Molecular Cloning, Tissue Distribution, and Hypoxia and Ammonia Stress Response of the p38 MAPK of Black Seabream (Acanthopagrus schlegelii)

Jing Wang1, Tiejin Tong1, Yuanchao Zou2, Xiaoling Xu1, Qiang Wu1 and Qingchao Shi2*

1Agricultural College, Yibin Vocational and Technical College, Yibin 644000, China

2Key Laboratory of Sichuan Province for Fishes Conservation and Utilization in the Upper Reaches of the Yangtze River, Neijiang Normal University, Neijiang 641000, Sichuan Province, P. R. China

ABSTRACT

P38 mitogen activated protein kinase (MAPK) has important effects in inflammation and immune regulation. Understanding the molecular characteristics of p38 MAPK would elucidate the environmental stress resistance of cultured fishes. The full-length 2642 bp cDNA of black seabream (Acanthopagrus schlegelii) included a 1083 bp open reading frame that encoded a 360-residue protein. The protein contained a Thr-Gly-Tyr (TGY) double phosphorylation site, an Ala-Thr-Arg-Trp (ATRW) substrate binding site, and a key functional ERK docking (ED) site. Sequence analysis revealed that the p38 MAPK protein of black seabream shared high sequence homology (86–94%) with those of other marine fishes. Quantitative real time-polymerase chain reaction revealed that p38 MAPK was expressed in the heart, brain, spleen, gill, head kidney, muscles, kidneys, intestines, and liver, and the expression was highest and lowest in the spleen and brain, respectively. The splenic expression of p38 MAPK increased significantly after 6 h of ammonia stress (P < 0.05), while its expression in the gills and liver increased significantly after 24 h of ammonia stress (P < 0.05). P38 MAPK expression increased significantly in the spleen, head kidney, and gills following 12 h of hypoxia stress (P < 0.05); however, the expression decreased after 12 h of returning to normoxia. A p38 MAPK was identified and characterized in black seabream, which was highly conserved and expressed in various tissues. Ammonia and hypoxia stress tests revealed that the p38 MAPK of black seabream has important roles in environmental stress responses.


Article Information

Received 26 February 2023

Revised 20 August 2023

Accepted 05 September 2023

Available online 04 March 2024

(early access)

Published 06 May 2025

Authors’ Contribution

Conceptualization, JW. Methodology, TT and XX. Writing-original draft preparation, JW and TT. Writing-review and editing, QW and QS. Supervision, QW and YZ. Funding acquisition, JW. All authors read and approved the final manuscript.

Key words

Ammonia stress, Black seabream, Hypoxia stress, Molecular cloning, p38 MAPK

DOI: https://dx.doi.org/10.17582/journal.pjz/20230226020206

* Corresponding author: [email protected]

0030-9923/2025/0003-1313 $ 9.00/00

Copyright 2025 by the authors. Licensee Zoological Society of Pakistan.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).



INTRODUCTION

Black seabream farming has been increasing in the coastal areas of China in recent years owing to its delicious flesh, high nutritional value, and rapid growth. Ammonia is an important pollutant in the intensive aquaculture environments in the coastal areas of China. According to the study of Murthy et al. (2001), ammonia toxicity causes oxidative stress in fishes and affects their growth. The high breeding density and high temperature of intensive aquaculture practices often cause the oxygen levels in the water to fall below normal. The resulting hypoxia causes shortness of breath, oxidative stress, subsequent head floating, and can eventually be fatal (Raaij et al., 1996). Previous studies have demonstrated that the stress caused by low oxygen and high ammonia levels can damage the immune and antioxidant functions of black seabream and promote inflammation (Shi et al., 2019, 2020). However, the mechanism underlying the damage caused by ammonia and hypoxia stress remains poorly understood to date.

Mitogen-activated protein kinases (MAPK) are a class of intracellular serine/threonine protein kinases, which have important effects in cellular responses to extracellular stimuli (Ono and Han, 2000). The MAPK superfamily comprises four subfamilies, namely, the extracellular regulated kinase (ERK), big MAPK1 (BMK1), C-Jun N-terminal kinase (JNK), and activated protein kinase (SPAK), and p38 MAPK subfamilies, which are involved in different signaling pathways (Garrington and Johnson, 1999; Mahtani et al., 2001). Of these, the p38 MAPK signaling pathway affects a variety of intracellular responses and plays a significant role in the generation of inflammation and response to environmental stress (Raingeaud et al., 1995; Regan and Cohen, 2009; Huang et al., 2011). It has been demonstrated that the activation of the p38 MAPK signaling pathway contributes to the development of inflammation (Herlaar and Brown, 1999) and plays a role in immune regulation by acting on toll-like receptors (Li et al., 2013; Yee and Hamerman, 2013). The production and release of various inflammatory factors, including, pro-inflammatory factors, chemokines, growth factors, cyclooxygenase-2, interleukin (IL)-10, and other factors, depend on the regulation of p38 MAPK, which is in turn activated by various inflammatory factors, such as tumor necrosis factor (TNF)-α, IL-1, and IL-31(Waetzig et al., 2002). The expression of the p38 MAPK gene can also be induced by heat and cold stress as well as microbial infections (Mizoguchi et al., 1996). A variety of algae can alleviate inflammation and stress by downregulating the expression of the p38 MAPK gene (Nakamura et al., 2006; Kim et al., 2011; Sanjeewa et al., 2017). These findings suggest that the stress and inflammation response of black seabream could be in connection with the expression of the p38 MAPK gene.

To date, the majority of studies on p38 MAPK have primarily focused on yeasts, mammals (Wilsbacher et al., 1999), and fishes (Hansen and Jørgensen, 2007; Cai et al., 2011; Zhang et al., 2019); however, there is a scarcity of studies on the complete sequence and functions of the p38 MAPK gene of black seabream. Therefore, the full-length p38 MAPK gene of black seabream was cloned and subjected to functional analysis, following which the changes in gene expression under ammonia and hypoxia stress were also investigated. The results obtained here provide valuable insights for understanding the mechanism underlying the immunity and stress response of black seabream via the p38 MAPK pathway.

MATERIALS AND METHODS

Fish sampling

The samples of black seabream, with a mean body weight of 33.82 g, were kept in fishing nets in offshore rafts (2.5 × 2.5 × 2.5 m) at a water temperature of 24–33°C, dissolved oxygen (DO) level of 7.2 mg L-1, pH range of 7.6–8.0, and under a dark/light cycle of 12 h/12 h. A commercial diet was used twice a day at 6:30 a.m. and 17:30 p.m. to feed fishes, for 2 weeks. After 2 weeks, six black seabream were randomly selected, and their heart, brain, spleen, gills, head kidney, muscle, kidney, intestine, and liver tissues were collected for cloning and analyzing the tissue distribution of p38 MAPK.

Molecular cloning of p38 MAPK

The total RNA was extracted according to the manufacturer’s protocol and the quality of the total RNA was assessed. A 1 μg aliquot of total RNA was subsequently reverse transcribed into cDNA using a PrimeScript RT Reagent Kit. A part of the cDNA sequence of p38 MAPK was obtained from the transcriptome of black seabream, which was obtained in our laboratory by high-throughput DNA sequencing. The 5′-rapid amplification of cDNA ends (RACE) and 3′-RACE were used to obtain the full-length cDNA of p38 MAPK, according to the method described by Zhang et al. (2016). The primers used for cloning the cDNA of p38 MAPK with RACE are enlisted in Table I.

 

Table I. Primers used for cloning and analyzing p38 MAPK expression.

Application

Sequence (5’ → 3’)

RACE

F1 AAGGCGATATGGGAAGTGC

R1 TCTCGGCTCTCAAAGCTCTG

5’- RACE

GSP-51 CGGAGTCGTGCAGCCTGCCTTAAAC

GSP-52 TTGTTCCCCTCTCCGCTTGCTTTCA

3’- RACE

GSP-31 TTCATCGGTGCCAACCCACAAGC

GSP-32 TGGACACAGACAAACGGATAACAGCAGC

p38 MAPK

F -AGACGATATGGGAAGTCCCG

R TGGCGTGGATGATGGACTG

β-actin

F ACAGTGCCCATCTATGAAGGCT

R GGCTGTGGTGGTGAAGGAGTAG

 

Sequence and phylogenetic analyses

The full-length nucleotide and amino acid sequences of the cDNA of the cloned gene were analyzed using NCBI BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi) for determining whether the cloned gene was indeed the target gene. The sequence homologues of the p38 MAPK protein of black seabream were determined, and the cDNA sequences, open reading frame (ORF), and predicted sequence of the encoded protein were analyzed using the DNAMAN software. A multiple sequence alignment of the p38 MAPK protein sequences of black seabream and other fishes was subsequently constructed. A phylogenetic tree was constructed using the Neighbor-Joining method in MEGA7.0 software with 1000 bootstrap replicates for ensuring accuracy.

Ammonia stress tests

A total of 24 black seabream were selected for the ammonia stress experiments following adaptation and 24 h of fasting. For the ammonia stress test, NH4Cl was slowly added until the concentration of ammonia in the bucket was 35 mg L-1, as described in the study by Shi et al. (2020). The liver, gill, spleen, and head kidney were collected before ammonia stress (0 h) and at 6 h, 12 h, and 24 h after stress from six fishes selected randomly at each time point, and subsequently stored at -80°C in a refrigerator for further analyses.

Hypoxia stress tests

Following adaptation and 24 h of fasting, 24 black seabream were randomly selected for the hypoxia stress experiments. Based on literature reports (Shi et al., 2020), the DO in the water was reduced from 7.12 mg L-1 to 2.5 mg L-1 within 30 min by introducing nitrogen into the bucket, and the DO was maintained at 2.5 mg L-1 for 12 h by adjusting the amount of injected air and flushed nitrogen. The nitrogen charge was ceased after 12 h of hypoxia stress. The level of DO in the water was gradually increased to normal after approximately 35 min, and normoxia was maintained for 12 h. The liver, gills, spleen, and head kidneys were collected before hypoxia stress (0 h), after 6 h and 12 h of hypoxia stress, and after 12 h of recovery under normoxia, from six black seabream selected randomly at each time point, and the tissues were stored at -80°C in a refrigerator.

Quantitative real-time polymerase chain reaction (qRT-PCR)

The primers used for qRT-PCR are enlisted in the Table I. The primers were designed based on the nucleotide sequence using the Primer 5.0 software (PREMIER Biosoft International, San Francisco, CA, USA). The qPCR analyses were performed using a Bio-Rad CFX Connect System (Bio-Rad, Hercules, CA, USA). The system and cycling conditions used for qPCR have been previously described in the study by Zhang et al. (2019). The relative gene expression levels were normalized to those of avian β-actin using the 2-ΔΔCt method.

Statistical analyses

The statistical analyses were performed using SPSS 22.0 (IBM Corp., Armonk, NY, USA). All the data were statistically analyzed by one-way analysis of variance (ANOVA) for multiple comparisons among groups, and assessed by Duncan’s multiple range tests. The differences were considered to be statistically significant at P ˂ 0.05. Data were showed as the mean and pooled standard error of mean (SEM).

RESULTS

Cloning and characterization of p38 MAPK

As depicted in Figure 1, the p38 MAPK cDNA of black seabream was 2642 bp long, and comprised a 277 bp 5′-untranslated region, a 1083 bp ORF, and a 1282 bp 3′-untranslated region. The 3′-terminal contained a poly A tail, but lacked a polyadenylate AATAA plus tail signal. The ORF of the p38 MAPK gene of black seabream encodes a protein of 360 amino acids with an estimated molecular mass of 41.6 KDa and a theoretical isoelectric point of 5.63. Conserved domain analysis revealed that the p38 MAPK protein of black seabream contains a conserved serine/threonine protein kinase catalytic region (S-TKc) structural domain, which possibly belongs to the protein kinase c (PKc) superfamily.

 

Homology and phylogenetic analyses of p38 MAPK

A multiple sequence alignment of the p38 MAPK proteins of black seabream, spiny-spined gill seabream, spotted grouper, sea bass, zebrafish, human, and protochickens revealed a high degree of sequence conservation in the proteins, as depicted in Table II and Figure 2. Sequence comparison further revealed highly conserved in the Thr-Gly-Tyr (TGY) bisphosphorylation site, substrate Ala-Thr-Arg-Trp (ATRW) binding site, and the ERK docking (ED) site of the aforementioned p38 MAPK proteins.

The phylogenetic tree was constructed and the sequence numbers used are shown in Tables III. The results of phylogenetic tree analyses (Fig. 3) revealed that the p38 MAPK protein of black seabream shared highest similarity with the p38 MAPK protein of Acanthochromis polyacanthus, with 94% homology.

 

Table II. Sequence identity between the p38 MAPK protein of black seabream and those of other organisms selected for constructing the phylogenetic tree.

Scientific name of organism

Amino acid sequence identity (%)

Acanthochromis polyacanthus

94

Epinephelus coioides

92

Dicentrarchus labrax

88

Homo sapiens

88

Danio rerio

86

Gallus sp.

86

Crotalus adamanteus

85

Anolis carolinensis

85

Rattus norvegicus

84

Mus musculus

84

Canis lupus familiaris

84

Felis catus

84

Ailuropoda melanoleuca

84

Oryctolagus cuniculus

84

Sus scrofa

84

Pongo abelii

84

Xenopus tropicalis

83

Litopenaeus vannamei

73

Bemisia tabaci

73

Penaeus japonicus

72

Nasonia vitripennis

72

Apis cerana cerana

72

Acromyrmex echinatior

72

Camponotus floridanus

72

Harpegnathos saltator

72

Danaus plexippus

71

Bombyx mori

71

Aedes aegypti

70

Crassostrea gigas

69

Sarcophaga crassipalpis

68

Drosophila melanogaster

66

Larimichthys crocea

58

Saccharomyces cerevisiae

50

 

The p38 MAPK protein of black seabream shared 92%, 88%, and 86% sequence homology with the p38 MAPK of spotted grouper (Epinephelus analogus), sea bass (Dicentrarchus labrax), and zebrafish (Danio rerio), respectively, and 58% sequence homology with the p38 MAPK of rhubarb (Larimichthys crocea). However, the p38 MAPK protein of black seabream was most distant to that the p38 MAPK of yeast (Saccharomyces cerevisiae), with a similarity of 50%. Phylogenetic analysis revealed that the p38 MAPK of black seabream clustered with the p38 MAPK of other vertebrates and was closely related to the p38 MAPK of the spiny chromis (Acanthochromis polyacanthus).

 

Tissue distribution of p38 MAPK

The expression of p38 MAPK mRNA in the different tissues of black seabream is depicted in Figure 4. P38 MAPK mRNA was expressed in the heart, brain, spleen, gill, head kidney, muscles, kidneys, intestines, and liver tissues of black seabream, but a higher expression of p38 MAPK mRNA was observed in the spleen and head kidney, while the expression was relatively low in the heart and brain.

Expression of p38 MAPK mRNA following ammonia stress

The effect of ammonia stress on the expression of p38 MAPK mRNA in the spleen, head kidney, gills, and liver tissues of black seabream is depicted in Figure 5.

The relative expression levels of p38 MAPK mRNA were upregulated in the spleen, head kidney, gills, and liver tissues of black seabream following ammonia stress (P < 0.05). The findings also revealed that compared to that in the pre-stress (0 h) condition, the splenic p38 MAPK expressed significantly higher after 6 h and 12 h of ammonia stress, while p38 MAPK in the head kidney expressed significantly higher after 12 h of ammonia stress.

 

 

 

 

Expression of p38 MAPK mRNA after hypoxia stress

The effect of hypoxia stress on the mRNA expression of p38 MAPK in the spleen, head kidney, gills, and liver tissues of black seabream is depicted in Figure 6. The relative expression levels of p38 MAPK mRNA in the spleen, head kidney, and gills of black seabream were upregulated following hypoxia stress, and the expression was highest after 12 h of hypoxia stress (P < 0.05). The expression of p38 MAPK decreased in the spleen and head kidney after 12 h of recovery, and was significantly lower than that after 12 h of hypoxia stress (P < 0.05). The findings also revealed that hypoxia stress and post-stress recovery had no effect on the hepatic expression of p38 MAPK (P > 0.05).

 

Table III. Information of the p38 MAPK from other species used for phylogenetic tree construction.

Species

Gene

Accession number

Litopenaeus vannamei

p38 MAPK

AFL70597.1

Penaeus japonicus

MAPK 14

BAK78916.1

Harpegnathos saltator

MAPK 14B

EFN89763.1

Bombyx mori

p38 MAPK

NP_001036996.1

Danaus plexippus

p38 MAPK

EHJ76051.1

Camponotus floridanus

MAPK 14B

EFN66664.1

Apis cerana cerana

p38 MAPK

ADT91683.1

Acromyrmex echinatior

MAPK 14B

EGI59042.1

Aedes aegypti

p38 MAPK

XP_001653240.1

Nasonia vitripennis

p38 MAPK

NP_001136337.1

Bemisia tabaci

p38 MAPK

AEA92685.1

Dicentrarchus labrax

MAPK 14a

CBN80893.1

Sarcophaga crassipalpis

p38 MAPK

BAF75366.1

Xenopus tropicalis

MAPK 14

NP_001005824.1

Epinephelus coioides

p38a MAPK

AEU04194.1

Danio rerio

MAPK 14b

AAH63937.1

Crotalus adamanteus

MAPK 14-like

AFJ50620.1

Gallus

MAPK 14 isoform X1

XP_001232616.1

Felis catus

MAPK 14 isoform X1

XP_003986110.1

Ailuropoda melanoleuca

MAPK 14 isoform X1

XP_002914341.1

Canis lupus familiaris

MAPK 14

NP_001003206.1

Crassostrea gigas

MAPK 14

EKC29510.1

Sus scrofa

MAPK 14 isoform X1

XP_001929525.3

Anolis carolinensis

MAPK 14 isoform X2

XP_003226523.1

Rattus norvegicus

p38 MAPK

AAC71059.1

Pongo abelii

MAPK 14 isoform X1

XP_002816848.1

Oryctolagus cuniculus

MAPK 14 isoform X1

XP_002714691.1

Mus musculus

MAPK 14 isoform 1

NP_036081.1

Drosophila melanogaster

p38a MAPK

AAC39030.1

Homo sapiens

MAPK 14 isoform 1

NP_001306.1

Saccharomyces cerevisiae

HOG1 protein

AAA34680.1

Larimichthys crocea

MAPK 14A

XP_010737771.1

Acanthochromis polyacanthus

MAPK 14A-like transcript variant X2

XM_022203546.1

 

DISCUSSION

MAPKs are a class of intracellular serine/threonine protein kinases that transmit extracellular signals into the intracellular compartment via a phosphorylation reaction cascade and had a vital role in cellular responses to extracellular stimuli (Ono and Han, 2000). The MAPK superfamily comprises four subfamilies that are involved in different signaling pathways, of which the p38 MAPK signaling pathway had significant effects in stress and inflammation (Nakamura et al., 2006; Kim et al., 2011; Sanjeewa et al., 2017).

In this study, primers were designed according to the conserved sequence of p38 MAPK of marine fishes, and the p38 MAPK gene of black seabream was cloned by qRT-PCR and RACE to obtain the full length 2642 bp cDNA,

containing a 1083 bp ORF that encodes a protein of 360 residues. The findings revealed that a high sequence similarity between the p38 MAPK gene of black seabream and those of Atlantic salmon (Hansen and Jørgensen, 2007), spotted grouper (Cai et al., 2011), groupers (Zhang et al., 2019), and silver carp (Li et al., 2016), which suggested that the p38 MAPK gene is highly conserved in fishes. Further analysis revealed that the cloned p38 MAPK protein of black seabream contained a highly conserved S-TKc domain and three highly conserved sites, including the TGY (Thr-Gly-Tyr) double phosphorylation site, ATRW substrate binding site, and ED site, which mediate the functions of p38 MAPK (Akella et al., 2008; Sheridan et al., 2008; Robert, 2012). The findings strongly suggested that the functions of the p38 MAPK protein of black seabream cloned in this study are similar to those of the p38 MAPK of other species of fish. The results of sequence homology analysis demonstrated that the amino acid sequence of the p38 MAPK of black seabream cloned herein shared high homology (86–94%) with the p38 MAPK of other marine fishes. Phylogenetic analysis also demonstrated that the cloned p38 MAPK of black seabream was closely related to the p38 MAPK of spiny chromis. Altogether, the findings indicated that the p38 MAPK of black seabream cloned belongs to the p38 MAPK family, which is highly conserved in fishes.

The p38 MAPK gene of black seabream was found to be expressed in all the tissues examined, with highest expressed in the spleen, head kidney, and gill. Results here were consistent with the findings of the study by Zhang et al. (2019). Spleen and head kidneys are important immune organs in fishes (Bromage et al., 2004; Zwollo et al., 2008), and the high expression of p38 MAPK in both these immune organs indicated that the p38 MAPK of black seabream has immune-related functions. The findings further revealed that the expression of p38 MAPK was also high in the gills, which could be attributed to the ion regulatory function of p38 MAPK. Marshall et al. (2017) reported that p38 MAPK are distributed throughout ionocytes, especially in regions lacking the sodium potassium chloride cotransporter (NKCC). It has also been demonstrated that osmotic stress can upregulate the gene expression of p38 MAPK and activate the p38 MAPK signaling pathway (Takei and Hwang, 2016).

The levels of ammonia and DO are important factors that affect the aquatic environment of fishes. Ammonia toxicity causes oxidative stress in fishes and affects their growth (Murthy et al., 2001). Hypoxia causes shortness of breath, oxidative stress, subsequent head floating, and can eventually lead to fatality (Raaij et al., 1996). The p38 MAPK protein had significant effects in regulating the inflammatory response, environmental stress, and immune response via lymphocytes and macrophages (Raingeaud et al., 1995; Regan et al., 2009; Huang et al., 2011). It has been reported that heat and cold stress as well as microbial infections can induce the expression of the p38 MAPK gene (Mizoguchi et al., 1996). Therefore, the expression of the p38 MAPK gene was investigated in this study following individual exposure to hypoxia and ammonia stress. The study demonstrated that both hypoxia and ammonia stress increased the expression of p38 MAPK, which suggested that the p38 MAPK of black seabream plays a role in the environmental stress response. The findings revealed a tissue-specific variability in the hypoxia and stress response, and the spleen and head kidneys were the most sensitive to these stressors, while the gills and liver were the least sensitive. The tissue distribution of p38 MAPK in black seabream observed in this study was similar to that observed in a previous report on blunt snout bream (Zhang et al., 2019). As the spleen and head kidney of fishes are important immune organs, the p38 MAPK-mediated stress response of black seabream could be mediated via inflammatory. Previous studies have in fact demonstrated that p38 MAPK can partake in immunomodulatory responses via Toll-like receptors (Li et al., 2013; Yee and Hamerman, 2013).

The present study further revealed that individual exposure to hypoxia and ammonia stress upregulated the splenic expression of p38 MAPK at an early stage of stress (6 h), which was possibly mediated by the intracellular inflammatory factor, TNF-α. Stress causes an inflammatory response in the body and triggers cells to secrete TNF-α, which activates p38 MAPK and the p38 MAPK signaling pathway (Waetzig et al., 2002). The body also produces large quantities of reactive oxygen species under stress, which can directly oxidize the cysteine residues of MAPK signaling molecules to activate MAPK and upregulate the expression of p38 MAPK (Day and Veal, 2010).

conclusion

The present study identified and characterized a p38 MAPK in black seabream (Acanthopagrus schlegelii), which was highly conserved and expressed in various tissues. The ammonia and hypoxia stress tests revealed that the p38 MAPK of black seabream plays a vital role in the environmental stress response of this species. The study provides important insights for further investigation of the mechanism underlying the immune stress resistance of black seabream via p38 MAPK.

Acknowledgement

The authors are grateful to all staff member of Shantou University Nan’ao Coastal Experimental Station for providing the required facilities to conduct this study

Funding

This research was funded by the Research Foundation for Advanced Talents of Yibin Vocational and Technical College (ybzysc21bk08) and the Projects of Sichuan Provincial Department of science and technology [No. 2021YFN0033; No. 2021YFS0359].

IRB approval

The animal experiments performed in this work were in strict accordance with the National Research Council’s Guide for the Care and Use of Laboratory Animals and experimental protocol and procedure authorized by the Animal Care and Use Committee of Yibin Vocational and Technical College (AEC-YVTC-20220106).

Ethical statement

This study was conducted in accordance with the requirements of the National Research Council’s Guide for the Care and Use of Laboratory Animals and was approved by the Animal Care and Use Committee of Yibin Vocational and Technical College.

Statement of conflict of interest

The authors have declared no conflict of interest.

REFERENCES

Akella, R., Moon, T.M. and Goldsmith, E.J., 2008. Unique MAP Kinase binding sites. Biochim. biophys. Acta, 1784: 48-55. https://doi.org/10.1016/j.bbapap.2007.09.016

Bromage, E.S., Kaattari, I.M., Patty, Z. and Kaattari, S.L., 2004. Plasmablast and plasma cell production and distribution in trout immune tissues. J. Immunol., 173: 7317-7323. https://doi.org/10.4049/jimmunol.173.12.7317

Cai, J., Huang, Y., Wei, S., Huang, X., Ye, F., Fu, J. and Qin, Q., 2011. Characterization of p38 MAPKs from orange-spotted grouper, Epinephelus coioides involved in SGIV infection. Fish Shellfish Immunol., 31: 1129-1136. https://doi.org/10.1016/j.fsi.2011.10.004

Day, A.M. and Veal, E.A., 2010. Hydrogen peroxide-sensitive cysteines in the Sty1 MAPK regulate the transcriptional response to oxidative stress. J. biol. Chem., 285: 7505-7516. https://doi.org/10.1074/jbc.M109.040840

Garrington, T.P. and Johnson, G.L., 1999. Organization and regulation of mitogen-activated protein kinase signaling pathways. Curr. Opin. Cell Biol., 11: 211-218. https://doi.org/10.1016/S0955-0674(99)80028-3

Hansen, T.E. and Jørgensen, J.B., 2007. Cloning and characterisation of p38 MAP kinase from Atlantic salmon: A kinase important for regulating salmon TNF-2 and IL-1β expression. Mol. Immunol., 44: 3137-3146. https://doi.org/10.1016/j.molimm.2007.02.006

Herlaar, E. and Brown, Z., 1999. p38 MAPK signalling cascades in inflammatory disease. Mol. Med. Today, 5: 439-447. https://doi.org/10.1016/S1357-4310(99)01544-0

Huang, X., Huang, Y., Ouyang, Z., Cai, J., Yan, Y. and Qin, Q., 2011. Roles of stress-activated protein kinases in the replication of Singapore grouper iridovirus and regulation of the inflammatory responses in grouper cells. J. Gen. Virol., 92: 1292-1301. https://doi.org/10.1099/vir.0.029173-0

Kim, A.R., Lee, M.S., Shin, T.S., Shin, T.S., Hua, H., Jang, B.C., Choi, J.S., Byun, D.S., Utsuki, T., Ingram, D. and Kim, H.R., 2011. Phlorofucofuroeckol A inhibits the LPS-stimulated iNOS and COX-2 expressions in macrophages via inhibition of NF-κB, Akt, and p38 MAPK. Toxicol. In Vitro, 25: 1789-1795. https://doi.org/10.1016/j.tiv.2011.09.012

Li, D., Lei, H., Li, Z., Li, H., Wang, Y. and Lai, Y., 2013. A novel lipopeptide from skin commensal activates TLR2/CD36-p38 MAPK signaling to increase antibacterial defense against bacterial infection. PLoS One, 8: e58288. https://doi.org/10.1371/journal.pone.0058288

Li, X., Ma, J. and Li, Y., 2016. Molecular cloning and expression determination of p38 MAPK from the liver and kidney of silver carp. J. Biochem. mol. Toxicol., 30: 224-231. https://doi.org/10.1002/jbt.21781

Mahtani, K.R., Brook, M., Dean, J.L., Sully, G., Saklatvala, J. and Clark, R.A., 2001. Mitogen-activated protein kinase p38 controls the expression and posttranslational modification of tristetraprolin, a regulator of tumor necrosis factor alpha mRNA stability. Mol. Cell Biol., 21: 6461-6469. https://doi.org/10.1128/MCB.21.9.6461-6469.2001

Marshall, W.S., Rrf, C. and Spieker, M., 2017. WNK1 and p38-MAPK distribution in ionocytes and accessory cells of euryhaline teleost fish implies ionoregulatory function. Biol. Open, 6: 956-966. https://doi.org/10.1242/bio.024232

Mizoguchi, T., Irie, K., Hirayama, T., Hayashida, N., Yamaguchi-Shinozaki, K., Matsumoto, K. and Shinozaki, K., 1996. A gene encoding a mitogen-activated protein kinase is induced simultaneously with genes for a mitogen-activated protein kinase and an S6 ribosomal protein kinase by touch, cold, and water stress in Arabidopsis thaliana. Proc. natl. Acad. Sci., 93: 765-769. https://doi.org/10.1073/pnas.93.2.765

Murthy, C.R., Rao, K.V., Bai, G. and Michael, D.N., 2001. Ammonia-induced production of free radicals in primary cultures of rat astrocytes. J. Neurosci. Res., 66: 282–288. https://doi.org/10.1002/jnr.1222

Nakamura, T., Suzuki, H., Wada, Y., Kodama, T. and Doi, T., 2006. Fucoidan induces nitric oxide production via p38 mitogen-activated protein kinase and NF-kappaB-dependent signaling pathways through macrophage scavenger receptors. Biochem. biophys. Res. Commun., 343: 286-294. https://doi.org/10.1016/j.bbrc.2006.02.146

Ono, K. and Han, J., 2000. The p38 signal transduction pathway activation and function. Cell Signal, 12: 1-13. https://doi.org/10.1016/S0898-6568(99)00071-6

Raaij, M.T.M.V., Pit, D.S.S., Balm, P.H.M., Steffens, A.B. and Thillart, G., 1996. Behavioral strategy and the physiological stress response in rainbow trout exposed to severe hypoxia. Horm. Behav., 30: 85–92. https://doi.org/10.1006/hbeh.1996.0012

Raingeaud, J., Gupta, S., Rogers, J.S., Dickens, M., Han, J.H., Ulevitch, R.J. and Davis, R.J., 1995. Pro-inflammatory cytokines and environmental stress cause p38 Mitogen-activated protein kinase activation by dual phosphorylation on tyrosine and threonine. J. biol. Chem., 270: 7420-7426. https://doi.org/10.1074/jbc.270.13.7420

Regan, A.D., Cohen, R.D. and Whittaker, G.R., 2009. Activation of p38 MAPK by feline infectious peritonitis virus regulates pro-inflammatory cytokine production in primary blood-derived feline mononuclear cells. J. Virol., 384: 135-143. https://doi.org/10.1016/j.virol.2008.11.006

Robert, R., 2012. MEK1/2 dual-specificity protein kinases: Structure and regulation. Biochem. biophys. Res. Commun., 417: 5-10. https://doi.org/10.1016/j.bbrc.2011.11.145

Sanjeewa, K.K., Fernando, I.P., Kim, E.A., Ahn, G., Jee, Y.H. and Jeon, Y.J., 2017. Anti-inflammatory activity of a sulfated polysaccharide isolated from an enzymatic digest of brown seaweed Sargassum horneri in RAW 264.7 cells. Nutr. Res. Pract., 11: 3-10. https://doi.org/10.4162/nrp.2017.11.1.3

Sheridan, D.L., Yong, K., Parker, S.A., Dalby, K.N. and Turk, B.E., 2008. Substrate discrimination among mitogen-activated protein kinases through distinct docking sequence motifs. J. biol. Chem., 283: 19511-19520.

Shi, Q.C., Wen, X.B., Zhu, D.S., Aweya, J.J. and Li, S.K., 2019. Protective effects of Sargassum horneri against ammonia stress in juvenile black sea bream, Acanthopagrus schlegelii. J. appl. Phycol., 31: 1445-1453. https://doi.org/10.1007/s10811-018-1637-5

Shi, Q.C., Yu, C.Q. and Zhu, D.S., 2020. Effects of dietary Sargassum horneri on resisting hypoxia stress, which changes blood biochemistry, antioxidant status, and hepatic HSP mRNA expressions of juvenile black sea bream Acanthopagrus schlegelii. J. appl. Phycol., 32: 3457–3466. https://doi.org/10.1007/s10811-020-02132-1

Takei, Y. and Hwang, P.P., 2016. 6-Homeostatic responses to osmotic stress. Fish Physiol., 35: 207-249. https://doi.org/10.1016/B978-0-12-802728-8.00006-0

Waetzig, G.H., Seegert, D., Rosenstiel, P., Nikolaus, S. and Schreiber, S., 2002. p38 Mitogen-activated protein kinase is activated and linked to TNF-α signaling in inflammatory bowel disease. J. Immunol., 168: 5342-5351. https://doi.org/10.4049/jimmunol.168.10.5342

Wilsbacher, J.L., Goldsmith, E.J. and Cobb, M.H., 1999. Phosphorylation of MAP kinases by MAP/ERK involves multiple regions of MAP kinases. J. biol. Chem., 274: 16988-16994. https://doi.org/10.1074/jbc.274.24.16988

Yee, N.K. and Hamerman, J.A., 2013. β2 integrins inhibit TLR responses by regulating NF-κB pathway and p38 MAPK activation. Eur. J. Immunol., 43: 779-792. https://doi.org/10.1002/eji.201242550

Zhang, C.N., Rahimnejad, S., Lu, K.L., Zhou, W.H. and Zhang, J.L., 2019. Molecular characterization of p38 MAPK from blunt snout bream (Megalobrama amblycephala) and its expression after ammonia stress, and lipopolysaccharide and bacterial challenge. Fish Shellfish Immunol., 84: 848-856. https://doi.org/10.1016/j.fsi.2018.10.074

Zhang, C.N., Zhang, J.L., Wu, Q.J., Gao, X.C. and Ren, H.T., 2016. Cloning, char acterization and mRNA expression of interleukin-6 in blunt snout bream (Megalobrama amblycephala). Fish Shellfish Immunol., 54: 639–647. https://doi.org/10.1016/j.fsi.2016.03.005

Zwollo, P., Haines, A., Rosato, P. and Gumulak-Smith, J., 2008. Molecular and cellular analysis of B-cell populations in the rainbow trout using Pax5 and immunoglobulin markers. Dev. Comp. Immunol., 32: 1482-1496. https://doi.org/10.1016/j.dci.2008.06.008