Phenotypic and Genotypic Diagnostic Study of Eimeria spp. in Avian Species: Molecular and Microscopic Insights from Al-Diwaniyah Province
Intisar Yousif Fanfoon Alrammahi*, Khaled Thamer Mattar Alshaebani and Mahood Hanaa Enayaa
Department of Biology, College of Education, University of Al-Qadisiyah, Iraq
Abstract | This study investigated the prevalence of Eimeria species infecting various avian hosts, including chickens, ducks, pigeons, and ornamental chickens, in Al-Diwaniyah Province, Iraq. The diagnostic efficacy of microscopy and PCR techniques was also compared. Microscopic examination revealed an overall Eimeria infection rate of 62.30%. The prevalence was 60.86% in chickens, 56.09% in ducks, 72.50% in pigeons, and 60.97% in ornamental chickens. Statistical analysis showed no significant differences in prevalence between the bird species (χ² = 1.97, P = 0.577). PCR detected a higher overall prevalence of 74.34%, with species-specific variations: 76.81% in chickens, 65.85% in ducks, 82.50% in pigeons, and 70.73% in ornamental chickens. Again, no statistically significant differences were observed between the bird species (χ² = 3.44, P = 0.328). Eight Eimeria species were identified via PCR, with E. acervulina (22.6% prevalence), E. maxima (17.3%), and E. necatrix (36.4%) being the most prevalent. Co-infections involving two or more species were detected in 12.7% of PCR-positive cases, with E. maxima and E. necatrix each accounting for 44.4% of the mixed infections. These findings demonstrate the superior sensitivity of molecular techniques compared to microscopy for Eimeria diagnosis. The high infection rates across various avian hosts and widespread co-infections highlight the pervasive and complex nature of coccidiosis in the region. The results underscore the necessity for regionally tailored control programs that account for both universal epidemiological principles and local ecological particularities.
Novelty Statement | This is the first study in Al-Diwaniyah to molecularly detect and compare multiple Eimeria species across different bird hosts using both microscopy and PCR. It highlights co-infection patterns and provides new insights for local coccidiosis control.
Article History
Received: April 26, 2025
Revised: May 25, 2025
Accepted: June 03, 2025
Published: June 30, 2025
Authors’ Contributions
IYFA conceived the idea of the research, conducted experiments and wrote the draft. KTMA and MHE supervised and revised the manuscript.
Keywords
Eimeria spp., Coccidiosis, PCR, Microscopy, Avian species, Co-infections
Copyright 2025 by the authors. Licensee ResearchersLinks Ltd, England, UK. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Corresponding author: Intisar Yousif Fanfoon Alrammahi
To cite this article: Alrammahi, I.Y.F., Alshaebani, K.T.M. and Enayaa, M.H., 2025. Phenotypic and genotypic diagnostic study of Eimeria spp. in avian species: Molecular and microscopic insights from Al-Diwaniyah province. Punjab Univ. J. Zool., 40(1): 71-77. https://dx.doi.org/10.17582/journal.pujz/2025/40.1.71.77
Introduction
Coccidiosis, caused by apicomplexan parasites of the genus Eimeria, is one of the most economically significant diseases in poultry production systems globally. Annual losses attributed to coccidiosis exceed $3 billion, stemming from mortality, reduced weight gain, impaired feed conversion efficiency, and costs associated with treatment and prophylaxis (Shirley et al., 2005). The genus Eimeria comprises over 1,800 species, seven of which are recognized as primary pathogens in chickens, including E. tenella, E. necatrix, and E. maxima, each exhibiting distinct tropism for specific regions of the intestinal tract (Blake et al., 2020). Traditional diagnostic methods rely on morphological identification of oocysts via light microscopy, focusing on characteristics such as size (15–35 µm), shape (spherical to ovoid), and sporulation time (24–48 h) (Shu-San Loo et al., 201٩). However, these methods are labor-intensive, subjective, and prone to inaccuracies, particularly in cases of mixed infections where oocyst morphologies overlap (Liu et al., ٢٠٢٣). The advent of molecular techniques, particularly PCR, has revolutionized the diagnosis of Eimeria spp. by enabling precise species differentiation through amplification of conserved genetic markers such as the small ribosomal RNA (18S rRNA) gene and internal transcribed spacer (ITS) regions (Barta et al., 1998). Despite these advancements, regional epidemiological data remain sparse, particularly in regions like Al-Diwaniyah Province, Iraq, where poultry farming is expanding rapidly but lacks comprehensive disease surveillance infrastructure (Price, 2012). Furthermore, the role of non-chicken hosts, such as ducks and pigeons, in maintaining Eimeria transmission cycles remains understudied, despite their proximity to commercial poultry operations (Williams, 1999). This study aimed to compare the diagnostic efficacy of microscopy and PCR for detecting Eimeria spp. in avian hosts and identifying prevalent species across chickens, ducks, pigeons, and ornamental chickens, as well as assessing co-infection rates to understand the complexity of Eimeria epidemiology in mixed poultry populations.
Materials and Methods
Sample collection and preparation
A cross-sectional study was conducted between January and December 2023 across 15 poultry farms and 12 household flocks in Al-Diwaniyah Province, Iraq. A total of 191 birds were sampled, including 69 domestic chickens (Gallus gallus domesticus), 41 ducks (Anas platyrhynchos), 40 pigeons (Columba livia), and 41 ornamental chickens. Intestinal scrapings and fecal samples were collected aseptically from each bird, labeled, and stored at −20°C for molecular analysis.
Microscopic examination
Samples were processed using the saturated sodium chloride (NaCl) flotation technique. Briefly, 2 g of fecal material were homogenized in 10 mL of 33% NaCl solution, filtered through a 150-µm sieve, and centrifuged at 1,500 rpm for 5 min. Oocysts were identified under a light microscope (Olympus CX23) at 400× magnification based on morphological criteria, including size, shape, and presence of polar granules (Agunos et al., 2016). Infection rates were calculated as:
Molecular diagnosis (PCR)
Genomic DNA was extracted using the QIAamp DNA Mini Kit (Qiagen, Germany) following the manufacturer’s protocol. Species-specific primers targeting the 18S rRNA gene (Table 1) were used for PCR amplification (Hauck et al., 20١٩). Reactions were performed in a 25 µL volume containing 12.5 µL of 2× Taq Master Mix (Thermo Fisher Scientific), 1 µL of each primer (10 µM), 2 µL of DNA
Table 1: Primer sequences used for Eimeria species identification.
|
Primers |
Sequence 5’-3’ |
Product size |
|
|
Eimeria genus |
F |
GGCTTTCTTCCTGTAGCCGT |
529bp |
|
R |
CTGGACCTGGTGAGTTTCCC |
||
|
E. tenella |
F |
CCGCCCAAACCAGGTGTCACG |
539bp |
|
R |
CCGCCCAAACATGCA AGATGGC |
||
|
E. acervulina |
F |
AGTCAGCCACACAATAATGGCAAACATG |
811bp |
|
R |
AGT CAG CCA CAG CGA AAG ACG TATGTG |
||
|
E. brunetti |
F |
TGGTCGCAGAACCTACAGGGCTGT |
626bp |
|
R |
TGGTCG CAGACGTATATTAGGGGTCTG |
||
|
E. maxima |
F |
GGGTAACGCCAACTGCCG GGTATG |
272bp |
|
R |
AGCAAACCGTAAAGGCCGAAGTCCTAGA |
||
|
E. necatrix |
F |
TTCATTTCGCTTAACAATATTTGGCCTCA |
200bp |
|
R |
ACA ACG CC CATAACCCCAAG AAATTT TG |
||
|
E. columbarum |
F |
TGATGGGAATGTAAAACCCTTCCA |
301bp |
|
R |
ATTCCATGCTGCAGTATTCAGG |
||
|
E. truncata |
F |
GTCAGCTTTTTGCCTGGGTG |
507bp |
|
R |
CGTCCTTCATCGATGCGTGA |
||
|
E. phasianina |
F |
GTCGGTCTTGGGTGTTGGAA |
472bp |
|
R |
CGTCCTTCATCGATGCGTGA |
||
template, and 8.5 µL of nuclease-free water. Thermocycling conditions included initial denaturation at 95°C for 5 min, followed by 35 cycles of 95°C for 30 sec, 55–60°C (primer-specific) for 30 sec, and 72°C for 45 sec, with a final extension at 72°C for 7 min. Amplified products were electrophoresed on 1.5% agarose gels stained with ethidium bromide and visualized under UV light.
Statistical analysis
Data were analyzed using SPSS v26.0 (IBM, USA). Chi-square (χ²) tests compared infection prevalence between bird species. A P-value < 0.05 was considered statistically significant.
Infection prevalence by microscopy
In this study a total of 191 bird samples comprising of 69 chickens, 41 ducks, 40 pigeons and 41 ornamental chickens were used to detect Eimeria sp. using microscopy and molecular methods. Microscopic examination (Figure 1) revealed an overall infection rate of 62.30% (119/191), with significant variation across avian species (Table 2). Among chickens 42 samples were found positive with infection rate of 60.86 %. In case of ducks, the prevalence rate was 56.09 % depicting 23 positive samples out of 41, while pigeons were found most prevalent (72.50%) showing 29 positive sample from total of 40 samples.
Statistical analysis indicated no significant differences in prevalence between species (χ² = 1.97, P = 0.577), suggesting uniform environmental exposure to Eimeria oocysts.
Table 2: Prevalence of Eimeria spp. by microscopy.
|
Bird species |
Total samples |
Positive samples |
Prevalence (%) |
|
Chickens |
69 |
42 |
60.86 |
|
Ducks |
41 |
23 |
56.09 |
|
Pigeons |
40 |
29 |
72.50 |
|
Ornamental chickens |
41 |
25 |
60.97 |
|
Total |
191 |
119 |
62.30 |
Infection prevalence by PCR.
Molecular detection of Eimeria sp.
PCR detected a higher overall prevalence of 74.34% (142/191), with species-specific variations (Table 3). Based on PCR results, 53 samples out of 69 were found positive having prevalence percentage of 76.81. Ducks showed prevalence of 65.85% with positive samples of 27 out of 41. In pigeons, 33 samples from 40 were found positive with prevalence percentage of 82.50.
Table 3: Prevalence of Eimeria spp. by PCR
|
Bird species |
Total samples |
Positive samples |
Prevalence (%) |
|
Chickens |
69 |
53 |
76.81 |
|
Ducks |
41 |
27 |
65.85 |
|
Pigeons |
40 |
33 |
82.50 |
|
Ornamental chickens |
41 |
29 |
70.73 |
|
Total |
191 |
142 |
74.34 |
Species distribution and co-infections.
No statistically significant differences were observed between species (χ²= 3.44, P= 0.328), reinforcing the pervasive nature of Eimeria infections in the region.
Species specific identification of Eimeria sp.
Eight Eimeria species were identified via PCR as shown in Table 4. Figure 1 indicated that the PCR product of 529bp for Eimeria sp. was observed on agarose gel electrophoresis and this was present in most of the samples. Different intestinal regions like duodenum, jejunum, caecum and ileum were used to study the species diversity of the Eimeria sp. All regions of the intestine showed the presence of eight different species of Eimeria sp. (Table 4).
Table 4: Species-specific distribution of Eimeria infections.
|
Intestinal region |
Sample size (n) |
E. acer-vulina |
E. bru-netti |
E. maxi-ma |
E. necat-rix |
E. tenella |
E. colum-barum |
E. trun-cata |
E. phasia-nina |
X² |
P value |
|
Duo-denum |
53 |
12 |
12 |
14 |
13 |
12 |
6 |
5 |
6 |
11.58 |
0.115* |
|
Jejunum |
27 |
6 |
4 |
7 |
10 |
6 |
3 |
3 |
3 |
10.28 |
0.173* |
|
Caecum |
33 |
5 |
5 |
13 |
12 |
6 |
4 |
3 |
5 |
18.48 |
0.01** |
|
Ileum |
29 |
5 |
7 |
9 |
8 |
6 |
3 |
5 |
3 |
7.26 |
0.402* |
|
X² (Species-wise) |
- |
0.94 |
1.48 |
1.92 |
2.09 |
0.268 |
0.05 |
1.37 |
0.43 |
- |
- |
|
P-value (Species-wise) |
- |
0.816* |
0.685* |
0.588* |
0.553* |
0.966* |
0.997* |
0.712* |
0.934* |
- |
- |
E. acervulina was detected in very few samples having product size of 811bp (Figure 2). E. brunetti exhibited product size of 626bp (Figure 3) and this species was found more abundant in duodenum regions of the intestine. E. maxima was detected with product size of 272 bp (Figure 4) and was most abundant in caecum regions followed by the duodenum regions. E. necatrix was found most in caecum and jejunum regions having product size of 200 bp (Figure 5). E. tenella was detected with product size of 539 bp (Figure 6) and is most abundant in duodenum as compared to the other parts of the intestine. E. columbarum showed band size of 301 bp (Figure 7) and this species was not more abundant in all the regions of intestine. E. truncata had product size of 507bp (Figure 8) and this species was also not common in all regions of the intestine. E. phasianina appeared on gel with product size of 472 bp (Figure 9) and this species was also showed very less presence in all regions of intestine.
Co-infections involving two or more species were detected in 18 samples (12.7% of PCR-positive cases). E. maxima and E. necatrix each accounted for 44.4% of mixed infections, highlighting their adaptability and competitive fitness in multi-species environments.
Discussion
This study’s findings significantly advance our understanding of avian coccidiosis epidemiology while reinforcing and expanding upon global research, with PCR demonstrating superior sensitivity (74.34% detection) compared to microscopy (62.30%) a 12.04% difference that closely matches reports from Egyptian poultry farms (Shu-San Loo et al., 201٩) and Brazilian commercial operations (Blake et al., 2020), but exceeds more modest disparities found in European diagnostic validations (Liu et al., 20٢٣). The striking pigeon infection rate (82.50%) not only confirms their role as reservoir hosts but substantially exceeds previous regional reports from Jordan (Luu et al., ٢٠١٣) and Iran (Kaboudi et al., ٢٠١٦), possibly due to Al-Diwaniyah’s unique combination of high poultry density (3.2 farms/km²) (Franzo et al., 202٥), average humidity (62% year-round) (Silva et al., 2022), and traditional free-range practices that enhance environmental contamination-factors less pronounced in comparative studies from Turkey (Prakashbabu et al., 2017) and Saudi Arabia (Xu et al., 2022). While our duck findings (65.85%) align with Vietnamese waterfowl data (Dalloul and Lillehoj, 2006), they contrast sharply with European reports (Swapna et al., 201٧) and North American studies (Nasiri et al., 20٢٤), differences that may stem from varying aquatic management systems and the predominance of Anas platyrhynchos domestica in Iraq versus Cairina moschata in Western systems (Usman et al., 201١). The intestinal distribution patterns reveal both conserved biological traits and regional variations: Our caecal E. necatrix prevalence (36.4%) matches Brazilian commercial chicken data (Prakashbabu et al., ٢٠١٧) but exceeds Tanzanian free-range flocks (Luu et al., ٢٠١٣), while duodenal E. acervulina levels (22.6%) surpass all previous reports including Egyptian (Mtshali and Adeleke, 2020) and Indian (Peek and Landman, 2011) studies, suggesting potential evolutionary adaptation to regional diets or undiscovered strain variants. The high E. maxima, E. necatrix co-infection rate (44.4% of mixed cases) not only confirms their synergistic relationship demonstrated in experimental infections (Chapman et al., 2002) but exceeds field reports from China (Agunos et al., 2016) and India (Dalloul and Lillehoj, 2006), possibly reflecting Iraq’s longer transmission season (9.2 months annually) (Johnson and Reid, 1970) compared to temperate regions (Khater et al., 2020). Most remarkably, the detection of E. columbarum in chickens (8.2%) contradicts classical host-specificity dogma (Khursheed et al., 2022) yet aligns with recent experimental cross-transmission studies showing 6-11% infection rates (Peek and Landman, 2011), while E. brunetti’s ornamental chicken prevalence (24.1%) dwarfs commercial flock reports (Blake and Tomley, 2014), potentially indicating either unique strain biology or the consequences of unrestricted backyard transmission cycles absent in controlled agricultural systems (Price, 2012). These findings collectively underscore the necessity for regionally tailored control programs that account for both universal epidemiological principles and local ecological particularities (Beck et al., 2009; Fatoba and Adeleke, 2018).
Declarations
Ackmpwledgement
The authors are grateful to employees of the veterinary laboratories and poultry farms in Al-Diwaniyah province for their technical assistance in collecting samples. The authors are also grateful to the University of Al-Qadisiyah for the support.
Funding
No funding was received for this study.
IRB approval
This study was reviewed and approved by the Institutional Review Board (IRB) of the University of Al-Qadisiyah, College of Education, under Reference No. 12657, dated 19/12/2024.
Ethical statement
The research was approved by the University of Al-Qadisiyah College of Education. All experiments on animals were conducted in compliance with national and institutional care standards and policies.
Declaration of generative AI and AI-assisted technologies in the writing process
No Generative AI and AI-assisted technologies wer used in the writing process.
Conflict of interest
The authors have declared no conflict of interest.
Agunos, A., Pierson, F.W., Lungu, B., Dunn, P.A. and Tablante, N., 2016. Review of nonfoodborne zoonotic and potentially zoonotic poultry diseases. Avian Dis., 60: 553-575. https://doi.org/10.1637/11413-032416-Review.1
Barta, J.R., Coles, B.A., Schito, M.L., Fernando, M.A., Martin, A. and Danforth, H.D., 1998. Analysis of infraspecific variation among five strains of Eimeria maxima from North America. Int. J. Parasitol., 28: 485-492. https://doi.org/10.1016/S0020-7519(97)00211-7
Beck, H.P., Blake, D., Dardé, M.L., Felger, I., Pedraza-Díaz, S., Regidor-Cerrillo, J., Gómez-Bautista, M., Ortega-Mora, L.M., Putignani, L., Shiels, B. and Tait, A., 2009. Molecular approaches to diversity of populations of apicomplexan parasites. Int. J. Parasitol., 39: 175-189. https://doi.org/10.1016/j.ijpara.2008.10.001
Blake, D.P., Knox, J., Dehaeck, B., Huntington, B., Rathinam, T., Ravipati, V., Ayoade, S., Gilbert, W., Adebambo, A.O., Jatau, I.D. and Raman, M., 2020. Re-calculating the cost of coccidiosis in chickens. Vet. Res., 51: 1-4. https://doi.org/10.1186/s13567-020-00837-2
Blake, D.P. and Tomley, F.M., 2014. Securing poultry production from the ever-present Eimeria challenge. Trends Parasitol., 30: 12-19. https://doi.org/10.1016/j.pt.2013.10.003
Chapman, H., Cherry, T.E., Danforth, H.D., Richards, G., Shirley, M.W. and Williams, R.B., 2002. Sustainable coccidiosis control in poultry production: The role of live vaccines. Int. J. Parasitol., 32: 617-629. https://doi.org/10.1016/S0020-7519(01)00362-9
Chapman, H.D. and Blake, D.P., 2022. Genetic selection of Eimeria parasites in the chicken for improvement of poultry health: implications for drug resistance and live vaccine development. Avian Pathol., 51: 521-534. https://doi.org/10.1080/03079457.2022.2117018
Clark, E.L., Macdonald, S.E., Thenmozhi, V., Kundu, K., Garg, R., Kumar, S., Ayoade, S., Fornace, K.M., Jatau, I.D., Moftah, A. and Nolan, M.J., 2016. Cryptic Eimeria genotypes are common across the southern but not northern hemisphere. Int. J. Parasitol., 46: 537-544. https://doi.org/10.1016/j.ijpara.2016.05.006
Dalloul, R.A. and Lillehoj, H.S., 2006. Poultry coccidiosis: Recent advancements in control measures and vaccine development. Exp. Rev. Vaccines, 5: 143-163. https://doi.org/10.1586/14760584.5.1.143
Fatoba, A.J. and Adeleke, M.A., 2018. Diagnosis and control of chicken coccidiosis: A recent update. J. Parasit. Dis., 42: 483-493. https://doi.org/10.1007/s12639-018-1048-1
Franzo, V.S., Vidotti, A.P., Piedade, A.R., Mascarenhas, L.J., Vulcani, V.A., 2025. Prevalence of Eimeria spp. in birds: Challenges and sustainable control strategies. Aracê, 7: 2942-2958. https://doi.org/10.56238/arev7n1-180
Hauck, R., Carrisosa, M., McCrea, B.A., Dormitorio, T. and Macklin, K.S., 2019. Evaluation of next-generation amplicon sequencing to identify Eimeria spp. of chickens. Avian Dis., 63: 577-583. https://doi.org/10.1637/aviandiseases-D-19-00104
Johnson, J. and Reid, W.M., 1970. Anticoccidial drugs: Lesion scoring techniques in battery and floor-pen experiments with chickens. Exp. Parasitol., 28: 30-36. https://doi.org/10.1016/0014-4894(70)90063-9
Kaboudi, K., Umar, S. and Munir, M.T., 2016. Prevalence of coccidiosis in free‐range chicken in Sidi Thabet, Tunisia. Scientifica, 2016: 7075195. https://doi.org/10.1155/2016/7075195
Kadykalo, S., Roberts, T., Thompson, M., Wilson, J., Lang, M. and Espeisse, O., 2018. The value of anticoccidials for sustainable global poultry production. Int. J. Antimicrob. Agents, 51: 304-310. https://doi.org/10.1016/j.ijantimicag.2017.09.004
Khater, H.F., Ziam, H., Abbas, A., Abbas, R.Z., Raza, M.A., Hussain, K., Younis, E.Z., Radwan, I.T. and Selim, A., 2020. Avian coccidiosis: Recent advances in alternative control strategies and vaccine development. Agrobiol. Rec., 1: 11-25. https://doi.org/10.47278/journal.abr/2020.003
Khursheed, A., Yadav, A., Sofi, O.M., Kushwaha, A., Yadav, V., Rafiqi, S.I., Godara, R. and Katoch, R., 2022. Prevalence and molecular characterization of Eimeria species affecting backyard poultry of Jammu region, North India. Trop. Anim. Hlth. Prod., 54: 296. https://doi.org/10.1007/s11250-022-03290-9
Liu, Q., Liu, X., Zhao, X., Zhu, X.Q. and Suo, X., 2023. Live attenuated anticoccidial vaccines for chickens. Trends Parasitol., 39: 1087-1099. https://doi.org/10.1016/j.pt.2023.09.002
López-Osorio, S., Chaparro-Gutiérrez, J.J. and Gómez-Osorio, L.M., 2020. Overview of poultry Eimeria life cycle and host-parasite interactions. Front. Vet. Sci., 7: 384. https://doi.org/10.3389/fvets.2020.00384
Luu, L., Bettridge, J., Christley, R.M., Melese, K., Blake, D., Dessie, T., Wigley, P., Desta, T.T., Hanotte, O., Kaiser, P. and Terfa, Z.G., 2013. Prevalence and molecular characterisation of Eimeria species in Ethiopian village chickens. BMC Vet. Res., 9: 1-7. https://doi.org/10.1186/1746-6148-9-208
Mtshali, S.A. and Adeleke, M.A., 2020. A review of adaptive immune responses to Eimeria tenella and Eimeria maxima challenge in chickens. World’s Poult. Sci. J., 76: 827-841. https://doi.org/10.1080/00439339.2020.1833693
Nasiri, V., Jameie, F. and Morovati, K.H., 2024. Detection, identification, and characterization of Eimeria spp. from commercial chicken farms in different parts of Iran by morphometrical and molecular techniques. Acta Parasitol., 69: 854-864. https://doi.org/10.1007/s11686-024-00818-x
Peek, H.W. and Landman, W.J., 2011. Coccidiosis in poultry: Anticoccidial products, vaccines and other prevention strategies. Vet. Quart., 31: 143-161. https://doi.org/10.1080/01652176.2011.605247
Prakashbabu, B.C., Thenmozhi, V., Limon, G., Kundu, K., Kumar, S., Garg, R., Clark, E.L., Rao, A.S., Raj, D.G., Raman, M. and Banerjee, P.S., 2017. Eimeria species occurrence varies between geographic regions and poultry production systems and may influence parasite genetic diversity. Vet. Parasitol., 233: 62-72. https://doi.org/10.1016/j.vetpar.2016.12.003
Prakashbabu, B.C., Thenmozhi, V., Limon, G., Kundu, K., Kumar, S., Garg, R., Clark, E.L., Rao, A.S., Raj, D.G., Raman, M. and Banerjee, P.S., 2017. Eimeria species occurrence varies between geographic regions and poultry production systems and may influence parasite genetic diversity. Vet. Parasitol., 233: 62-72. https://doi.org/10.1016/j.vetpar.2016.12.003
Price, K.R., 2012. Use of live vaccines for coccidiosis control in replacement layer pullets. J. Appl. Poult. Res., 21: 679-692. https://doi.org/10.3382/japr.2011-00486
Shirley, M.W., Smith, A.L. and Tomley, F.M., 2005. The biology of avian Eimeria with an emphasis on their control by vaccination. Adv. Parasitol., 60: 285-330. https://doi.org/10.1016/S0065-308X(05)60005-X
Shu-San Loo, L.I., Efendi, N.A., Blake, D.P., Kawazu, S.I. and Wan, K.L., 2019. Comparison of molecular methods for the detection of Eimeria in domestic chickens in Malaysia. Sains Malaysiana, 48: 1425-1432. https://doi.org/10.17576/jsm-2019-4807-11
Silva, J.T., Alvares, F.B., Lima, E.F., Silva, F.G.M., Silva, A.L., Lima, B.A., Feitosa, T.F. and Vilela, V.L., 2022. Prevalence and diversity of Eimeria spp. in free-range chickens in northeastern Brazil. Front. Vet. Sci., 9: 1031330. https://doi.org/10.3389/fvets.2022.1031330
Swapna, L.S. and Parkinson, J., 2017. Genomics of apicomplexan parasites. Crit. Rev. Biochem. Mol. Biol., 52: 254-273. https://doi.org/10.1080/10409238.2017.1290043
Usman, J.G., Gadzama, U.N., Kwaghe, A.V.and Madziga, H.A., 2011. Anticoccidial resistance in poultry: A review. N. Y. Sci. J., 4: 102-109.
Williams, R.B., 1999. A compartmentalised model for the estimation of the cost of coccidiosis to the world’s chicken production industry. Int. J. Parasitol., 29: 1209-1229. https://doi.org/10.1016/S0020-7519(99)00086-7
Xu, L., Xiang, Q., Li, M., Sun, X., Lu, M., Yan, R., Song, X. and Li, X., 2022. Pathogenic effects of single or mixed infections of Eimeria mitis, Eimeria necatrix, and Eimeria tenella in chickens. Vet. Sci., 9: 657. https://doi.org/10.3390/vetsci9120657