Research Article
Age-Dependent Changes in Muscle Regulatory Factors and Glycogen in Broiler Chickens: A Histological and Molecular Study
Nabeel Abd Murad Al-Mamoori*, Haneen Abdul Ameer Abbas**
Department of Anatomy and histology, College of Veterinary Medicine, University of Al- Qadisiyah, Iraq.
Abstract | Muscle regulatory factors (MYF5 and MYOG) and myosin heavy chain isoform (MYH7) play a crucial role in muscle development and adaptation, making them key candidate genes for muscle growth traits in chickens. This study examined glycogen content and the expression of MYF5, MYOG and MYH7 genes in the Iliotibialis muscle of broiler chickens. Fresh muscle samples were collected from the Iliotibialis muscle at 7, 21, and 38 days of age. Histological techniques were employed to evaluate muscle fiber structure, connective tissue thickness, and glycogen distribution. Muscle fiber area, bundle area, and connective tissue thickness peaked at 38 days and were lowest at 7 days. PAS staining intensity progressively increased with age, suggesting greater glycogen accumulation in older broilers. Quantitative real-time PCR (qPCR) was performed to analyze the mRNA expression levels of MYF5, MYOG, and MYH7. At 7 days, MYF5 showed the highest expression, while MYH7 had the lowest. At 21 days, no significant differences in gene expression were detected. However, at 38 days, MYOG exhibited the highest expression, while MYF5 was at its lowest level. These results underscore the dynamic involvement of muscle regulatory genes in iliotibialis muscle development. The results suggest a correlation between gene expression changes and muscle fiber adaptation during growth, emphasizing the importance of MYH7, MYF5, and MYOG in regulating muscle composition in broiler chickens.
Keywords | Broiler chicken, Iliotibialis muscle, Glycogen, MYF5, MYH7, MYOG
Received | April 01, 2025; Accepted | May 17, 2025; Published | June 02, 2025
*Correspondence | Nabeel Abd Murad Al-Mamoori, Haneen Abdul Ameer Abbas, Department of Anatomy and histology, College of Veterinary Medicine, University of Al- Qadisiyah, Iraq; Email: [email protected], [email protected]; [email protected]
Citation | Al-Mamoori NAM, Abbas HAA (2025). Age-dependent changes in muscle regulatory factors and glycogen in broiler chickens: A histological and molecular study. Adv. Anim. Vet. Sci. 13(7): 1424-1434.
DOI | https://dx.doi.org/10.17582/journal.aavs/2025/13.7.1424.1434
ISSN (Online) | 2307-8316; ISSN (Print) | 2309-3331
Copyright: 2025 by the authors. Licensee ResearchersLinks Ltd, England, UK.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
INTRODUCTION
Broiler chickens play a crucial role in the global food supply, serving as a rich source of protein for populations worldwide (Ozentürk et al., 2025). They are recognized for their high nutritional value and affordability when compared to other meats and animal products (Cavani et al., 2009; Petracci et al., 2015; Tallentire et al., 2016). Furthermore, Kong et al. (2017), Maharjan et al. (2021), and Yousefi et al. (2024) highlighted that broiler chickens are characterized by their rapid growth and efficient feed-to-meat conversion, which has been a driving force in the development of the poultry industry, making it a reliable source of affordable animal protein on a global scale. The preference for broiler chicken meat is influenced by various factors, including its lower fat content, higher protein concentration, and superior digestibility compared to red meats (Tallentire et al., 2016). In broilers, skeletal muscles, particularly the pectoral and thigh muscles, play a pivotal role in meat production, as these muscles constitute the largest portion of the meat mass in poultry raised for consumption (Maharjan et al., 2021).
Growth is a key characteristic in poultry production, as it directly influences both the growth rate and size of poultry, which in turn affects overall productivity in the industry. Therefore, investigating the genetic factors that regulate these traits is vital for enhancing poultry farming outcomes (Wei et al., 2016). Moreover, gene expression provides valuable insight into how various genes influence muscle fiber development, ultimately affecting both the quality of meat and the nature of muscle growth in chickens (Du et al., 2017). Muscle regulatory factors (MRFs), such as MYF5, MYF6 (MRF4), MYOD, and MYOG, play pivotal roles in muscle development and growth, making them crucial candidate genes for meat production traits in chickens (Yin et al., 2014; Zhang et al., 2018). This study aimed to investigate the age-related changes in skeletal muscle growth in broiler chickens (Gallus gallus domesticus) by combining histochemical analysis with gene expression studies. Specifically, this study focus on two key myogenic regulatory factors (MYF5 and MYOG) and one myosin heavy chain isoform (MYH7) across three developmental stages (7, 21, and 38 days) in the iliotibialis muscle. Unlike previous studies that predominantly examined the pectoralis major muscle, this study specifically focuses on the iliotibialis muscle, a major locomotor muscle in broiler chickens. Given its essential function in supporting body weight and enabling movement, analyzing the iliotibialis muscle offers unique insights into the molecular and structural adaptations of muscle development, which remain less explored compared to the extensively studied breast muscles.
.MATERIAL AND METHODS
Ethical Approval
Ethical approval for this study was obtained from the Ethics Committee of the College of Veterinary Medicine, University of Al-Qadisiyah, Iraq, under reference number 5051. Approval was granted prior to the commencement of sample collection.
Collection of Specimens
Specimens were collected from a commercial broiler farm in Al-Diwaniyah Governorate between 15 October and 21 November 2024. A total of 15 broiler chickens (Gallus gallus domesticus) were selected and categorized into three age groups: 7 days (first group), 21 days (second group), and 38 days (third group, marketing age). The chickens were reared under optimal environmental conditions. Specimens from the central iliotibialis muscle were collected to analyze histology, glycogen content, and expression of MYF5, MYOG, and MYH7. For histological examination, specimens were immediately fixed in 10% neutral buffered formalin (NBF), while additional samples were preserved in TRIzol (SRCr Green-Zol reagent) for real-time polymerase chain reaction (RT-PCR) analysis.
Histochemical Process of Tissue
Fixed specimens were immersed in 10% neutral buffered formalin (NBF) for 48 hours, followed by thorough washing with tap water for 2 hours. Tissue processing included dehydration through a graded series of ethanol concentrations, beginning at 60% and progressing to 100%. Specimens were then cleared in xylene for 5 minutes, infiltrated with paraffin wax twice for 2 hours, and subsequently embedded in paraffin blocks. Tissue sections of 5 µm thickness were prepared and mounted on glass slides. Histological staining was performed using (H and E) and Masson’s trichrome to examine the general muscle structure, while Periodic acid–Schiff (PAS) staining was used to detect glycogen accumulation within the muscle tissues and the staining intensity was assessed using ImageJ software. The prepared sections were allowed to adhere for 24 hours (Luna, 1968).
Gene Expression Study
Fresh muscle specimens for gene expression analysis were collected from three age groups. For each age group, samples were obtained from five individual broiler chickens (n = 5), serving as biological replicates. Specimens were collected from the same regions as those used in the histochemical analysis. Each specimen, weighing approximately 100 mg, was immediately placed in an Eppendorf tube containing an appropriate volume of TRIzol® reagent for total RNA extraction. The samples were then stored at freezer until all specimens were collected and processed for analysis. The expression levels of MYF5, MYOG, and MYH7 were quantified and normalized against the housekeeping gene GAPDH using the RT-qPCR technique. The primers were used in this study, as presented in (Table 1).
Total RNA extraction and estimation: Total RNA was extracted from muscle tissue using TRIzol® (Bioneer, Korea) per the manufacturer’s protocol. The purity and concentration of the extracted RNA were evaluated using a Nanodrop spectrophotometer by measuring the absorbance ratio at 260/280 nm. The RNA samples were subsequently preserved at -20°C.
Nase 1 Treatment and cDNA synthesis: To eliminate any potential genomic DNA contamination from the extracted RNA, the total RNA samples were treated with DNase I enzyme (Promega, USA). Following this, cDNA synthesis was carried out using the M-MLV Reverse Transcriptase kit, following the manufacturer’s protocol.
Table 1: Represented the primers and sequence of target genes.
|
Primer |
Sequence (5'-3') |
Product size |
Amplicon |
|
|
MYF5 gene |
F |
CAAAGCCTGCAAGAGGAAATCC |
103bp |
NM_001030363.2 |
|
R |
CAAGGTCTCGAATGCTTGGTTC |
|||
|
MYOG gene |
F |
AAAACTGAGCTGGCGCAAAG |
144bp |
NM_204184.2 |
|
R |
GGAAAGGATTTGGGCGGTTTC |
|||
|
MYH7 gene |
F |
TGCTGCTCATCACCAACAAC |
108bp |
NM_001001302.2 |
|
R |
AAGCACTATCGGTTGCCAAC |
|||
|
GAPDH gene |
F |
TGGCATTGCACTGAATGACC |
86bp |
NM_204305.2 |
|
R |
TCAAGTCCACAACACGGTTG |
|||
Preparation of qPCR master mix and thermal cycling conditions: The qPCR master mix was prepared using the GoTaq® qPCR Master Mix kit (Promega, USA), which includes SYBR Green dye for the amplification of the target genes MYF5, MYOG, and MYH7, with the housekeeping gene GAPDH. The preparation and amplification were performed following the protocol provided by the manufacturer.
Data analysis of RT-qPCR: The relative gene expression levels were determined using the ΔCT method, with GAPDH serving as the reference gene. The following equation was used for this analysis:
Gene expression ratio = 2^- ΔCT
Where, ΔCT = CT (Reference gene) – CT (Target gene)
Statistical analysis was performed using the SPSS software. The mean values and standard errors for muscle fiber area, muscle bundle area, connective tissue layer thickness, and the expression levels of MYF5, MYOG, and MYH7 genes were calculated. A univariate analysis of variance was conducted, followed by a least significant difference (LSD) test with a significance level of P ≤ 0.05 to compare differences between the groups.
Table 2: Represented the thickness of connective tissue layers, the muscle fiber area, and the muscle bundle area in the Iliotibialis at 7, 21, and 38 days of age of the broiler chickens.
|
Parameters |
7 days of age |
21 days of age |
38 days of age |
|
Epimysium (µm) |
11.397±0.603 |
20.297±0.761 |
22.979±1.128 |
|
Perimysium (µm) |
4.538 ± 0.187 |
7.488 ±0.724 |
12.567±0.499 |
|
Endomysium µm |
1.639 ± 0.181 |
1.843 ±0.195 |
2.782 ± 0.170 |
|
Muscle fiber area (µm²) |
149.130 ± 7.558 |
661.434 ± 33.172 |
1028.501 ± 69.863 |
|
Muscle bundle area (µm²) |
16934.994± 2264.660 |
23859.544± 1977.794 |
66055.386± 9317.384 |
The values represent the mean ± standard error for each group. (n = 5). P<0.05.
RESULTS
The histological results of the iliotibialis muscle was obtained using hematoxylin and eosin and Masson’s trichrome stains to demonstrate its general structure at different growth stages of broiler chickens. Microscopically, the iliotibialis muscle consisted of muscle fibers. Each muscle fiber appeared as a long, cylindrical structure with multiple oval, elongated nuclei located marginally beneath the sarcolemma and exhibited distinct cross-striations (Figure 1). The area of muscle fibers in the iliotibialis muscle showed a progressive increase with age. The highest mean fiber area was recorded at 38-day-old, whereas the lowest was observed at 7-day-old. Statistical analysis revealed a highly significant difference in muscle fiber area at 38-day-old compared to both the 7-day-old (p = 0.0007) and 21-day-old (p = 0.003). Additionally, a significant difference was detected between the 21-day-old and 7-day-old (p = 0.0006), as presented in (Table 2 and Figure 2). Additionally, the area of the muscle bundle in the Iliotibialis muscle exhibited a significant increase with age. The highest mean muscle bundle area was recorded at 38-day-old, whereas the lowest was observed at 7-day-old. Statistical analysis revealed a highly significant difference in muscle bundle area at 38-day-old compared to both the 7-day-old (p = 0.0001) and 21-day-old (p = 0.0002). However, no significant difference was observed between the 21-day-old and 7-day-old (p = 0.392), as presented in (Table 2 and Figure 3).
The iliotibialis muscle was externally covered by a dense, irregular connective tissue layer, the epimysium, which encased the entire muscle. From this layer, connective tissue septa extended inward, forming the perimysium, a dense, irregular connective tissue layer that contained small blood vessels surrounding the muscle fascicles, organizing the muscle fibers within bundles. Each muscle fiber was surrounded by a thin layer of loose connective tissue called endomysium that accompanied the blood vessels and nerves supplying the muscle tissue (Figure 1). The thickness of the connective tissue layers in the iliotibialis muscle increased with age. The epimysium exhibited the highest mean thickness at 38-day-old, while the lowest was observed at 7-day-old. Statistical analysis demonstrated a highly significant difference between the 38-day-old compared to the 7-day-old (p = 0.0001) and 21-day-old (p = 0.006). Additionally, a significant difference was observed between the 21-day-old and 7-day-old (p = 0.0002). Similarly, the perimysium displayed a notable thickening with age, with the highest mean thickness recorded at 38-day-old and the lowest at 7-day-old. Statistical analysis revealed a highly significant difference between the 38-day-old compared to both the 7-day-old (p = 0.0001) and 21-day-old (p = 0.0002). Furthermore, a significant difference was observed between the 21-day-old and 7-day-old (p = 0.0009). In addition, the endomysium, a gradual increase in thickness was detected with advancing age, with the highest mean thickness recorded at 38-day-old and the lowest at 7-day-old. Statistical analysis revealed a highly significant difference between the 38-day-old compared to both the 7-day-old (p = 0.0005) and 21-day-old (p = 0.0001). However, no significant difference was observed between the 21-day-old and 7-day-old (p = 0.371) as presented in (Table 2 and Figure 4). PAS staining revealed a progressive increase in glycogen accumulation within the muscle fibers of the iliotibialis muscle as broiler chickens aged. Glycogen granules, appearing as purple-stained deposits between myofibrils, exhibited a noticeable increase in both density and PAS staining intensity over with ages. At 7-day-old, the muscle fibers displayed a weak PAS reaction, indicating a low glycogen content, with faint staining and sparsely distributed glycogen granules. By 21-day-old, PAS staining intensity increased significantly, with glycogen granules becoming more abundant and widely distributed within the fibers. At 38-day-old, PAS staining intensity remained high, and glycogen granules appeared denser and more dispersed compared to earlier stages (Figure 1).
Real-Time PCR primers (RT-qPCR) were used to analyze their transcript expression in the iliotibialis muscle of broiler chickens. The RT-qPCR accuracy for experimental samples and housekeeping genes displayed identical amplification curves and melting peaks (Figure 12 and 13). The RT-qPCR amplification was highly specific, with no nonspecific product amplification.
Table 3: Represented the gene expression of MYH7 and housekeeping gene in the iliotibialis muscle of broiler chickens at 7, 21, and 38 days of age.
|
No. |
Exp. Group |
CT: MYH7 |
CT: GAPDH |
∆CT |
Gene expression ratio (MYH7) |
Mean± standard error |
|
1 |
Iliotibialis muscle at 7 days. |
27.47 |
26.51 |
0.96 |
1.95 |
1.94 ± 0.43 |
|
2 |
26.14 |
26.28 |
-0.14 |
0.91 |
||
|
3 |
27.63 |
26.92 |
0.71 |
1.64 |
||
|
4 |
27.01 |
26.26 |
0.75 |
1.68 |
||
|
5 |
28.2 |
26.38 |
1.82 |
3.53 |
||
|
1 |
Iliotibialis muscle at 21 days. |
29.47 |
26.41 |
3.06 |
8.34 |
7.04 ± 0.85 |
|
2 |
29.14 |
26.39 |
2.75 |
6.73 |
||
|
3 |
29.63 |
26.48 |
3.15 |
8.88 |
||
|
4 |
29.01 |
26.15 |
2.86 |
7.26 |
||
|
5 |
28.2 |
26.21 |
1.99 |
3.97 |
||
|
1 |
Iliotibialis muscle at 38 days. |
32.52 |
26.27 |
6.25 |
76.11 |
42.63 ± 9.59 |
|
2 |
32.22 |
27.77 |
4.45 |
21.86 |
||
|
3 |
32.33 |
27.54 |
4.79 |
27.67 |
||
|
4 |
32.21 |
26.95 |
5.26 |
38.32 |
||
|
5 |
32.28 |
26.66 |
5.62 |
49.18 |
The values represent the mean ± standard error for five samples in each group. Relative expression was calculated using the ΔCT method, where Gene expression ratio = 2^−ΔCT (where ΔCT = CT (Housekeeping gene) - CT (Target gene)). P < 0.05.
Every experimental specimen exhibited melting peaks between 79 and 80°C. The β-MHC, MYOG, and MYF5 protein expression at 7-day-old demonstrated that the highest average expression was detected in MYF5, while the lowest was found in β-MHC, as presented in (Table 5 and ٣). Therefore, statistical analysis revealed no significant difference in MYF5 compared to both β-MHC and MYOG (p = 0.304 and p = 0.305, respectively). Furthermore, no significant difference was observed between β-MHC and MYOG in the iliotibialis muscle (p = 0.99) (Figure 5,6,7,8,9,10 and 11). Additionally, the expression of β-MHC, MYOG, and MYF5 at 21-day-old indicated no significant changes in gene expression. The highest average expression was detected in β-MHC, while the lowest was found in MYF5, as presented in (Table 3 and ٥). Statistical analysis showed no significant difference in β-MHC compared to both MYF5 and MYOG (p = 0.953 and p = 0.825, respectively). Similarly, there was no significant difference between MYOG and MYF5 (p = 0.871) (Figure 5,6,7,8,9,10 and 11). Moreover, the expression of β-MHC, MYOG, and MYF5 at 38-day-old revealed that the highest average expression was detected in MYOG, while the lowest was found in MYF5, as presented in (Table 4 and ٥). Statistical analysis revealed a highly significant difference in MYOG and β-MHC compared to MYF5 (p-value = 0.0004 and p-value = 0.033, respectively) and no significant difference between the MYOG and the β-MHC in the iliotibialis muscle (p-value = 0.127) (Figure 5,6,7,8,9,10 and 11).
Table 4: Represented the gene expression of MYOG and housekeeping gene in the iliotibialis muscle of broiler chickens at 7, 21, and 38 days of age.
|
No. |
Exp. Groups |
CT: MYOG |
CT: GAPDH |
∆CT |
Gene expression ratio (MYOG) |
Mean± standard error |
|
1 |
Iliotibialis muscle at 7 days. |
26.55 |
26.51 |
-0.04 |
1.03 |
2.00 ± 0.33 |
|
2 |
27.65 |
26.28 |
-1.37 |
2.58 |
||
|
3 |
27.73 |
26.92 |
-0.81 |
1.75 |
||
|
4 |
27.78 |
26.26 |
-1.52 |
2.87 |
||
|
5 |
27.19 |
26.38 |
-0.81 |
1.75 |
||
|
1 |
Iliotibialis muscle at 21 days. |
28.65 |
26.41 |
-2.24 |
4.72 |
5.57 ± 1.50 |
|
2 |
26.73 |
26.39 |
-0.34 |
1.27 |
||
|
3 |
29.78 |
26.48 |
-3.3 |
9.85 |
||
|
4 |
28.19 |
26.15 |
-2.04 |
4.11 |
||
|
5 |
29.19 |
26.21 |
-2.98 |
7.89 |
||
|
1 |
Iliotibialis muscle at 38 days. |
31.97 |
26.27 |
-5.7 |
51.98 |
20.55 ± 8.25 |
|
2 |
30.28 |
27.77 |
-2.51 |
5.70 |
||
|
3 |
31.15 |
27.54 |
-3.61 |
12.21 |
||
|
4 |
30.47 |
26.95 |
-3.52 |
11.47 |
||
|
5 |
31.08 |
26.66 |
-4.42 |
21.41 |
The values represent the mean ± standard error for five samples in each group. Relative expression was calculated using the ΔCT method, where Gene expression ratio = 2^−ΔCT (where ΔCT = CT (Housekeeping gene) - CT (Target gene)). P < 0.05.
DISCUSSION
Histological analysis of iliotibialis muscle fibers in broiler chickens across three age groups (7, 21, and 38 days) revealed a consistent structural organization. These results align with studies by (Iwamoto et al., 2001; Watanabe et al., 2015; Listrat et al., 2016; Purslow, 2020). However, a significant increase in muscle fiber area was observed with age, consistent with the findings of (Ono et al., 1993; Dransfield and Sosnicki, 1999; Rehfeld et al., 2000; Nakamura et al., 2004a; Nakamura et al., 2004b). This increase in muscle fiber size contributes to the rapid muscle development characteristic of broilers. Additionally, the muscle bundle area increased with age, which agrees with the findings of (Shakirova et al., 2021).
Table 5: Represented the gene expression of MYF5 and housekeeping gene in the iliotibialis muscle of broiler chickens at 7, 21, and 38 days of age.
|
No. |
Exp. Group |
CT: MYF5 |
CT: GAPDH |
∆CT |
Gene expression ratio (MYF5) |
Mean± standard error |
|
1 |
Iliotibialis muscle at 7 days. |
31.41 |
26.51 |
-4.9 |
29.86 |
27.86 ± 9.13 |
|
2 |
32.13 |
26.28 |
-5.85 |
57.68 |
||
|
3 |
32.02 |
26.92 |
-5.1 |
34.30 |
||
|
4 |
29.45 |
26.26 |
-3.19 |
9.13 |
||
|
5 |
29.44 |
26.38 |
-3.06 |
8.34 |
||
|
1 |
Iliotibialis muscle at 21 days. |
26.75 |
26.41 |
-0.34 |
1.27 |
1.50 ± 0.27 |
|
2 |
27.67 |
26.39 |
-1.28 |
2.43 |
||
|
3 |
26.22 |
26.48 |
0.26 |
0.84 |
||
|
4 |
26.94 |
26.15 |
-0.79 |
1.73 |
||
|
5 |
26.55 |
26.21 |
-0.34 |
1.27 |
||
|
1 |
Iliotibialis muscle at 38 days. |
26.93 |
26.27 |
-0.66 |
1.58 |
0.76 ± 0.28 |
|
2 |
25.35 |
27.77 |
2.42 |
0.19 |
||
|
3 |
26.92 |
27.54 |
0.62 |
0.65 |
||
|
4 |
24.42 |
26.95 |
2.53 |
0.17 |
||
|
5 |
26.94 |
26.66 |
-0.28 |
1.21 |
The values represent the mean ± standard error for five samples in each group. Relative expression was calculated using the ΔCT method, where Gene expression ratio = 2^−ΔCT (where ΔCT = CT (Housekeeping gene) - CT (Target gene)). P < 0.05.
A progressive increase in the thickness of connective tissue was observed with advancing age, which is consistent with studies by (Nakamura et al., 2004a; Nakamura et al., 2004b; Roy et al., 2007; Oshima et al., 2007; Das et al., 2009). The increase in collagen fibers with muscle fiber enlargement suggests that the thickening of connective tissue is part of an adaptive process that supports the muscle structure and enhances its resistance to environmental and mechanical stresses with age. In addition, Changes in connective tissue thickness may be directly related to meat quality and tenderness. Increase in the amount of connective tissue can lead to a reduction in meat tenderness, an important factor in evaluating meat quality.
Our results show that PAS staining revealed a progressive increase in glycogen accumulation within the muscle fibers of the iliotibialis muscle with advancing age in broiler chickens. These findings align with Baqer (2024), who reported an increase in PAS staining intensity with age in the thigh muscle of broilers. Ylä‐Ajos et al. (2007) found that postmortem glycogen degradation in chickens varies by muscle type, with iliotibialis glycogen content being lower than in other muscles but degrading at a slower rate, resulting in darker meat. Similarly, Warriss et al. (1988) found that pre-slaughter fasting reduces muscle glycogen. However, Buyse et al. (2004) indicated that in younger broiler chickens, glucose is predominantly utilized for glycogen synthesis and storage. However, as broilers age, there is increased reliance on glucose oxidation for energy production, rather than its storage as glycogen.
Collectively, these findings suggest that changes in glycogen accumulation in the iliotibialis muscle are influenced by age-related metabolic adaptations. The increased glycogen content with age may indicate an enhanced capacity for energy storage during early growth stages, supporting rapid muscle development.
Our results for mRNA expression of proteins MYF5, MYOG, and β-MHC in the iliotibialis muscle across different developmental stages were analyzed. The expression results of MYF5 were at the highest level at 7 days of age, reaching its lowest level at 38 days. On the other hand, MYOG showed a progressive increase with age, with its expression at the lowest level at 7 days and reaching the highest level at 38 days. These results are consistent with the findings of (Kiefer and Hauschka, 2001; Yin et al., 2015; Zhang et al., 2018). These results indicate that MYF5 plays a key role in regulating early myogenesis, while MYOG continues to support muscle fiber differentiation at various developmental stages, reflecting their distinct influences on muscle formation and development.
In this study, the gene expression analysis of MYH7 in the iliotibialis muscle showed a progressive increase with age. The expression was lowest at 7 days, followed by the highest expression level at 38 days, indicating a significant age-dependent increase in MYH7 expression. As reported by Darin et al. (2007), MYH7 encodes β-MHC, which is expressed in type I slow-twitch fibers of skeletal muscle. This result suggests that the Iliotibialis muscle contains slow-twitch fibers, consistent with the findings of Lokman et al. (2016), who reported an increase in type I fibers with aging due to continuous locomotor activity.
Additionally, Macnaughtan (1974), Suzuki et al. (1985), McFarland and Meyers (2008), Pin and Baker (2010), Cheng et al. (2022), who demonstrated that the Iliotibialis muscle in chicken broiler consists of both slow- and fast-twitch fibers, with a predominance of fast-twitch fibers (88.85%) compared to slow-twitch fibers (11.15%).
However, this result contradicts the findings of Iwamoto et al. (1992), Iwamoto et al. (1993), Roy et al. (2007), and Oshima et al. (2007), who reported that the iliotibialis muscle in chickens consists of fast-twitch fibers only. In contrast, Gosnak et al. (2010), Zikic et al. (2016) and Tejeda et al. (2019) observed that the thigh muscle in broiler chickens is predominantly composed of slow-twitch fibers. The differences in MYH7 expression in the iliotibialis muscle between this study and previous findings may be due to genetic variations among broiler breeds, muscle adaptation to locomotion, metabolic changes with age, and environmental or dietary factors. Moreover, the fiber-type composition of the iliotibialis muscle remains a subject of debate, and breed-specific characteristics should be considered as a potential limitation when interpreting gene expression patterns.
CONCLUSIONS AND RECOMMENDATIONS
This study revealed a progressive development in the structure of the iliotibialis muscle in broiler chickens as they age. A significant increase was observed in muscle fiber area and muscle bundle area, along with a thickening of connective tissue layers. PAS staining showed a gradual accumulation of glycogen within the muscle fibers. Gene expression analysis indicated age-dependent changes in the expression of MYF5, MYOG, and MYH7, highlighting the critical role of these regulatory factors in muscle development and fiber formation.
ACKNOWLEDGMENTS
This study was supported and funded by the University of Qadisiyah’s Department of Anatomy and Histology, College of Veterinary Medicine. In addition, we value the cooperation of the technician staff at the University of Qadisiyah’s College of Veterinary Medicine and Department of Anatomy and Histology.
NOVELTY STATEMENT
These findings highlight the morphological and histological description and the dynamic role of muscle regulatory genes in Iliotibialis muscle development. The results suggest a correlation between gene expression changes and muscle fiber adaptation during growth, emphasizing the importance of MYH7, MYF5, and MYOG in regulating muscle composition in broiler chickens.
AUTHOR’S CONTRIBUTIONS
All researchers contributed equally.
Conflict of Interest
None.
REFERENCES
Baqer AAS (2024). Comparative Analysis of Myozinin1 and Glycogen Concentration in the Skeletal Muscles of the Broiler Chickens (Gallus gallus domesticus) Across Age-Dependent (Master’s thesis). Iraq: Univ. Al-Qadisiyah, 107.
Buyse J, Geypens B, Malheiros RD, Moraes VM, Swennen Q, Decuypere E (2004). Assessment of age-related glucose oxidation rates of broiler chickens by using stable isotopes. Life Sci., 75(18): 2245-2255. https://doi.org/10.1016/j.lfs.2004.05.016
Cavani C, Petracci M, Trocino A, Xiccato G (2009). Advances in research on poultry and rabbit meat quality. Ital. J. Anim. Sci., 8(sup2): 741-750. https://doi.org/10.4081/ijas.2009.s2.741
Cheng H, Song S, Park TS, Kim GD (2022). Proteolysis and changes in meat quality of chicken pectoralis major and iliotibialis muscles in relation to muscle fiber type distribution. Poult. Sci., 101(12): 1-12. https://doi.org/10.1016/j.psj.2022.102185
Darin N, Tajsharghi H, Ostman-Smith I, Gilljam T, Oldfors A (2007). New skeletal myopathy and cardiomyopathy associated with a missense mutation in MYH7. Neurology, 68(23): 2041-2042. https://doi.org/10.1212/01.wnl.0000264430.55233.72
Das C, Roy BC, Oshima I, Miyachi H, Nishimura S, Iwamoto H, Tabata S (2009). Collagen content and architecture of the Iliotibialis lateralis muscle in male chicks and broilers with different growth rates fed on different nutritional planes. Br. Poult. Sci., 50(1): 47-56. https://doi.org/10.1080/00071660802613294
Dransfield E, Sosnicki AA (1999). Relationship between muscle growth and poultry meat quality. Poult. Sci., 78(5): 743-746. https://doi.org/10.1093/ps/78.5.743
Du YF, Ding QL, Li YM, Fang WR (2017). Identification of differentially expressed genes and pathways for myofiber characteristics in soleus muscles between chicken breeds differing in meat quality. Anim. Biotechnol., 28(2) :83-93. https://doi.org/10.1080/10495398.2016.1206555
Gosnak RD, Erzen I, Holcman A, Skorjanc D (2010). Effects of divergent selection for 8-week body weight on postnatal enzyme activity pattern of 3 fiber types in fast muscles of male broilers (Gallus gallus domesticus). Poult. Sci., 89(12): 2651-2659. https://doi.org/10.3382/ps.2010-00641
Iwamoto H, Hara Y, Gotoh T, Ono Y, Takahara H (1993). Different growth rates of male chicken skeletal muscles related to their histochemical properties. Br. Poult. Sci, 34(5): 925-938. https://doi.org/10.1080/00071669308417653
Iwamoto H, Hara Y, Ono Y, Takahara H (1992). Breed differences in the histochemical properties of the M. iliotibialis lateralis myofibre of domestic cocks. Br. Poult. Sci., 33(2): 321-328. https://doi.org/10.1080/00071669208417470
Iwamoto H, Tabata S, Sakakibara, K, Nishimura S, Gotoh T, Koga Y (2001). Scanning electron microscopic observation of the architecture of collagen fibres in chicken M. iliotibialis lateralis. Br. Poult. Sci., 42(3): 321-326. https://doi.org/10.1080/00071660120055278
Khazali H, Mahmoud F (2022). Changes of plasma concentration and gene expression of ghrelin and leptin in rats receiving kisspeptin and morphine. Vet. Res. Forum, 13 (1): 85–90.
Kiefer JC, Hauschka SD (2001). Myf-5 is transiently expressed in nonmuscle mesoderm and exhibits dynamic regional changes within the presegmented mesoderm and somites I–IV. Dev. Biol., 232(1): 77-90. https://doi.org/10.1006/dbio.2000.0114
Kong BW, Hudson N, Seo D, Lee S, Khatri B, Lassiter K, Cook D, Piekarski A, Dridi S, Anthony N, Bottje W (2017). RNA sequencing for global gene expression associated with muscle growth in a single male modern broiler line compared to a foundational Barred Plymouth Rock chicken line. BMC Genom., 18: 1-19.
Listrat A, Lebret B, Louveau I, Astruc T, Bonnet M, Lefaucheur L, Picard B, Bugeon J (2016). How muscle structure and composition influence meat and flesh quality. Sci. World J., 2016(1): 1-14. https://doi.org/10.1155/2016/3182746
Lokman IH, Jawad HS, Goh YM, Sazili AQ, Noordin MM, Zuki ABZ (2016). Morphology of breast and thigh muscles of Red Jungle Fowl (Gallus gallus spadiceus), Malaysian village chicken (Gallus gallus domesticus) and commercial broiler chicken. Int. J. Poult. Sci., 15(4): 144-150.
Luna L (1968). Manual of histologic staining methods of the armed forces institute of pathology. McGrow-Hill book company. https://pesquisa.bvsalud.org/portal/resource/pt/biblio-1081120
MAcNAUGHTAN AF (1974). An ultrastructural and histochemical study of fibre types in the pectoralis thoracica and iliotibialis muscles of the fowl (Gallus domesticus). J. Anat., 118(Pt 1):171–186.
Maharjan P, Martinez DA, Weil J, Suesuttajit N, Umberson C, Mullenix G, Hilton KM, Beitia A, Coon CN (2021). Physiological growth trend of current meat broilers and dietary protein and energy management approaches for sustainable broiler production. Anim., 15: 1-10. https://doi.org/10.1016/j.animal.2021.100284
Maisarah Y, Hashida HN, Yusmin MY (2020). The challenge of getting a high quality of RNA from oocyte for gene expression study. Vet. Res. Forum, 11 (2): 179 – 184.
McFarland JC, Meyers RA (2008). Anatomy and histochemistry of hindlimb flight posture in birds. I. The extended hindlimb posture of shorebirds. J. Morphol., 269(8): 967-979. https://doi.org/10.1002/jmor.10636
Nakamura YN, Iwamoto H, Shiba N, Miyachi H, Tabata S., Nishimura S (2004b). Growth changes of the collagen content and architecture in the pectoralis and iliotibialis lateralis muscles of cockerels. Br. Poult. Sci., 45(6): 753-761.
Nakamura, Y. N., Iwamoto, H., Shiba, N., Miyachi, H., Tabata S, Nishimura S (2004a). Developmental states of the collagen content, distribution and architecture in the pectoralis, iliotibialis lateralis and puboischiofemoralis muscles of male Red Cornish× New Hampshire and normal broilers. Br. Poult. Sci., 45(1): 31-40. https://doi.org/10.1080/00071660410001668833
Ono Y, Iwamoto H, Takahara H (1993). The relationship between muscle growth and the growth of different fiber types in the chicken. Poult. Sci., 72(3): 568-576. https://doi.org/10.3382/ps.0720568
Oshima I, Iwamoto H, Tabata S, Ono Y, Ishibashi A, Shiba N, Miyachi H, Gotoh T, Nishimura S (2007). Comparative observations of the growth changes of the histochemical properties and collagen architecture of the iliotibialis lateralis muscle from Silky, layer and meat type cockerels. Anim. Sci. J., 78(5): 546-559. https://doi.org/10.1111/j.1740-0929.2007.00475.x
Ozenturk U, Uysal A, Laçin E, Uysal S, Gelen S U, Ozlu H (2025). The effect of cage density and meat storage period on some meat quality parameters in brown and white spent hens. Vet. Res. Forum,16 (2): 71 – 79. https://doi: 10.30466/vrf.2024.2025425.4210
Petracci M, Mudalal S, Soglia F, Cavani C (2015). Meat quality in fast-growing broiler chickens. Worlds Poult. Sci. J., 71(2): 363-374. https://doi.org/10.1017/S0043933915000367
Pin LS, Bakar ZA (2010). Muscle Fibre Typing, Collagen Composition Analysis of Breast and Thigh Meats in Two Breeds of Chicken of Different Growth Performance. Universiti Putra Malaysia Press Serdang, 62-64.
Purslow PP (2020). The structure and role of intramuscular connective tissue in muscle function. Front. Physiol., (11): 1-14. https://doi.org/10.3389/fphys.2020.00495
Rehfeldt C, Fiedler I, Dietl G, Ender K (2000). MYOGenesis and postnatal skeletal muscle cell growth as influenced by selection. Livest. Prod. Sci., 66(2):177-188. https://doi.org/10.1016/S0301-6226(00)00225-6
Roy BC, Oshima I, Miyachi H, Shiba N, Nishimura S, Tabata S, Iwamoto H (2007). Histochemical properties and collagen architecture of M. iliotibialis lateralis and M. puboischiofemoralis in male broilers with different growth rates induced by feeding at different planes of nutrition. Br. Poult. Sci., 48(3):312-322. https://doi.org/10.1080/00071660701370491
Shakirova GR, Borkhunova EN, Kondratov GV, Stepanishin VV (2021). Comparative characteristics of myohistogenesis of musculoskeletal tissue in hens and quails. E3S Web Conf., (254): 1-10. https://doi.org/10.1051/e3sconf/202125409020
Suzuki A, Tsuchiya T, Ohwada S, Tamate H (1985). Distribution of myofiber types in thigh muscles of chickens. J. Morphol., 185(2): 145-154. https://doi.org/10.1002/jmor.1051850202
Tallentire CW, Leinonen I, Kyriazakis I (2016). Breeding for efficiency in the broiler chicken: a review. Agron. Sustain. Dev., 36: 1-16.
Tejeda OJ, Calderon AJ, Arana JA, Meloche KJ, Starkey JD (2019). Broiler chicken myofiber morphometrics and MYOGenic stem cell population heterogeneity. Poult. Sci., 98(9): 4123-4130. https://doi.org/10.3382/ps/pez287
Warriss PD, Kestin SC, Brown SN, Bevis EA (1988). Depletion of glycogen reserves in fasting broiler chickens. Br. Poult. Sci., 29(1): 149-154. https://doi.org/10.1080/00071668808417036
Watanabe T, Nishimura K, Takeuchi R, Koyama YI, Kusubata M, Takehana K, Hiramatsu K (2015). Oral ingestion of collagen peptide causes change in width of the perimysium of the chicken iliotibialis lateralis muscle. J. Vet. Med. Sci., 77(11): 1413-1417. https://doi.org/10.1292/jvms.15-0144
Wei Y, Zhang GX, Zhang T, Wang JY, Fan QC, Tang Y, Ding FX, Zhang L (2016). MYF5 and MYOG gene SNPs associated with Bian chicken growth trait. Genet. Mol. Res., 15(3): 1-9.
Yin H, Li D, Wang Y, Zhao X, Liu Y, Yang Z, Zhu, Q (2015). MYOGenic regulatory factor (MRF) expression is affected by exercise in postnatal chicken skeletal muscles. Gene, 561(2): 292-299. https://doi.org/10.1016/j.gene.2015.02.044
Yin H, Zhang S, Gilbert ER, Siegel PB, Zhu Q, Wong EA (2014). Expression profiles of muscle genes in postnatal skeletal muscle in lines of chickens divergently selected for high and low body weight. Poult. Sci., 93(1):147-154. https://doi.org/10.3382/ps.2013-03612
Yla‐Ajos M, Ruusunen M, Puolanne E (2007). Glycogen debranching enzyme and some other factors relating to post‐mortem pH decrease in poultry muscles. J. Sci. Food Agric., 87(3): 394-398. https://doi.org/10.1002/jsfa.2705
Yousefi K, Allymehr M, Talebi A, Tukmechi A (2024). A comparative study on the expression of MYOGenic genes, and their effects on performance and meat quality in broiler chicken strains. Vet. Res. Forum, 15 (5): 243 – 250.
Zhang R, Li R, Zhi L, Xu Y, Lin Y, Chen L (2018). Expression profiles and associations of muscle regulatory factor (MRF) genes with growth traits in Tibetan chickens. Br. Poult. Sci., 59(1): 63-67. https://doi.org/10.1080/00071668.2017.1390212
Zikic D, Stojanovic S, Đukic-Stojcic M, Kanacki Z, Milosevic V, Uscebrka G (2016). Morphological characteristics of breast and thigh muscles of slow-and medium growing strains of chickens. Biotechnol. Anim. Husb., 32(1): 27-35.