Genomic Study of Silent Heat: A Novel Mutation in HSD17β1 Gene Muting the Potential of Black Gold of Asia

Basit Imtiaz1, Asif Nadeem2, Huma Mujahid1 and Maryam Javed1*

1Institute of Biochemistry and Biotechnology, University of Veterinary and Animal Sciences, Lahore, Pakistan.

2Department of Biotechnology, Virtual University of Pakistan, Lahore, Pakistan.

Basit Imtiaz and Asif Nadeem have equal contribution in the publication.

ABSTRACT

Buffaloes are useful in the conversion of straw into agro-industry waste and bio-fertilizer, in addition to giving milk, meat, and mechanical power to humans. Between 65 and 60% of the world’s milk is produced by buffaloes. Regardless of their excellent production capabilities, buffalo production is challenged due to poor fertility, delayed maturity, poor estrus behavior and seasonality in breeding. Buffaloes have a high level of genetic variation, which might affect the buffalo estrus cyclicity. When female animals exhibit estrus behavior, male animals are attracted to their female counterparts, and this is known as the mating instinct. Buffalo being a shy breeder depicts the estrus behavior late night. Very hot climate may also affect the estrus behavior. But in majority of the cases estrus signs are not visible enough to ensure the mating. Various genomic regions have been identified affecting poor estrus behavior in buffaloes. In the current study, novel insertion (p.3491) was found in HSD17β1 gene which is a key role player in production of estradiol. Polymorphic site was identified by comparing the genomic regions of animals with higher and lower heat score (≥50). This polymorphism was further analyzed for Hardy Weinberg Equilibrium (HWE), allelic frequency, heterozygosity status and association with heat score calculated by considering exhibited heat signs by animals. A chi-square value of 2.08 (P > 0.05) depicted that genotypic distribution of locus was obeying HWE in the population under study. Allelic frequency of the mutant allele was lower (0.39) but association testsing for the genotypic distribution provided significant values (17.47±0.25). Three dimensional protein structure illustrated the variation between residues 150 to 180. Truncation of five residues was also observed in the length of the mutant protein. Protein network was also constructed to understand the interaction of protein. Functional significance of the identified polymorphic sites illustrates the use of these regions as targeted site for marker assisted selection or genome editing, which would enhance the reproduction potential of river buffalo.

Article Information

Received 17 August 2022

Revised 25 November 2023

Accepted 06 December 2023

Available online 24 April 2024

(early access)

Published 13 June 2025

Authors’ Contribution

Conceiving the idea: MJ, AN. Conduct of laboratory experiment: BI, MJ. Data analysis: AN, MJ, HM. Manuscript writing and editing: MJ, BI, AN and HM.

Key words

Silent estrus, HSD17β1 gene, River buffalo, Polymorphism

DOI: https://dx.doi.org/10.17582/journal.pjz/20220817040832

* Corresponding author: [email protected]

0030-9923/2025/0004-1669 $ 9.00/00

Copyright 2025 by the authors. Licensee Zoological Society of Pakistan.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

INTRODUCTION

Agriculture contributes 50 percent to the national economy of Pakistan, while livestock contributes 14.0 percent in overall GDP (Pakistan Economic Survey, 2022-23). Among major livestock species, buffalo stands out as well adaptive unique animal of temperate regions. In addition to providing humans with milk, meat, and mechanical power, buffaloes are also beneficial in converting straw into agroindustrial waste and bio-fertilizer. Buffaloes provide 65-60% of the world’s milk (Riaz et al., 2018). Asia accounted for 97.10 percent of the world’s buffalo milk production in 2007, which totaled 86,574.5 thousand tons (Pasha and Hayat, 2012). Due to their remarkable productive capabilities, these are denoted as black gold of Asia. Success of buffalo production is highly dependent upon the high fertility and regularity of estrus cyclicity of the animal (Siddiky and Faruque, 2017). Due to weak expression of estrus symptoms in buffaloes, a varied estrus cycle, delayed and low conception rate and repeated act of breeding have become particularly challenging (Sartori and Barros, 2011). This is an area where improvements can be made to increase reproductive efficiency (Pasha and Hayat, 2012; Kumar et al., 2013).

Detecting a buffalo throughout its reproductive cycle is extremely challenging because of its homosexual tendencies (Suthar and Dhami, 2010). Bison exhibit estrus behavior from September to January as a result of seasonal influences. October and November are the months when this habit peaks (Kumar et al., 2013). Because the river buffalo does not display signs of heat from March to June, it is assumed that the buffalo’s reproductive season lasts eight months, and that it is sexually dormant for four months (Suthar and Dhami, 2010; Phogat et al., 2016). Hormones such as testosterone are formed by 17b-hydroxysteroid dehydrogenases (17b-HSDs). Scientists have studied seven types of HSDs used in sex hormone production and inactivation (Lu et al., 2020). Low levels of ovarian estrogens are the primary reason of buffalo’s infertility, which causes anestrus stage. Estrogen production depends on cytochrome P450 aromatase, which is represented by CYP19 (Stevenson et al., 2014; Imran et al., 2018). Hormones such cytochrome P450 aromatase (CP450) and HSD17β1 are synthesized with estrogen (Kumar et al., 2009).

Oestradiol-17 is found in high concentration in medium-sized ovarian follicles, compared to bigger and smaller follicles (Verma et al., 2014). Climatic conditions such as hot-dry or hot-humid weather affect its concentration as well. As the temperature rises, the concentration of estradiol drops. A lack of estrus heat causes buffaloes to be hesitant breeders. Silent estrus behavior is affected by multiple genetic and environmental variables. HSD17β1 gene is thought to be a crucial player in the synthesis of 17-b estradiol (Liu et al., 2009). In the given context, study was planned to identify polymorphisms in HSD17β1 gene associated with silent estrus in the Nili-Ravi buffalo breed. Animals were selected from the animal farms at University of Veterinary and Animal Sciences, Ravi campus, Pattoki (n=192) and exonic regions of the gene was amplified and sequenced. SNPs were identified by comparing the sequences obtained and then analyzed for the statistical significance. Protein configuration was also predicted to see the functional consequences of the polymorphic sites on the protein. Identified genomic polymorphic sites affect the estrus behavior in buffaloes and can be used as candidate sites for the gene-based therapeutic approaches to combat the issue of silent estrus.

MATERIALS AND METHODS

Taxonomic species

Bubalus bubalis was the species employed in this investigation. Nili Ravi buffalo breed of Pakistan was selected. River buffalo is well adapted in the hot climatic conditions of the Punjab province in Pakistan. Sampling was conducted from the Animal Farm at University of Veterinary and Animal Sciences, Ravi campus, Pattoki, Pakistan. Animals with typical phenotypic features for the Nili Ravi buffalo breed were selected for the study.

Sampling strategy

Nili Ravi buffaloes were tracked for their estrus cyclicity for consecutive three months and estrus record was used to calculate the heat score of animals by using the score chart reported by Van Eerdenburg et al. (1996). Animals with estrus score more than 50 were put into control group (n=93) and animals with estrus score less than this were put into test population (n=99). Along with the reproductive history, production records of the animals were also observed. Animals with disease history or no previous tract for parturition were excluded from the study. Blood sampling of the selected animals (n=192) was conducted between August-December, 2019 as these months are considered as breeding season. Blood was collected by pricking the jugular vein and stored into EDTA coated vacutainers. Samples were immediately moved to the Molecular Lab in Institute of Biochemistry and Biotechnology for further process and kept at -20oC prior to DNA extraction.

Genomic DNA extraction and quantification

Organic method of genomic DNA isolation was used as reported by Sambrook and Russell, 2001. Phenol-chloroform-isoamyl alcohol was used to precipitate the protein contaminants from the cell residues and DNA was obtained. Quantification of the genomic DNA was done by using Nanodrop Spectrophotometer at A260/A280 and sample concentrations were standardized at 50 ng/ml.

Genetic characterization of HSD17β1 gene

Primer designing and synthesis: HSD17β1 gene is located on chromosome 3 of the bovines and carries six exons. Primer 3 (https://primer3.ut.ee/) was used to design the gene’s specific primer pairs (Table I). Oligocalc (http://biotools.nubic.northwestern.edu/OligoCalc.html) was used to evaluate the hairpin formation, self-annealing, and similarities and other secondary structural components. Suitably designed primer sets were synthesized by commercial facility.

Primer amplification and sequencing of amplicons: Primers were optimized for the optimal amplification according to the varying annealing Tm ranges. Amplification was done by conventional polymerase chain reaction using the template, dNTPs, Taq polymerase, bi-valent ions and buffer in the master mixture. Primers were added at concentration of 10pM. Amplicons were purified using QIAquick PCR Purification Kit (Cat. No: 28104). Purified products were then sequenced bidirectionally (Sanger’s chain termination method) via commercial facility.

 

Table I. Primer pairs for HSD17β1 gene in river buffalo.

Primers	Sequence 5`→3`
Exon 1	F TGGAGAACTCCATGGACAGA
	R TACTTAGGCCGGGAAGGAGT
Exon 2	F TAAGGCTGAAAGACCGGAAT
	R GTGGGCTTCTGGACATCTTG
Exon 3/4	F AACAAGCCCAAGAGCCTTCT
	R AGAGCGGTTCCAACAAGATG
Exon 5	F GCTGTAAACCCGCTTTCAAAT
	R ATAGCGCCTGGAGGAAGAC
Exon 6	F AGGAGGTGGTCGAGGTAAGC
	R GCGGATTAGGCCTTTATTGC

 

Bioinformatics and statistical analysis

Sequences obtained were analyzed by sequence alignment software (https://www.genome.jp/tools-bin/clustalw) and genomic variations were identified in the test and control animal groups. Identified loci were further analyzed for Hardy-Weinberg equilibrium (HWE) by chi-square testing and allelic and genotypic frequencies were also calculated by using POPGENE32 (https://sites.ualberta.ca/~fyeh/popgene.pdf). Genomic loci obeying the HWE were further analyzed for association testing by VassarStats (http://vassarstats.net/).

3D protein structural configuration

3D protein model was predicted for the standard and mutated polypeptides by using Phyre2 Protein Fold Recognition Server (http://www.sbg.bio.ic.ac.uk/phyre2/html/page.cgi?id=index). Secondary structural elements as transmembrane loop and domains were also predicted. Interaction of HSD17β1 protein was determined by using String (https://string-db.org/).

RESULTS

Identification of SNP in HSD17β1

In this study, we analyzed the data of 192 Nili-Ravi buffaloes categorized in control (n=93) and test population (n=99). Sequencing of exonic regions of HSD17β1 gene illustrated an insertion of “G” base at position 3491 in the gene (XM_006055742.2). Insertion was identified after sequence alignment of Bubalus bubalis with sequences obtained from the Nili-Ravi buffaloes of Pakistan. Identified polymorphic site was further analyzed for the amino acid substitution by ExPaSy Protein Translation Tool and substitution of all subsequent amino acids in the exon-2 was observed (Fig. 1).

 

HWE and association analysis of the p.3491

Identified locus (p.3491) of HSD17β1 gene in Exon2 (Mutant G with frame shift mutation) in Nili-Ravi buffalo was further analyzed for HWE to observe the effect of mutation in population statistics. A chi-square test was performed yielding a value of 2.08 with P > 0.05. As locus was non-significant, so it was fixed in the population’s gene pool structure by obeying the HWE law. The allelic frequency of the locus was also calculated (A, 0.60; B, 0.39). Shannon index is the measure of locus diversity and richness. Its value for the locus was 0.67 which is medium to high score depicting locus is diversed (na=2, ne=1.91). Summary of heterozygosity for the locus was observed as 0.2857, which was lower than the expected value 0.48857 (Table I). This depicts the increased ratio of homozygous loci among studied population. These results support our assumption that genotypic distribution of locus was obeying HWE in the population under study.

Results of association analysis suggested that insertion p.3491 was significantly associated with the lowered heat score (<50) of the animals during the estrus cycle (Table II). Mutant genotype scores were observed as (17.47±0.25), while heat score of the wild genotypes was much higher (53.95±0.52). These values were significantly associated with heat scoring in the bovines (P-value>0.05). Allelic frequency of the mutant form was lower (0.39) but it imparts a strong effect on the estrus behavior of the river buffalo.

 

Table II. Heterozygosity statistics for p.3491 in HSD17β1 in Nili-Ravi buffalo (Mean±SD).

Locus	Obs_Hom	Obs_Het	Exp_Hom*	Exp_Het*	Nei**	Ave_Het
p.3491	0.714± 0.00	0.285± 0.00	0.514± 0.00	0.485± 0.00	0.477± 0.00	0.477± 0.00

 

*Expected homozygosity and heterozygosity were computed using Levene (1949). **Nei’s (1973) expected heterozygosity.

 

Table III. Association analysis of p.3491 with heat scores (Van Eerdenburg at al. 1996) by one way ANOVA using Vassar stats (Mean±SEM).

SNPs	Association analysis (n=192)			Probability (P < 0.05)
	AA (n=70)	AB (n=12)	BB (n=110)
p.3491	53.95±0.52	42.9±0.13	17.47±0.25	<.0001

 

3-D protein configuration of HSD17β1

Protein association network was also predicted and a complex functional linkage of the protein was observed suggesting its involvement in numerous essential pathways (Fig. 2). Protein structure prediction of the HSD17β1 illustrated the change in protein folds between residues 150 to 180. Truncation of five residues was also observed in the length of the mutant protein (Fig. 3A). A transmembrane helix was identified between 113-128 residues (Fig. 3B). Secondary structural entities were also identified depicting the distribution of helices and coils (Fig. 3C).

 

DISCUSSION AND CONCLUSION

River buffalo is mostly referred as black gold due to its superior production capabilities. But poor reproductive traits stand as a hindrance in exploring the potential of this animal (Perera, 2011). 17b-HSD is involved in the production of 17-b estradiol and is encoded by the HSD17β1 gene. In the ovaries, this enzyme is synthesized and exhibits lipid-like characteristics. Female mammals exhibit estrus activity under the effect of 17-b estradiol. Estradiol is a hormone that acts on the brain to elicit bodily estrus sighs. As the uterus prepares for pregnancy, this hormone increases the blood flow to it. Its concentration rises during the estrous phase of the estrus cycle. A huge buffalo population has a very low concentration, which causes it to develop quiet heat symptoms (Kommadath et al., 2011). Inadequate nutrition, poor management, infections, hereditary causes, genomics and other environmental variables are among the causes of the epidemics. This information can be used to forecast whether a buffalo will exhibit silent estrus or not.

Buffalo’s silent heat is caused by a surge of gonadotropins just before and during the pre-ovulatory surge of estradiol. It was first published in (Bachalaus et al., 1979). This occurs because the concentration of progesterone and estradiol decreases during the estrus cycle. Because of this, progesterone concentrations reduce the peak values of estradiol around estrus (Rao et al., 1982). This enzyme, also known as 17beta-HSD, is responsible for the final step in estrogen production. Esterification is the principal activity of HSD17β1, which catalyzes the final step of estradiol production (Babitha et al., 2013; Yazawa et al., 2023). 17-HSD 17-HSD1 is the most abundant enzyme in the ovaries, and it is engaged in the final phase of 17-b estradiol metabolism in the ovaries by follicles, according to the National Institutes of Health (Mitko et al., 2008).

In this study exonic regions of HSD17β1 gene were analyzed to identify novel variations affecting the estrus behavior in river buffalo. Nili-Ravi Buffalo animals from Punjab province of Pakistan were included in the study. On the basis of heat scoring, animals were categorized into control (>50) and test population (<50). Genome sequencing provided with the insertional mutation (p.3491) at position 3491 in exon-2 of the gene affecting the subsequent amino acid chain. Bioinformatics and statistical analysis of the locus and 3-D protein configuration analysis of the protein illustrated the significant effect of the insertion on estrus behavior of the population.

In past, it was believed that season plays a significant role in the regulation of estrus but now the influence of structure and regulation pattern of various genes has been reported in numerous studies effecting the poor manifestation of estrus behavior (Barkawi et al., 2009; Boer et al., 2010; Mirmahmoudi and Parkash, 2012; Zobel et al., 2012; Jia et al., 2015). This results in laborious and frequent tracking of animal’s reproductive tract to find the suitable time for insemination. Missing one cycle not only delays the animal’s reproductive cycle but also affects the farmers. Genomic association of this trait provides a promising insight into candidate genes. Suitable approaches for early age detection and cure can be developed to combat the issue of silent estrus in river buffalo.

Acknowledgement

Authors present their humble acknowledgement for the Department of Animal Production and Technology for their support during the sample collection.

Funding

Research work is not funded by any agency.

IRB approval

Institutional approval was aquired via letter no DAS. 470 dated 18/05/2020.

Ethical approval

Research work was conducted with due approval of the Institutional Research Ethical Committee.

Consent to participate

All authors of the manuscript are agreed upon the publication in the submitted form.

Consent for publication

All con-authors of the manuscript are agreed upon the publication in the submitted form.

Statement of conflict of interest

Ther authors have declared no conflict of interest.

References

Babitha, V., Panda R., Yadav V., Chouhan V., Dangi S., Khan F., Singh G., Bag S., Sharma G.T., Silvia W., 2013. Amount of mRNA and localization of vascular endothelial growth factor and its receptors in the ovarian follicle during estrous cycle of water buffalo (Bubalus bubalis). Anim. Reprod. Sci., 137: 163-176. https://doi.org/10.1016/j.anireprosci.2013.01.004

Bachalaus, N., Aroara, R.C., Prasad, A. and Pandey, R.S., 1979. Plasma levels of gonadal hormones in cycling buffalo heifers. Indian J. expt. Biol., 17: 823-825.

Barkawi, A., Hafez, Y., Ibrahim, S., Ashour, G., El-Asheeri, A.K. and Ghanem, N., 2009. Characteristics of ovarian follicular dynamics throughout the estrous cycle of Egyptian buffaloes. Anim. Reprod. Sci., 110: 326-334. https://doi.org/10.1016/j.anireprosci.2008.02.016

Boer, H., Veerkamp, R., Beerda, B. and Woelders, H., 2010. Estrous behavior in dairy cows: Identification of underlying mechanisms and gene functions. Animal, 4: 446-453. https://doi.org/10.1017/S1751731109991169

Economic Survey of Pakistan, 2022-23. www.finance.gov.pk

Imran, S., Maryam, J., Nadeem, A. and Iqbal, M., 2018. Pretentious genomic selection signatures in CYP19A1 gene associated with silent estrous behavior in water buffalo in Pakistan. Electron. J. Biotechnol., 32: 35-40. https://doi.org/10.1016/j.ejbt.2018.01.001

Jia, M., Dahlman-Wright, K. and Gustafsson, J.Å., 2015. Estrogen receptor alpha and beta in health and disease. Best Pract. Res. Clin. Endocrinol. Metab., 29: 557-568. https://doi.org/10.1016/j.beem.2015.04.008

Kommadath, A., Woelders, H., Beerda, B., Mulder, H.A., de Wit, A.A., Veerkamp, R.F., Te Pas, M.F. and Smits, M.A., 2011. Gene expression patterns in four brain areas associate with quantitative measure of estrous behavior in dairy cows. BMC Genomics, 12: 200. https://doi.org/10.1186/1471-2164-12-200

Kumar, O.S., Sharma, D., Singh, D. and Sharma, M., 2009. CYP19 (cytochrome P450 aromatase) gene polymorphism in murrah buffalo heifers of different fertility performance. Res. Vet. Sci., 86: 427-437. https://doi.org/10.1016/j.rvsc.2008.09.008

Kumar, P.R., Shukla, S.N. and Purkayastha, R.D., 2013. Economical analysis of the estimated cost of management of anestrus buffaloes under field conditions using different hormonal and non–hormonal strategies. J. Anim. Hlth. Prod., 1: 39-41.

Liu, L., Li, F., Deng, C., Zuo, B., Zheng, R. and Xiong, Y., 2009. Polymorphism of the pig 17beta-hydroxysteroid dehydrogenase type1 (HSD17β1) gene and its association with reproductive traits. Anim. Reprod. Sci., 114: 318-323. https://doi.org/10.1016/j.anireprosci.2008.09.004

Lu, X., Duan, A., Ma, X., Liang, S. and Deng, T., 2020. Knockdown of CYP19A1 in buffalo follicular granulosa cells results in increased progesterone secretion and promotes cell proliferation. Front. Vet. Sci., 7: 539496. https://doi.org/10.3389/fvets.2020.539496

Mirmahmoudi, R. and Prakash, B., 2012. The endocrine changes, the timing of ovulation and the efficacy of the Doublesynch protocol in the Murrah buffalo (Bubalus bubalis). Gen. Comp. Endocrinol., 177: 153-159. https://doi.org/10.1016/j.ygcen.2012.03.004

Mitko, K., Ulbrich, S.E., Wenigerkind, H., Sinowatz, F., Blum, H., Wolf, E. and Bauersachs, S., 2008. Focus on mammalian embryogenomics dynamic changes in messenger RNA profiles of bovine endometrium during the oestrous cycle. Reproduction, 135: 225-240. https://doi.org/10.1530/REP-07-0415

Pasha, T. and Hayat, Z., 2012. Present situation and future perspective of buffalo production in Asia. J. Anim. Pl. Sci., 22(3 Suppl): 250-256.

Perera, B., 2011. Reproductive cycles of buffalo. Anim. Reprod. Sci., 124: 194-199. https://doi.org/10.1016/j.anireprosci.2010.08.022

Phogat, J., Pandey, A.K. and Singh, I., 2016. Seasonality in buffaloes reproduction. Int. J. Pl. Anim. Environ. Sci., 6: 46-54.

Rao, D.G., Prasad, A.B., Rao, K.S. and Jayaramkrishan, V. 1982. Serum total cholesterol levels in Friesian x Ongole crosses in different stages of reproduction. Indian Vet. J., 59: 107-109.

Riaz, U., Hassan, M., Husnain, A., Naveed, M.I., Singh, J. and Ahmad, N., 2018. Effect of timing of artificial insemination in relation to onset of standing estrus on pregnancy per AI in Nili-Ravi buffalo. Anim. Reprod., 15: 1231-1235. https://doi.org/10.21451/1984-3143-AR2017-0015

Sambrook, J. and Russell, D.W., 2001. Molecular cloning: A laboratory manual. 3rd Edition, Vol. 1, Cold Spring Harbor Laboratory Press, New York.

Sartori, R. and Barros C., 2011. Reproductive cycles in Bos indicus cattle. Anim. Reprod. Sci., 124: 244-250. https://doi.org/10.1016/j.anireprosci.2011.02.006

Siddiky, M. and Faruque, M., 2017. Buffaloes for dairying in South Asia: Potential, challenges and way forward. SAARC J. Agric., 15: 227-239. https://doi.org/10.3329/sja.v15i2.35167

Stevenson, J., Hill, S., Nebel, R. and DeJarnette, J., 2014. Ovulation timing and conception risk after automated activity monitoring in lactating dairy cows. J. Dairy Sci., 97: 4296-4308. https://doi.org/10.3168/jds.2013-7873

Suthar, V. and Dhami, A., 2010. Estrus detection methods in buffalo. Vet. World, 3: 94-96.

Van Eerdenburg, F., Loeffler, H. and Van Vliet, J., 1996. Detection of oestrus in dairy cows: A new approach to an old problem. Vet. Quart., 18: 52-54. https://doi.org/10.1080/01652176.1996.9694615

Verma, K., Prasad, S., Mohanty, T., Kumaresan, A., Layek, S., Patbandha, T. and Kantwa, S., 2014. Behavioural signs of estrus in different parity of Murrah buffaloes (Bubalus bubalis): A comparative study. Indian J. Anim. Res., 48: 620-624. https://doi.org/10.5958/0976-0555.2014.00043.0

Yazawa, T., Islam, M.S., Imamichi, Y., Watanabe, H., Yaegashi, K., Ida, T., Sato, T., Kitano, T., Matsuzaki, S., Umezawa, A. and Muranishi, Y., 2023. Comparison of placental HSD17β1 expression and its regulation in various mammalian species. Animals (Basel), 10: 622. https://doi.org/10.3390/ani13040622

Zobel, R., Pipal, I. and Buić, V., 2012. Anovulatory estrus in dairy cows: Treatment options and influence of breed, parity, heredity and season on its incidence. Vet. Arhiv., 82: 239-249.