Construction, Characterization, and Biosensing Potential of an SOS Inducible mCherry Based Reporter Plasmid

Shaista Bano1, 2* and Sarfraz A. Tunio2

1School of Life Sciences, University of Nottingham, University Park, Nottingham, NG7 2RD, UK

2Institute of Microbiology, Allama I. I Qazi Campus, University of Sindh, Jamshoro, 76080, Pakistan

ABSTRACT

Improved variants of mushroom coral derived monomeric red fluorescent protein have been considered as a reliable reporter protein for gene expression. One of these variants is the mCherry protein which is encoded by the mCherry gene. The aim of the present study was to use the SOS inducible expression of the mCherry gene for monitoring the unwanted presence of antibiotics in a given environment. For that purpose, the mCherry gene was amplified using PCR technique. Then the amplified DNA fragment was cloned in a previously described low copy plasmid that carried an SOS inducible promoter. This cloning resulted in the transcriptional fusion between the SOS inducible promoter and the mCherry gene. The induced expression of the mCherry gene from the resultant construct was analyzed in E. coli cells by using fluorescence microscopy. The biosensing characteristics of the red fluorescent cells were evaluated quantitatively by considering the red fluorescence as an early marker of DNA damage in the cells exposed to antibiotics such as ColE7, nalidixic acid and norfloxacin. Our data showed that the construct was capable of detecting the presence of DNA damaging antibiotics up to nanogram level in an aqueous environment. Our findings suggested that the construct may be useful in the development of future strategies for the controlling of dissemination of antibiotic resistance that occurs due to the contamination of environment with antibiotic residues.

Article Information

Received 03 April 2023

Revised 20 January 2024

Accepted 01 February 2024

Available online 03 May 2024

(early access)

Published 13 June 2025

Authors’ Contribution

SB conducted the experiments and wrote the manuscript. SAT contributed to the analytical tools and wrote the manuscript. All authors have read and approved the manuscript.

Key words

Biosensors, Gene expression, mCherry, Fluorescence, Monomeric RFPs

DOI: https://dx.doi.org/10.17582/journal.pjz/20230403060422

* Corresponding author: [email protected]

0030-9923/2025/0004-1753 $ 9.00/00

Copyright 2025 by the authors. Licensee Zoological Society of Pakistan.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

INTRODUCTION

Microbe-derived biosensors are widely used in the environmental and medical diagnostics (Fahliyani et al., 2020). Their use in the monitoring of environmental contaminants is well documented (Bilal and Iqbal, 2019). The high sensitivity and reliability are the primary advantage of the biosensors. The development of biosensors provides a versatile, compact, flexible, and inexpensive way of the study of multiple environmental contaminants including antimicrobial agents (Bilal and Iqbal, 2019). A range of biosensors with a great potential of being used in the detection of contaminants in an environment has been reported so far. Among them, the majority of the recently developed biosensors has involved the engineered reporter genes (Ma et al., 2022). Given that the performance of microbe-derived biosensors is directly linked to the selection of reporter genes and their regulatory proteins (Gui et al., 2017), there is always a need for the development of a new and recent biosensor to be used as a biological screen.

The majority of toxicogenic materials present in the environment has ability to cause DNA damage, thus induce SOS response in a bacteria cell. Therefore, SOS inducible promoters have been used in many biosensors for the detection of environmental pollutant. One of the known SOS inducible promoters, the promoter of Colicin E9 (ColE9p) contains two overlapping SOS boxes (Bano et al., 2013). Any stress to the host bacterial cell causing DNA damage results in the induction of ColE9p. The inducing ability of ColE9p makes it a suitable indicator of DNA damage in the host cell. Therefore, the ColE9p can be exploited for the detection of any toxic agents in an environment if it regulates the expression of a reporter gene encoding a fluorescent protein. Among the reporter proteins, the monomeric red fluorescent protein (mRFP) from the Discosoma sp. has been modified to improve its efficiency. One of the improved variants of mRFP is mCherry protein which is encoded by mCherry gene (Shaner et al., 2004). The mCherry protein folds faster than tetramer resulting its rapid maturation after transcription. mCherry absorbs and emits light between 540-590 nm and 550-650 nm, respectively (Shu et al., 2006).

In this study we describe the construction of an SOS inducible mCherry based reporter plasmid which was found functional in E. coli K12 (JM83) cells. Therefore, the construct was characterized in E. coli cells using DNA damaging agents such as mitomycin C (MMC). The fluorescence from the red fluorescent E. coli cells, was the measure of the DNA damage caused by DNA damaging agent (toxin or mutagen) in their environment. The construct was then used to detect the presence of antibiotics such as nalidixic acid (NA), norfloxacin (Nor), and purified colicin E7 (ColE7) in a liquid environment. Our findings have suggested that the construct can be useful in the development of future strategies for controlling of the dissemination of antibiotic resistance that occurs due to the contamination of environment with antibiotic residues from different sources.

Materials and Methods

Bacterial strains, growth conditions and media

The plasmids were maintained in Escherichia coli JM83 (F−ara_(lac-proAB) rpsL (Strr)[ϕ80 dlac_(lacZ)M15]thi) strain at 37°C (unless otherwise stated) with shaking using Luria-Bertani (LB) broth supplemented with antibiotics appropriate for the recombinant clones.

DNA manipulation techniques

The primers were supplied by Sigma-Aldrich (UK). All enzymes including restriction endonucleases, T4 DNA ligase and polymerase were purchased from New England BioLabs (UK). The extraction of plasmid DNA, agarose gel electrophoresis, and ligation of DNA fragments were carried out as described in Sambrook et al. (1989).

Amplification of the mCherry gene

A promoter less mCherry gene (Shaner et al., 2004) was amplified using template DNA and a set of forward (SBM34) and reverse (SBM35) primers (Table I). To facilitate the cloning of amplified DNA fragment specific restriction sites were incorporated into the sequence of primers (Table I). The amplified DNA fragment (~ 0.71 kb) corresponding to the mCherry gene was subsequently digested with NdeI and HindIII to be ligated with the NdeI and HindIII digested pSBM6 to yield an SOS inducible mCherry based construct. The successful fusion between ColE9p and the mCherry gene was confirmed by the nucleotide sequencing of the construct.

Table I. List of primers used in the present study.

Primers	Sequence (5’-3’)	Restriction site
SBM34 (F)	GCGCATATGGTGAGCAAGG	NdeI
SBM35 (R)	GCGAAGCTTTACTTGTACAGCTCG	HindIII

SDS-PAGE analysis

Proteins were separated by SDS-PAGE in a 16% resolving gel using Tris/glycine buffer (Laemmli, 1970). 10µl of sample was loaded to run SDS-PAGE at 170V followed by the staining of gel with Coomassie blue dye. The size of protein bands was determined using protein standards (NEB, 10-175kDa range).

Fluorescence microscopic measurements

Fluorescence microscopic measurements were carried out with a Nikon labophot 2 fluorescence microscopes. For the microscopic observations, a pre-warmed glass slide was loaded with an aliquot of 10 µl of each sample and a cover slip was placed over the sample immediately. Images were photographed using Nikon digital camera (DXm1200) attached with the microscope and saved with Nikon -ACT-1 version 2 software.

Determination of biosensing abilities

A single colony of the red fluorescent biosensor cells was grown overnight in LB broth at 37°C. Next day, culture was diluted 100-fold into fresh broth and grown until OD600 reached 0.4. At this stage, a test concentration of a specific DNA damaging agent was added. After the treatment step, a volume of 200 µl of the exposed culture was poured into the wells of a pre-warmed 96-well microtiter plate (Nunc). Then, red fluorescence was assayed at different time points with a Tecan Infinite 200 microplate reader using the excitation/emission wavelength 535/595nm. The fluorescence was measured in relative fluorescence unit (RFU). The subtraction of any background fluorescence from the target cells was carried out using non fluorescent cells (E. coli JM83 cells with low copy number plasmid lacking the cloned mCherry gene). Dose response ratio was calculated using the maximum RFU obtained from the red fluorescent cells treated with any given concentration of DNA damaging agent minus the RFU obtained from the untreated cells serving as control at the same time point (60 min) divided by the RFU of the control cells at that time point (Vankemmelbeke et al., 2005).

RESULTS

Construction of the SOS inducible mCherry based plasmid

A recombinant plasmid carrying the mCherry gene under the control of an SOS inducible promoter in a low copy number plasmid was constructed. An amplified DNA fragment corresponding to the mCherry gene (Fig. 1A) was cloned into pSBM6 plasmid (Bano et al., 2022), at NdeI and HindIII site (Fig. 1B). This insertion resulted the replacement of the gfpmut2 gene with the mCherry gene. Hence, the resultant construct carries pColE9: mCherry in the back bone of pACYC184 plasmid which is a low copy number plasmid (Fig. 1C). The SOS inducible property of pColE9 makes it a useful tool for the detection of DNA damage in host cell. Therefore, the construct was introduced into E. coli JM83 cells in order to make red fluorescent cells. The cells were anticipated to sense the presence of genotoxin in their environment.

 

Characterization of the SOS inducible mCherry based construct

The construct was characterized by determining the expression of mCherry in E. coli cells in response to a well-known DNA damaging agent-MMC. For that purpose, the red fluorescent cells and the non-fluorescent cells were exposed to subinhibitory concentration of MMC (0.5µg/ml) for 2 h. SDS-PAGE analysis of the induced cells showed the appearance of a sharp band of mCherry protein suggesting that the expression of the mCherry protein is under the regulation of SOS system of host cell thus the uninduced cells have a very low level of the expression of mCherry (Fig. 2). Furthermore, the fluorescence microscopic observations of the MMC treated red fluorescent biosensor cells revealed that the red fluorescent cells were elongated, and the majority of cells was fluorescent while untreated cells were normal in size and only a few cells were fluorescent (Fig. 3). The MMC induced elongation of E. coli cells are well described (Suzuki et al., 1967). Furthermore, the observed effects of MMC in the red fluorescent cells indicated that the expression of mCherry in the red fluorescent cells is under the regulation of an SOS response inducible promoter. Hence the cells could have abilities of biosensing DNA damaging agents in their environment.

 

Biosensing abilities of the construct

To determine the ability of the red fluorescent cells to respond to different DNA damaging agents, the cells were exposed to NA, Nor and ColE7. Then the fluorescence was measured at different post exposure time points.

 

Detection of DNA-damaging toxins

ColE7 is a nuclease protein antibiotic that causes DNA damage in E. coli cells. The red fluorescent cells were exposed to a range of purified ColE7 (1nM-15pM), and the fluorescence, as an early marker of DNA damage, was detected. It was observed that the construct was able to detect the presence of ColE7 even in a very low quantity (data not shown). However, the dose response linearity curve was achieved up to 0.25nmol (Fig. 4A). No increase in RFU was observed from 0.5 nMol ColE7 albeit decline in the RFU was observed. This might have occurred due to the killing of the cells by the higher concentration of the toxin; thus, the fluorescence pattern was disturbed. The production of the linear pattern from lower concentrations of ColE7 indicates about the more sensitivity of our construct in the detection of such genotoxins, if present in an aqueous environment.

Detection of DNA-damaging antibiotics

Similar response was observed from a range of concentration of two antibiotics, NA and Nor. The red fluorescent cells were very efficient in the detection of a range of the concentrations of NA and Nor antibiotics, while dose linearity was achieved up to 50 and 25 ng/ml, respectively (Fig. 4B, C). Fluorescence was detected at a very low concentration (up to 6.25ng/ ml).

DISCUSSION

In the present study, we describe the construction of an SOS inducible mCherry based plasmid and its characterization in E. coli cells which can be useful in the development of a red fluorescent protein-based biosensor. The fluorescent protein-based biosensors have an advantage of producing fluorescence without the addition of any exogenous substrate (Stiner and Halverson, 2002). Furthermore, the biosensing can be measured using fluorescence microscopy, fluorometry, flowcytometry and confocal microscopy. Among the fluorescent proteins, an improved variant of monomeric red fluorescent protein, mCherry, has been used as a reporter protein for the gene expression (Ransom et al., 2015). Although mCherry has been useful in its constitutive expression, the inducible expression of mCherry has been characterized recently (Kuduğ et al., 2019). Here, we created a construct that carries the fusion of mCherry gene with an SOS inducible promoter. The construct was functional in E. coli cells. We exposed the E. coli cells to MMC to characterize and validate the construct and to confirm that the construct is responsive to the DNA damaging agents. The post MMC treatment response was incredible. Therefore, the biosensing abilities of the construct were evaluated against antibiotics that cause DNA damage thus SOS response induction in E. coli.

Biosensing abilities of the SOS inducible mCherry based construct was promising as it allowed the red fluorescent cells to detect a very low level of DNA damaging agents within an hour of exposure. It was observed that the construct was very efficient to detect the agents in a low quantity while higher concentration did not show linearity in response. These observations occurred because the fluorescence was detected while the red fluorescent cells were exposed to DNA damaging agents. Apparently, the cells exposed to higher concentrations of the DNA damaging agents (ColE7, NA, and Nor) were killed and the dose response linearity was not achieved. Our data is supported by a previous study where lux reporter could not detect higher concentration of DNase type colicin due to the killing of the cells (Vankemmelbeke et al., 2005). If the red fluorescent cells were exposed to the agents for a short time (less than lethal time), and then fluorescence was measured, it might have produced red fluorescence detected by fluorometry at a single point or by fluorescence microscopy.

The contamination of environment with antibiotic residues has now become a global issue (Ma and Zhai, 2020). Generally, wastewater from antibiotic manufacturing pharmaceutical industries, hospitals, animal husbandry, and households contribute to the increasing contamination of environment (water, food, soil, and other environments) with antibiotic residues which is obviously due to the increased consumption of the antibiotics (Manaia, 2017; Polianciuc et al., 2020). Consequently, the consumption of antibiotic residues by humans from food and water cause increasing antibiotic resistance and its dissemination (Manaia, 2017; Larsson and Flach, 2022). At one hand, the removal of the antibiotic residues itself is not an easy task. On other hand, the problem has been augmented due to the unavailability of an efficient routine monitoring system. Although, many detection methods and various biosensors have been described so far and many of them are currently in use, there is still need of different biosensors to face the issue of the increasing antibiotic contamination of environment, globally. The red fluorescent cells were sensitive enough to detect a very low quantity of NA and Nor in liquid medium which provides an easy method for the detection of antibiotics, particularly, those which block the bacterial DNA replication, thus induce SOS response in bacterial cell. However, the investigation of the detection ability of antibiotics directly from the environmental samples using our biosensing red fluorescent cells is our future research priority.

CONCLUSION

Our results showed that the SOS inducible mCherry based construct was functional in E. coli cells. The E. coli cells hosting the construct were capable of detecting the presence of DNA damaging antibiotics in a very minute amount. Our data suggests that the biosensing potential of the construct can be exploited for the detection of antibiotic contamination of environment. However, the investigations of the biosensing potential of the construct in real time using environmental samples need to be carried out.

Acknowledgments

The authors are highly thankful to Emeritus Prof. Richard James, and Dr. Christopher Penfold, the Centre for Biomolecular Sciences (CBS), University of Nottingham, United Kingdom, for their guidance during this research work. The authors are also thankful to Dr. Mireille Vankemmelbeke for providing us the purified colicin E7.

Funding

No funding was obtained particularly for this study.

Statement of conflict of interest

The authors have declared no conflict of interests.

REFERENCES

Bano, S., Vankemmelbeke, M., Penfold, C.N. and James, R., 2013. Pattern of induction of colicin E9 synthesis by sub MIC of Norfloxacin antibiotic. Microbiol. Res., 168: 661-666. https://doi.org/10.1016/j.micres.2013.04.005

Bano, S., Vankemmelbeke, M., Penfold, C.N., Tunio, S.A. and James, R., 2022. Heterogeneity in the spontaneous induction of the promoter of the ColE9 operon in Escherichia coli. Arch. Microbiol., 204: 1-9. https://doi.org/10.1007/s00203-022-03242-9

Bilal, M. and Iqbal, H.M., 2019. Microbial-derived biosensors for monitoring environmental contaminants: Recent advances and future outlook. Proc. Saf. Environ. Prot., 124: 8-17. https://doi.org/10.1016/j.psep.2019.01.032

Fahliyani, S.A., Rastegari, A.A., Yadav, A.N. and Yadav, N., 2020. Microbially derived biosensors for diagnosis, monitoring, and epidemiology for future biomedicine systems. In: New and future developments in microbial biotechnology and bioengineering, Elsevier. pp. 43-65. https://doi.org/10.1016/B978-0-12-820528-0.00005-3

Gui, Q., Lawson, T., Shan, S., Yan, L. and Liu, Y., 2017. The application of whole cell-based biosensors for use in environmental analysis and in medical diagnostics. Sensors, 17: 1623. https://doi.org/10.3390/s17071623

Kuduğ, H., Atamanm, B., İmamoğlu, R., Düzgün, D. and Gökçe, İ., 2019. Production of red fluorescent protein (mCherry) in an inducible E. coli expression system in a bioreactor, purification and characterization. Int. Adv. Res. Eng. J., 3: 20-25. https://dergipark.org.tr/en/pub/iarej/issue/44303/429547

Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227: 680-685. https://doi.org/10.1038/227680a0

Larsson, D.G. and Flach, C.F., 2022. Antibiotic resistance in the environment. Nat. Rev. Microbiol., 20: 257-269. https://doi.org/10.1038/s41579-021-00649-x

Ma, J. and Zhai, G., 2020. Antibiotic contamination: A global environment issue. J. Bioremed. Biodeg., 5: 5-6.

Ma, Z., Meliana, C., Munawaroh, H.S., Karaman, C., Karimi-Maleh, H., Low, S.S. and Show, P.L., 2022. Recent advances in the analytical strategies of microbial biosensor for detection of pollutants. Chemosphere, pp. 135515. https://doi.org/10.1016/j.chemosphere.2022.135515

Manaia, C.M., 2017. Assessing the risk of antibiotic resistance transmission from the environment to humans: non-direct proportionality between abundance and risk. Trends Microbiol., 25: 173-181. https://doi.org/10.1016/j.tim.2016.11.014

Polianciuc, S.I., Gurzău, A.E., Kiss, B., Ştefan, M.G. and Loghin, F., 2020. Antibiotics in the environment: Causes and consequences. Med. Pharm. Rep., 93: 231-240. https://doi.org/10.15386/mpr-1742

Ransom, E.M., Ellermeier, C.D. and Weiss, D.S., 2015. Use of mCherry red fluorescent protein for studies of protein localization and gene expression in Clostridium difficile. Appl. environ. Microbiol., 81: 1652-1660. https://doi.org/10.1128/AEM.03446-14

Sambrook, J., Fritsch, E.F. and Maniatis, T., 1989. Molecular cloning: A laboratory manual. Cold Spring Harbor Laboratory Press.

Shaner, N.C., Campbell, R.E., Steinbach, P.A., Giepmans, B.N., Palmer, A.E. and Tsien, R.Y., 2004. Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat. Biotechnol., 22: 1567-1572. https://doi.org/10.1038/nbt1037

Shu, X., Shaner, N.C., Yarbrough, C.A., Tsien, R.Y. and Remington, S.J., 2006. Novel chromophores and buried charges control color in mFruits. Biochemistry, 45: 9639-9647. https://doi.org/10.1021/bi060773l

Stiner, L. and Halverson, L.J., 2002. Development and characterization of a green fluorescent protein-based bacterial biosensor for bioavailable toluene and related compounds. Appl. environ. Microbiol., 68: 1962-1971. https://doi.org/10.1128/AEM.68.4.1962-1971.2002

Suzuki, H., Pangborn, J. and Kilgore, W.W., 1967. Filamentous cells of Escherichia coli formed in the presence of mitomycin. J. Bact., 93: 683-688. https://doi.org/10.1128/jb.93.2.683-688.1967

Vankemmelbeke, M., Healy, B., Moore, G.R., Kleanthous, C., Penfold, C.N. and James, R., 2005. Rapid detection of colicin E9-induced DNA damage using Escherichia coli cells carrying SOS promoter-lux fusions. J. Bact., 187: 4900-4907. https://doi.org/10.1128/JB.187.14.4900-4907.2005