. Vet. Sci.4: 38-48. https://doi.org/10.20431/2455-2518.0402006

Shafiei, R., Bahador, S., Seyed, M.S., Gholam, R. and Abdolali, M., 2014. Molecular and morphological characterization of Fasciola spp. isolated from different host species in a newly emerging focus of human fascioliasis in Iran. Vet. Med. Intern., 14: 10. https://doi.org/10.1155/2014/405740

Srimuzipo, P., Komalamisra, C., Choochote, W., Jipakdi, A., Vanichthanakorn, P., Keha, P., Riyong, D., Sukontason, K., Komalamisra, N. and Sukontason, K., 2000. Comparative morphometry, morphology of egg and adult surface topography under light and scanning electron microscopies, and metaphase karyotype among three size-races of Fasciola gigantica in Thailand. Southe. Asian J. trop. Med. Publ. Hlth.31: 366-373.

Villa-Mancera, A., Alcalá-Canto, Y., Olivares-Pérez, J., Molina-Mendoza, P., Hernández-Guzmán, K., Utrera-Quintana, F., Carreón-Luna, L., Olmedo-Juárez, A. and Reynoso-Palomar, A., 2021. Vaccination with cathepsin L mimotopes of Fasciola hepatica in goats reduces worm burden, morphometric measurements, and reproductive structures. Microb. Pathog.155: 104859. https://doi.org/10.1016/j.micpath.2021.104859

Yakhchali, M., Malekzadeh-Viayeh, R., Imani-Baran, A. and Mardani, K., 2015. Morphological and molecular discrimination of Fasciola species isolated from domestic ruminants of Urmia city, Iran. Iran. J. Parasitol.10: 46.