Genetic Diversity and Molecular Characterization of Virulence Determinants and Integrons in Pseudomonas aeruginosa Isolated from Canal Water in Peshawar Pakistan
Urooj Amjad1, Kafeel Ahmad1*, Hifsa Saadia1 and Imran Muhammad Khan2
1Centre of Biotechnology and Microbiology, University of Peshawar, Peshawar, Pakistan
2Burns and Plastic Surgery Centre, Hayatabad, Peshawar, Pakistan
ABSTRACT
Pseudomonas aeruginosa is a clinically significant Gram-negative bacillus with remarkable ability to thrive in diverse environments that could be attributed to its minimal nutritional demands allowing it to exist in settings like wastewater, surface water, and moist conditions and even on inert surfaces. This adaptability makes P. aeruginosa noteworthy for its environmental resilience and clinical importance. This study aimed to examine the genetic determinants of virulence (toxA, lasB, plcH, exoS), occurrence of integrons (int1, int2) and molecular diversity among P. aeruginosa isolates recovered from canal water in Peshawar, Pakistan. A total of fifty samples were collected and processed for isolation of P. aeruginosa. Antibiotic susceptibility was conducted against eight different classes of antibiotics i.e. Norfloxacin (10µg), Ticarcillin (75µg), Doripenem (10µg), Azithromycin (10µg), Ciprofloxacin (5µg), Levofloxacin (10µg), Polymyxin (300U) and Colistin (10µg). Isolated P. aeruginosa were analyzed for the presence of lasB, toxA, exoS, and plcH, int1and int2 genes. Genetic diversity was analyzed through RAPD PCR. Results showed 98%, 74%, 100%, 26%, 70%, 98%, 100%, 100% susceptibility towards Norfloxacin, Ticarcillin, Doripenem, Azithromycin, Ciprofloxacin, Levofloxacin, Polymyxin and Colistin respectively. The occurrence of lasB, toxA, exoS and plcH was confirmed in 98% (n=49), 86% (n=43), 88% (n=44) and 96% (n=48) isolates. Int1 gene was detected in 90% (n=45) isolates whereas int2 gene was not detected. Among the 50 isolates, 26 were clustered into 11 distinct clones whereas 24 isolates showed distinct RAPD profiling. The presence of highly pathogenic strains of P. aeruginosa highlights the requirement for efficient strategies for control and prevention.
Article Information
Received 24 November 2023
Revised 25 December 2024
Accepted 11 January 2024
Available online 27 May 2024
(early access)
Published 21 June 2025
Authors’ Contribution
UA performed samples collection, experimental work, data analysis and manuscript writing. KA conceived the idea, contributed to experimental work, conducted analysis, contributed to manuscript writing and proofreading. HS helped in data analysis and manuscript writing. IMK contributed to data analysis and proofreading. All the authors approved the final version of the manuscript.
Key words
Pseudomonas aeruginosa, Virulence genes, Integrons, RAPD, Antibiotics, Genetic diversity
DOI: https://dx.doi.org/10.17582/journal.pjz/20231124100835
* Corresponding author: [email protected]
0030-9923/2025/0004-1803 $ 9.00/00
Copyright 2025 by the authors. Licensee Zoological Society of Pakistan.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
INTRODUCTION
Pseudomonas aeruginosa could lead to community-acquired infections like keratitis, folliculitis, and ear infections primarily due to exposure to recreational water containing this bacterium (Moore et al., 2011). Presence of P. aeruginosa in various water bodies has been reported from different parts of the world. Individuals living in proximity to the river could experience a high incidence of skin diseases, urinary tract infections (UTIs) and gastroenteritis infections (GTIs) (Chakraborti et al., 2016). The virulence factors of P. aeruginosa enable it to adhere to host cells, disrupt signaling and invade the host leading to persistent infections (Diggle and Whiteley, 2020). The virulence factor ExoS serves as the principal cytotoxin essential for multiple functions including invasion, colonization and bacterial dissemination during infection. In P. aeruginosa the toxA gene encodes the key virulence factor, exotoxin A, which is responsible for inhibiting protein synthesis. P. aeruginosa produces the hemolysin encoded by plcH gene which leads to the degradation of lipids and lecithin (Hofmann et al., 2021). Within the human body, collagen is a crucial protein found in numerous tissues. The product of LasB gene is responsible for breaking down type III and type IV collagens. An Iranian study revealed a notably higher presence of lasB, exoS, and toxA genes in P. aeruginosa isolated from children with cystic fibrosis (Camiade et al., 2020). Various other studies have reported the occurrence of various virulence factors in P. aeruginosa of clinical and environmental origin (Bhasin, 2020; Ali and Al-Kenanei, 2020; Diggle and Whiteley, 2020; Bahador et al., 2019).
Microbial typing plays a crucial role in establishing connections between different microbial strains (Suárez et al., 2020). Randomly Amplified Polymorphic DNA-Polymerase Chain Reaction (RAPD-PCR) is commonly used for estimating genetic diversity among bacteria (Goudarzi et al., 2016). RAPD offers a rapid and efficient way to assess DNA polymorphism at multiple loci in an organism’s genome. It is a simple, cost-effective technique that doesn’t require prior knowledge of the target DNA sequence (Suárez et al., 2020; Nanvazadeh et al., 2013). Horizontal gene transfer mechanisms, facilitated by mobile genetic elements (MGE) are pivotal in the acquisition of resistance genes in P. aeruginosa. Resistance genes dissemination in the environment is notably influenced by plasmids or transposons carrying integrons. Among various Integrons, the class 1 integrons are most prevalent in P. aeruginosa and are primarily associated with β-lactamase-mediated resistance (Goudarzi et al., 2016). Class 1 integrons are widespread among Gram-negative bacteria in diverse environments including wastewater. However, Class 2 integrons are seldom reported in P. aeruginosa (Bhasin et al., 2020; Bahador et al.,, 2019). This study aimed to address the lack of data regarding molecular characteristics of P. aeruginosa prevailing in canal water by investigating the presence of virulence genes, integrons and genetic diversity of P. aeruginosa isolates recovered from canal water in Peshawar, Pakistan.
MATERIALS AND METHODS
Isolation, culturing and identification
Fifty water samples were collected from various canals in the Peshawar district of Khyber Pakhtunkhwa and transferred to laboratory in cold conditions for further processing. For isolation of bacteria, water samples (100 µl) were inoculated onto MacConkey agar plates (Oxoid, UK) followed by incubation at 37 °C for 24 h. Standard procedures including Gram staining and a series of biochemical tests including catalase, oxidase, motility, citrate, indole, triple sugar iron, methyl red (MR), Voges-Proskauer (VP), gelatin hydrolysis, casein hydrolysis, urease and phenotypic biofilm formation tests were performed to identify P. aeruginosa (Al-Bayati et al., 2021).
Antimicrobial susceptibility
Antibiotic susceptibility testing was conducted using the Kirby-Bauer method. A fresh bacterial culture was evenly spread on Muller Hinton agar medium and antibiotic discs Levofloxacin (LEV) 5µg; Doripenem (DOR) 10µg; Norfloxacin (NOR) 10µg; Azithromycin (AZM) 15µg; Ticarcillin (TIC) 75µg; Cefaperazone (CFP) 75µg; Polymyxin (PB) 300 U; Colistin (CT) 10µg were placed at specified intervals in accordance with CLSI guidelines and reported procedures (Mohamed et al., 2020). Following incubation, zones of inhibition were measured to determine resistance, intermediate sensitivity or sensitivity.
Detection of virulence genes
Bacterial DNA was extracted using bacterial genomic DNA extraction kit (solar bio, D1600). DNA extraction was performed according to the kit instructions. The quality of extracted DNA was checked through gel electrophoresis using 1% agarose.
Presence of four virulence genes i.e. exoS, toxA, lasB and plcH were analyzed. PCR reaction mix consisted of 4 µl master mix (FIREpol Cat. No. 04-12-00115), 1 µl reverse primer, 1 µl forward primer, 13 µl water and 1 µl DNA template to make the final volume up to 20 µl. PCR products were checked through gel electrophoresis using 1% agarose. Primer sequences for different virulence genes are given in Table I.
Table I. Primer sequence for detection of virulence genes.
|
Gene |
Sequence of primers 5’ → 3’ |
Size of products in bps |
|
|
Virulence genes |
|||
|
toxA |
CTGCGCGGGTCTATGTGCC |
270 |
|
|
GATGCTGGACGGGTCGAG |
|||
|
exoS |
CGTCGTGTTCAAGCAGATGGTGCTG |
444 |
|
|
CCGAACCGCTTCACCAGGC |
|||
|
lasB |
GGAATGAACGAAGCGTTCTCCGAC |
284 |
|
|
TTGGCGTCGACGAACACCTCG |
|||
|
plcH |
GCACGTGGTCATCCTGATGC |
608 |
|
|
TCCGTAGGCGTCGACGTAC |
|||
|
Integrons |
|||
|
Int1 |
CAGTGGACATAAGCCTGTTC |
160 |
|
|
CCCGAGGCATAGACTGTA |
|||
|
Int2 |
CACGGATATGCGACAAAAAGGT |
789 |
|
|
GTAGCAAACGAGTGACGAAATG |
|||
The PCR thermal cycle for toxA, exoS, lasB and plcH comprise initial denaturation at 95oC for 5 min followed by 30 cycles each of denaturation at 94 oC for 30 sec, anncaling at 63 oC for 1 min, and extension at 72 oC for 1 min. The final extension was done at 72 oC for 5 min, with the following minor deviations: (1) the number of thermal cycles was 35 for exoS instead of 30. (2) annealing was done at 61 oC for exoS and 55 oC for lasB and plcH.
Analysis of integrons
Primer sequences used for the analysis of integrons are shown in Table I. For amplification, the reaction mixture consisted of: 4ul master mix (FIREpol Cat. No. 04-12-00115), 1µl reverse primer, 1µl forward primer, 13 µl water and 1µl DNA template to make the final volume up to 20 µl. The DNA fragments that were amplified were subjected to gel electrophoresis using 1% agarose gel. PCR conditions for int1 and int2 genes were initial denaturation at 94 oC for 5 min, followed by 30 cycles, each of initial denaturation at 94 oC for one min, annealing at 59 oC for 1 min, extension at 72 oC for 1 min. The final extension was done at 72 oC for 5 min.
Genetic diversity analysis
For analysis of genetic diversity, previously documented random decamer primer known as RAPD 272 was utilized (Ranjbar et al., 2014). The amplified RAPD fragments were separated through gel electrophoresis using 1% agarose gel. A 100 base pair DNA ladder (Solis BioDyne no.07-11-00005) was employed for size comparison.
Statistical analysis
To create bivariate data for statistical analysis, the bands obtained from RAPD-PCR were coded as either 0 (indicating absence) or 1 (indicating presence). This binary data was then used to calculate genetic diversity among P. aeruginosa isolates. Genetic distance among isolates was estimated as reported (Ali et al., 2021). The software MEGA X was employed to construct a dendrogram using the bivariate data obtained from the RAPD-PCR analysis (Ranjbar et al., 2014).
RESULTS
Antibiotics susceptibility
The results of antibiotic sensitivity are shown in Table II. All the isolates (n=50) showed susceptibility towards Doripenem, Polymyxin and Colistin. 98% (n=49) isolates showed susceptibility towards Levofloxacin and Norfloxacin while only 2% (n=1) isolates were resistant. 70% (n=35) of the samples showed susceptibility towards ciprofloxacin, 14% (n=7) isolates were resistant whereas 16% (n=8) isolates were intermediate. For Ticarcillin antibiotic 74% (n=34) isolates were susceptible, 14% (n=7) were resistant while 12% (n=6) were intermediate. Out of 50 samples, 26% (n=13) of them showed susceptibility towards Azithromycin, 56% (n=28) were resistant while 14% (n=7) showed intermediate resistance.
Table II. Antibiotic susceptibility of Pseudomonas aeruginosa isolates.
|
S. No |
Name of antibiotics |
Sensitive (S) % (no) |
Intermediate (I) % (no) |
Resistant (R) % (no) |
|
1 |
Ticarcillin |
74% (n=37) |
12% (n=6) |
14% (n=7) |
|
2 |
Norfloxacin |
98% (n=49) |
0% (n=0) |
2% (n=1) |
|
3 |
Levofloxacin |
98% (n=49) |
0% (n=0) |
2% (n=1) |
|
4 |
Ciprofloxacin |
70% (n=35) |
16% (n=8) |
14% (n=7) |
|
5 |
Doripenem |
100% (n=50) |
0% (n=0) |
0% (n=0) |
|
6 |
Polymyxin |
100% (n=50) |
0% (n=0) |
0% (n=0) |
|
7 |
Colistin |
100% (n=50) |
0% (n=0) |
0% (n=0) |
|
8 |
Azithromycin |
26% (n=13) |
14% (n=7) |
56% (n=28) |
Detection of virulence genes
Result on the occurrence of virulence genes among P. aeruginosa isolates are shown in Table III and Supplementary Figure 1. The lasB gene was present in 98% isolates, plcH gene in 96% isolates, exoS gene in 88% isolates and toxA in 86% isolates. The highest frequency was observed for the lasB gene while the lowest prevalence was seen for the toxA gene. The presence of the class 1 integron (int1 gene) was noted in 90% isolates (Table III, Fig. 1). None of the isolates were found to contain the class 2 Integron genes (int2 gene).
Genetic diversity
A total of 13 distinct RAPD bands were observed among all the isolates. The highest band size was 1500 bp whereas the lowest band size was 300 bp. A phylogenetic tree based on RAPD genetic diversity data is shown in Figure 1. Among the 50 isolates, 26 isolates were grouped into 11 distinct clones while 24 isolates exhibited unique RAPD profiles based on similarity coefficients of ≥ 80%. The 11 distinct clones were labeled as follows: C1 (isolates 39 and 45), C2 (isolates 28 and 37), C3 (isolates 18, 7, and 48), C4 (isolates 15, 25, and 23), C5 (isolates 6 and 41), C6 (isolates 14 and 32), C7 (isolates 2, 40, and 36), C8 (isolates 1, 50, and 17), C9 (isolates 24 and 43), C10 (isolates 47 and 49), and C11 (isolates 16 and 30).
Table III. Occurrence of virulence and integrase genes in P. aeruginosa isolates.
|
Location |
Virulence genes |
Integrase genes |
|||||
|
lasB |
plcH |
exoS |
toxA |
intI1 |
intI2 |
||
|
C1 |
Danishabad |
+ |
+ |
+ |
+ |
+ |
- |
|
C2 |
Danishabad |
+ |
+ |
+ |
+ |
+ |
- |
|
C3 |
Galaxy mart |
+ |
+ |
+ |
+ |
+ |
- |
|
C4 |
Galaxy mart |
+ |
+ |
+ |
+ |
+ |
- |
|
C5 |
Board bazar |
+ |
+ |
+ |
+ |
+ |
- |
|
C6 |
Board bazar |
+ |
+ |
+ |
+ |
+ |
- |
|
C7 |
Board bazar |
+ |
+ |
+ |
+ |
+ |
- |
|
Table continued on next column...... |
|||||||
|
Location |
Virulence genes |
Integrase genes |
|||||
|
lasB |
plcH |
exoS |
toxA |
intI1 |
intI2 |
||
|
C8 |
University town |
+ |
+ |
+ |
- |
+ |
- |
|
C9 |
University town |
+ |
+ |
+ |
+ |
+ |
- |
|
C10 |
University town |
+ |
+ |
+ |
+ |
+ |
- |
|
C11 |
Malakhander |
+ |
+ |
+ |
+ |
+ |
- |
|
C12 |
Malakhander |
+ |
+ |
+ |
+ |
+ |
- |
|
C13 |
Malakhander |
+ |
+ |
+ |
+ |
+ |
- |
|
C14 |
Malakhander |
+ |
+ |
+ |
+ |
+ |
- |
|
C15 |
Umer gul road |
+ |
+ |
+ |
+ |
+ |
- |
|
C16 |
Umer gul road |
+ |
+ |
+ |
+ |
+ |
- |
|
C17 |
Askari 6 |
+ |
+ |
- |
- |
- |
- |
|
C18 |
Askari 6 |
+ |
+ |
- |
- |
- |
- |
|
C19 |
DHA gate |
+ |
+ |
+ |
+ |
- |
- |
|
C20 |
DHA gate |
+ |
+ |
+ |
- |
+ |
- |
|
C21 |
Achini |
+ |
+ |
+ |
+ |
+ |
- |
|
C22 |
Achini |
+ |
+ |
+ |
+ |
+ |
- |
|
C23 |
Shalman phase 2 hayatabad |
+ |
+ |
+ |
+ |
+ |
- |
|
C24 |
Shalman phase 2 hayatabad |
+ |
+ |
+ |
+ |
+ |
- |
|
C25 |
Shalman phase 2 hayatabad |
+ |
+ |
+ |
+ |
+ |
- |
|
C26 |
Jamrud road |
+ |
+ |
+ |
+ |
+ |
- |
|
C27 |
Jamrud road |
+ |
+ |
+ |
+ |
+ |
- |
|
C28 |
Jamrud road |
+ |
+ |
+ |
+ |
+ |
- |
|
C29 |
Regi model town |
+ |
+ |
+ |
+ |
+ |
- |
|
C30 |
Regi model town |
+ |
+ |
+ |
+ |
+ |
- |
|
C31 |
Regi model town |
+ |
+ |
+ |
+ |
+ |
- |
|
C32 |
Shami road |
+ |
+ |
- |
+ |
- |
- |
|
C33 |
Shami road |
+ |
+ |
- |
- |
+ |
- |
|
C34 |
Garrison park |
+ |
+ |
+ |
+ |
+ |
- |
|
C35 |
Garrison park |
+ |
+ |
+ |
+ |
+ |
- |
|
C36 |
Qayyum stadium |
+ |
+ |
+ |
+ |
+ |
- |
|
C37 |
Qayyum stadium |
+ |
+ |
+ |
+ |
+ |
- |
|
C38 |
Army stadium |
+ |
+ |
+ |
+ |
+ |
- |
|
C39 |
Army stadium |
+ |
- |
- |
- |
+ |
- |
|
C40 |
Defence colony |
- |
- |
- |
- |
- |
- |
|
C41 |
Budni canal |
+ |
+ |
+ |
+ |
+ |
- |
|
C42 |
Budni canal |
+ |
+ |
+ |
+ |
+ |
- |
|
C43 |
Hazarkhwani canal |
+ |
+ |
+ |
+ |
+ |
- |
|
C44 |
Hazarkhwani canal |
+ |
+ |
+ |
+ |
+ |
- |
|
C45 |
Chamkani |
+ |
+ |
+ |
+ |
+ |
- |
|
C46 |
Chamkani |
+ |
+ |
+ |
+ |
+ |
- |
|
C47 |
Shoba bazar |
+ |
+ |
+ |
+ |
+ |
- |
|
C48 |
Shoba bazar |
+ |
+ |
+ |
+ |
+ |
- |
|
C49 |
Yakatoot |
+ |
+ |
+ |
+ |
+ |
- |
|
C50 |
Yakatoot |
+ |
+ |
+ |
+ |
+ |
- |
DISCUSSION
In this study a notably high frequency of the toxA gene (86%) was detected among P. aeruginosa isolates which contrasts with a previous study reporting a low prevalence (2.32%) of the toxA gene (Ghorbani et al., 2022) isolated from well and spring water which shows that water could potentially serve as a reservoir for P. aeruginosa and play a role in disseminating resistance genes within the food chain. Exotoxin A serves as a crucial virulence factor in clinical infections, exerting a cytotoxic impact. Its role involves hindering the biosynthesis of proteins during the elongation factor 2 phase in the polypeptide chain, leading to substantial loss of organs and tissues (Jenkins et al., 2004). Significantly high prevalence (98%) of the lasB gene was observed in current study whereas a previous study from Eastern Cape, South Africa reported a lower prevalence (75%) of lasB gene isolated from hospital wastewater (Mapapi et al., 2021). Other studies from Iran showed lower prevalence of lasB gene in P. aeruginosa isolated from environmental samples such as soil and surface and spring waters (Gholami, 2019; Ghorbani, 2022). These findings showed mutagenic elements within bacteria, inappropriate usage of disinfectants and detergents which find their way to surface water, improper administration of medications in human infections, and unregulated use of drugs in animals and poultry within the context of contemporary industrial practices. The product of LasB gene, also recognized as elastase B, facilitates the invasiveness of P. aeruginosa and has been demonstrated to exhibit high toxicity to the host. This toxicity arises from its enzymatic activity, which disrupts various mechanisms of both the innate and adaptive immune systems (Reboud et al., 2016). A substantially high prevalence (96%) of the plcH gene was observed in this study whereas a study conducted in Abidjan, West Africa reported a lower prevalence (72.1%) of the plcH gene in P. aeruginosa isolated from fresh and smoked fish (Benie et al., 2017). These prevalence findings indicate that the isolated strains possess the capability to secrete hemolytic exoenzymes and phospholipase C. Consequently, these strains may play a role in pulmonary infections (Barker et al., 2004). Another study from Iran showed a prevalence of 45.9% for the plcH gene isolated from burn infections which is considerably less than the findings of current study (Ellappan et al., 2018). The plcH gene is accountable for provoking pro-inflammatory responses and enhancing virulence, particularly contributing to pulmonary inflammation and suppressing the oxidative burst of neutrophils (Wieland et al., 2002). In this study, a high prevalence (88%) of the exoS gene was observed. This is in contrast to findings from studies conducted in Iran which showed 62% occurrence of the gene in P. aeruginosa isolated from spring water (Gholmai et al., 2019). Notably the frequency of exoS gene in the study conducted by Firouzi-Dalvand et al. (2019) was only 14% in P. aeruginosa obtained from clinical samples. The product of ExoS gene, with its ADP ribosyltransferase (ADPR) activity and function as a GTPase-activating protein, induces rapid lysis of host cells, showing maximal phospholipase activity (Barbieri et al., 2004).
Current study revealed a significantly high prevalence (90%) of class 1 Integrons while prevalence of class 2 Integrons was not detected in P. aeruginosa isolates. In contrast, a study from Barcelona, Spain showed 0% presence of class 1 integrons in P. aeruginosa isolated from water samples (Ruiz-Martínez et al., 2011). Another study from Brazil revealed class 1 and 2 integron in 3.2% isolates of P. aeruginosa obtained from lake water (Zanetti et al., 2013) which is in contrast with the current study. The findings indicate that P. aeruginosa strains in the environment could serve as a potential source for the dissemination of antibiotic resistance genes through mobile genetic elements.
A high genetic diversity among P. aeruginosa was observed in the current study. In China, a study reported similar genetic diversity pattern among the isolates of P. aeruginosa (Wu et al., 2016). Other studies also reported high genetic diversity among clinical isolates of P. aeruginosa (Kumari and Thakur, 2014; Zulfahmi et al., 2021). A study conducted in Iran reported only nine distinct genotypes indicating a lower genetic diversity among the isolates of P. aeruginosa that does not align with the findings of the current study (Kumari and Thakur, 2014). Considerable genetic diversity reflects the fact a wide variety of distinct genetic characteristics are possessed by the isolated P. aeruginosa strains to make them better adopted to diverse environments. This diversity suggests that multiple sources or origins may contribute to the population of P. aeruginosa in the canal water. The existence of various genetic profiles implies that different strains with diverse genetic makeup are present, and this diversity can influence the bacterium’s resistance, adaptability, and potential impact on the environment and human health.
CONCLUSION
The study reveals the occurrence of virulent and Integron possessing P. aeruginosa in canal water in Peshawar, Pakistan which is commonly used for irrigation and other human activities. The findings carry substantial clinical implications. These finding show a heightened risk of waterborne infections and the potential dissemination of antibiotic resistance of these bacteria. The presence of virulence genes in P. aeruginosa suggests an increased likelihood of infections upon human exposure to contaminated water. Furthermore, the existence of integrons implies a mechanism for the transfer of antibiotic resistance genes, likely contributing to the emergence of multidrug-resistant strains. The contaminated water poses a threat to public health, particularly for individuals with compromised immune systems, emphasizing the critical importance of robust water quality monitoring, public awareness, and measures to mitigate the spread of both pathogenic and antibiotic resistant bacteria in the community. This highlights the need for taking action by irrigation authorities to maintain cleanliness of canals and educating public about not disposing waste directly into open water bodies.
Declarations
Acknowledgement
The facilities provided by Centre of Biotechnology and Microbiology, University of Peshawar are greatly acknowledged.
Funding
The study received no external funding.
There is supplementary material associated with this article. Access the material online at: https://dx.doi.org/10.17582/journal.pjz/20231124100835
Statement of conflict of interest
The authors have declared no conflict of interest.
REFERENCES
Al-Bayati, S.S., Al-Ahmer, S.D., Shami, A.M.M. and Al-Azawi, A.H., 2021. Isolation and identification of Pseudomonas aeruginosa from clinical samples. Biochem. Cell. Arch., 21: 3931-3935.
Ali, A.M., Al-Kenanei, K.A. and Bdaiwi, Q.O., 2020. Molecular study of some virulence genes of Pseudomonas aeruginosa isolated from different infections in hospitals of Baghdad. Rev. med. Microbiol., 31: 26-41. https://doi.org/10.1097/MRM.0000000000000194
Ali, A., Ahmad, K., Rahat, S. and Ahmad, I., 2021. Genetic diversity and molecular analysis of metallo beta lactamases among imipenem resistant clinical isolates of Pseudomonas aeruginosa from Peshawar, Pakistan. Pak. J. med. Sci., 37: 1865-1870. https://doi.org/10.12669/pjms.37.7.4303
Bahador, N., Shoja, S., Faridi, F., Dozandeh-Mobarrez, B., Qeshmi, F.I., Javadpour, S. and Mokhtary, S., 2019. Molecular detection of virulence factors and biofilm formation in Pseudomonas aeruginosa obtained from different clinical specimens in Bandar Abbas. Iran. J. Microbiol., 11: 25-29. https://doi.org/10.18502/ijm.v11i1.701
Barbieri, J.T. and Sun, J., 2004. Pseudomonas aeruginosa exos and exot. Rev. Physiol. Biochem. Pharmacol., 6: 79-92. https://doi.org/10.1007/s10254-004-0031-7
Barker, A.P., Vasil, A.I., Filloux, A., Ball, G., Wilderman, P.J. and Vasil, M.L., 2004. A novel extracellular phospholipase C of Pseudomonas aeruginosa is required for phospholipid chemotaxis. Mol. Microbiol., 53: 1089-1098. https://doi.org/10.1111/j.1365-2958.2004.04189.x
Benie, C.K.D., Dadié, A., Guessennd, N., N’gbesso-Kouadio, N.A., Kouame, N.Z.D., N’golo, D.C. and Dosso, M., 2017. Characterization of virulence potential of Pseudomonas aeruginosa isolated from bovine meat, fresh fish, and smoked fish. Eur. J. Microbiol. Immunol., 7: 55-64. https://doi.org/10.1556/1886.2016.00039
Bhasin, S., Shukla, A. and Shrivastava, S., 2020. Bacterial diversity of river Kshipra with relation to human health. Environ. Conserv., 21: 63-74. https://doi.org/10.36953/ECJ.2020.211207
Camiade, M., Bodilis, J., Chaftar, N., Riah-Anglet, W., Gardères, J., Buquet, S. and Pawlak, B., 2020. Antibiotic resistance patterns of Pseudomonas spp. isolated from feacal wastes in the environment and contaminated surface water. FEMS Microbiol. Ecol., 96: 8-11. https://doi.org/10.1093/femsec/fiaa008
Chakraborti, A.K., Prasad, K.S.S.V.V. and Bhat, B.S., 2016. Case for integrated development of Urban and Rural Water supply scheme in India and its implementation strategies. J. Geol. Soc. India, 5: 25-33.
Diggle, S.P. and Whiteley, M., 2020. Microbe profile: Pseudomonas aeruginosa: Opportunistic pathogen and lab rat. Microbiology, 166: 30-37. https://doi.org/10.1099/mic.0.000860
Ellappan, K., Narasimha, H.B. and Kumar, S., 2018. Coexistence of multidrug resistance mechanisms and virulence genes in carbapenem-resistant Pseudomonas aeruginosa strains from a tertiary care hospital in South India. J. Glob. Antimicrob. Resist., 12: 37-43. https://doi.org/10.1016/j.jgar.2017.08.018
Firouzi-Dalvand, L., Hosseini, F., Moradi D.S. and Siasi, T.E., 2019. Antibacterial and antibiofilm activity of bismuth oxide nanoparticles produced by Bacillus subtilis against clinical Pseudomonas aeruginosa isolated from wound infections. J. Microb. World, 12: 172-185.
Gholami, S. and Tabatabaei, M., 2019. The prevalence of virulence factors in human and environmental isolates of Pseudomonas aeruginosa. Avicenna J. clin. Microbiol. Infect., 6: 9-14. https://doi.org/10.34172/ajcmi.2019.03
Ghorbani, G., Rahimi, E. and Shakerian, A., 2022. Antibiotic resistance’s genotypic and phenotypic characteristics and the frequency of virulence factors in P. aeruginosa isolates isolated from water samples in Iran. BioMed. Res. Int., 22: 1-13. https://doi.org/10.1155/2022/7076433
Goudarzi, M., Fazeli, M., Azad, M., Seyedjavadi, S.S., Mousavi, R., Rashidan, M. and Azargashb, E., 2016. Carriage of class 1 and class 2 integron in multidrug resistant Pseudomonas aeruginosa isolated from burn patients in Tehran hospitals, Iran. West Indian med. J., 65: 372-379. https://doi.org/10.7727/wimj.2014.315
Hofmann, L., Hirsch, M. and Ruthstein, S., 2021. Advances in understanding of the copper homeostasis in Pseudomonas aeruginosa. Int. J. mol. Sci., 22: 2050-2065. https://doi.org/10.3390/ijms22042050
Jenkins, C.E., Swiatoniowski, A., Issekutz, A.C. and Lin, T.J., 2004. Pseudomonas aeruginosa exotoxin A induces human mast cell apoptosis by a caspase-8 and-3-dependent mechanism. J. biol. Chem., 279: 37201-37207. https://doi.org/10.1074/jbc.M405594200
Kumari, N. and Thakur, S.K., 2014. Randomly amplified polymorphic DNA. A brief review. Am. J. Anim. Vet., 9: 6-13. https://doi.org/10.3844/ajavsp.2014.6.13
Mapipa, Q., Digban, T.O., Nnolim, N.E. and Nwodo, U.U., 2021. Antibiogram profile and virulence signatures of Pseudomonas aeruginosa isolates recovered from selected agrestic hospital effluents. Sci. Rep., 11: 1180-1187. https://doi.org/10.1038/s41598-021-91280-6
Mohamed, A. and Abdelhamid, F., 2020. Antibiotic susceptibility of Pseudomonas aeruginosa isolated from different clinical sources. Zagazig J. Pharm. Sci., 28: 10-17.
Moore, N.M. and Flaws, M.L., 2011. Introduction: Pseudomonas aeruginosa. Clin. Lab. Sci., 24: 41-45. https://doi.org/10.29074/ascls.24.1.41
Nanvazadeh, F., Khosravi, A.D., Zolfaghari, M.R. and Parhizgari, N., 2013. Genotyping of Pseudomonas aeruginosa strains isolated from burn patients by RAPD-PCR. Burns, 39: 1409-1413. https://doi.org/10.1016/j.burns.2013.03.008
Ranjbar, R., Karami, A., Farshad, S., Giammanco, G.M. and Mammina, C., 2014. Typing methods used in the molecular epidemiology of microbial pathogens: A how to guide. New Microbiol., 37: 1-15.
Reboud, E., Elsen, S., Bouillot, S., Golovkine, G., Basso, P., Jeannot, K. and Huber, P., 2016. Phenotype and toxicity of the recently discovered exlA-positive Pseudomonas aeruginosa strains collected worldwide. Environ. Microbiol., 18: 3425-3439. https://doi.org/10.1111/1462-2920.13262
Ruiz-Martínez, L., López-Jiménez, L., Fusté, E., Vinuesa, T., Martínez, J.P. and Viñas, M., 2011. Class 1 integrons in environmental and clinical isolates of Pseudomonas aeruginosa. Int. J. Antimicrob. Agents, 38: 398-402. https://doi.org/10.1016/j.ijantimicag.2011.06.016
Suárez, P., Gutiérrez, A.V., Salazar, V., Puche, M.L., Serrano, Y., Martínez, S. and Fernández-Delgado, M., 2020. Virulence properties and antimicrobial resistance of Pseudomonas aeruginosa isolated from cave waters at Roraima Tepui, Guayana Highlands. Lett. appl. Microbiol., 70: 372-379. https://doi.org/10.1111/lam.13283
Wieland, C.W., Siegmund, B., Senaldi, G., Vasil, M.L., Dinarello, C.A. and Fantuzzi, G., 2002. Pulmonary inflammation induced by Pseudomonas aeruginosa lipopolysaccharide, phospholipase C, and exotoxin A: Role of interferon regulatory factor 1. Infect. Immun., 70: 1352-1358. https://doi.org/10.1128/IAI.70.3.1352-1358.2002
Wu, Q., Ye, Y., Li, F., Zhang, J. and Guo, W., 2016. Prevalence and genetic characterization of Pseudomonas aeruginosa in drinking water in Guangdong Province of China. LWT Fd. Sci. Technol., 69: 24-31. https://doi.org/10.1016/j.lwt.2016.01.014
Zanetti, M.O., Martins, V.V., Pitondo-Silva, A. and Stehling, E.G., 2013. Antimicrobial resistance, plasmids and class 1 and 2 integrons occurring in Pseudomonas aeruginosa isolated from Brazilian aquatic environments. Water Sci. Technol., 67: 1144-1149. https://doi.org/10.2166/wst.2013.676
Zulfahmi, Z., Parjanto, P., Purwanto, E. and Yunus, A., 2021. Genetic diversity and population structure of Eurycoma apiculata in Eastern Sumatra, Indonesia. Biodivers. J., 22: 10-11. https://doi.org/10.13057/biodiv/d221036