PJZ_57_4_1835-1843

Introduction

Marek’s disease (MD) is an avian-specific disease that causes immunosuppression, neurological disorders, CD4+ T-cell transformation and, eventually, tumour formation in peripheral nerves and visceral organs (Calnek, 2001). Marek’s disease virus (MDV), which causes MD, belongs to the genus Mardivirus in the subfamily Alphaherpesvirinae (Gatherer et al., 2021). Previously, MD been well controlled by live vaccines. Although MDV is has a relatively stable dsDNA virus for which commercially available vaccines are available, poultry farming in JuRong, Jiangsu Province, has led to pathogen evolution as a result of cramped living conditions and shorter rearing periods.

MDV was first detected by Josef Marek in 1907. There are three serotypes of MDV, MDV-1 (GaHV-2), MDV-2 (GaHV-3) and MDV-3 (MeHV-1), of which only MDV-1 induces tumours in birds (Bulow and Biggs, 1975). There are four pathotypes of MDV-1 as evaluated by monovalent HVT or bivalent HVT+SB-1 vaccinations: mild (m) MDV, virulent (v) MDV, very virulent (vv) MDV and very virulent plus (vv+) MDV (Witter, 1997, Witter et al., 2005). In addition, chickens, similar to turkeys (Davidson and Borenstein, 1999), quail (Kobayashi et al., 1986) and pheasant (Lesnik et al., 1981), have been found to be infected with MDV. All chickens, including gamefowl (Kenzy et al., 1964), native breeds (Grewal et al., 1977) and jungle fowl (Weiss and Biggs, 1972), are susceptible to tumour development induced by MDV infection. The transmission of MDV is horizontal rather than vertical, and MDV cannot be transmitted from chicken to egg (Boodhoo et al., 2016). Skin dander contains viruses that can persist for at least several months at room temperature (Calnek, 1986).

However, due to the continued evolution of MDV, MD remains a serious threat to poultry and causes substantial economic losses annually worldwide (Yu et al., 2023). The current live vaccines allow MDV to exist in vaccinated hosts and be shed into the environment (Davison and Nair, 2005). Thus, the present study analysed the pathogenicity of newly isolated MDV strains from tumour-bearing chickens in China and revealed that the protection indices (PIs) of four commercial MD vaccines (CVI988, HVT, CVI988+HVT, and 814) for the new isolates were less than 50% (Liu et al., 2023). Although MD vaccines can effectively prevent disease occurrence, including the occurrence of tumours, they cannot completely prevent the transmission of the virus, which may lead to the evolution and enhancement of virulence (Read et al., 2015). In recent years, several countries have reported that emerging strains of vvMDV, vv+MDV, and other variants in many chicken flocks are thought to be the major reasons for MD vaccine failures (Song et al., 2022).

In recent years, especially between 2019 and 2023, many chicken flocks, particularly in the southern to northeastern regions of China, have suffered from neoplastic avian diseases, which are caused mainly by MDV infection (Zheng et al., 2022). In this study, we report a recent case of MD in yellow feathered chickens from a small poultry farm (containing 300 chickens) in JuRong, Jiangsu Province. Necropsy of seven chickens from this flock was performed, and the pathologic organs were collected. Detection of MDV was performed using histopathological assays and PCR. Meq and 132-bp tandem repeat region genes were selected for the detection of MDV. These genes, which are associated with oncogenicity and virus replication, are usually mutated in virulent MDVs. In this study, conducted in JuRong, Jiangsu Province, MDV1 was isolated from immunized chickens and molecularly characterized. The results show that MD outbreaks occur frequently in MD-vaccinated chicken flocks, but the key pathogenic determinants and influencing factors remain unclear.

Materials and Methods

Clinical samples

Seven 3-months old chickens were obtained from a chicken flock in JuRong, Jiangsu Province, in April 2023. The chickens belonged to a small family-type flock (the capacity was 300 chickens) that also included ducks. All chickens were necropsied for gross pathological examination and PCR. The chickens were previously immunized with the MDV vaccine CVI988. Cages were not isolated from the outside, so the chickens were able to mingle with wild birds. These chickens were free-range chickens that moved outside during the day and lived in cages at night.

Histopathological assay

The spleen and liver from the sick chickens were fixed in 10% neutral formalin, dehydrated in alcohol, and embedded in paraffin. The tissues were sliced, stained with HE and visualized via light microscopy.

Virus isolation from feather follicles

The feather follicles from the dead chickens were used to isolate the virus. Accordingly, feather tips approximately 5 mm in length were suspended in phosphate buffer (pH 7.2) and freeze‒thawed three times. The suspension was filtered through a 0.45 μm membrane filter and cultured in CEFs. Then, the medium was added, and the cultures were incubated for 7 days. Cells infected with the field strain were cultured for three blind passages. PCR was used to confirm infection in cultured cells with CPE.

Genomic DNA extraction and PCR amplification of MDV genes

Genomic DNA extracted from feather follicle samples was used for the diagnosis of MDV. The samples were digested in lysis buffer (10 mM Tris, 100 mM EDTA, 0.5% SDS, 0.2 mg/ml proteinase K), extracted three times with phenol/chloroform, precipitated in 100% ethanol and washed twice with 70% ethanol. Finally, the DNA was dissolved in TE buffer (10 mM Tris-HCl, 1 mM EDTA; pH 8.0). In the PCR system, a 50 μl reaction mixture, consisting of 25 μl of 2 × Phanta Max Buffer, 2 μl of each of the two primers (10 µmol), 1 μl of Phanta Max Super-Fidelity DNA Polymerase (Vazyme, China), 19 μl of ddH2O, and 1 μl of DNA template, was used. The PCR conditions for the Meq and 132-bp tandem repeat region genes were as follows: 95°C for 3 min; 33 cycles of 95°C for 15 s, 54°C for 15 s, and 72°C for 40 s; and 72°C for 5 min. The PCR conditions for the full-length Meq gene were as follows: 95°C for 3 min; 33 cycles of 95°C for 15 s, 54°C for 15 s, and 72°C for 60 s; and 72°C for 5 min. The primers used for amplification are listed in Table I.

Table I. Primers used for amplification of MDV viral genes.

Name	Sequence (5’ → 3’)	Length
132-bp tandem repeat regions	F: TGCGATGAAAGTGCTATGGAGG R: GAGAATCCCTATGAGAAAGCGC	317bp
MDV-Meq- partial	F: TTCCCTGACGGCCTATCTGA R: TTCGGGATCCTCGGTAAGAC	786bp
MDV-Meq	F: AGAGATGTCTCAGGAGCCAGAGCC R: ATCATCAGGGTCTCCCGTCACCTG	1020 bp

Table II. GenBank accession numbers of the Meq gene sequences used in this study.

Isolate	Country of origin	Accession number	Pathotype
CVI988/ Rispens	Netherlands	AY243334.1	attMDV
GA	USA	AF147806.2	vMDV
Md5	USA	AF243438.1	vvMDV
RB/1B	USA	HM488349.1	vvMDV
648A	USA	AY362725.1	vv+MDV
SD-2012	China	KC511815.1	vvMDV
LMS	China	AEM63531.1	vvMDV
HNXZ105	China	HF546100.1	N.A.
HNGS101	China	HF546084.1	N.A.
HNGS206	China	HF546086.1	N.A.
HNLC107	China	HF546091.1	N.A.
HNLC202	China	HF546092.1	N.A.
HNLC203	China	HF546093.1	N.A.
HNLC401	China	HF546094.1	N.A.
HNLC502	China	HF546095.1	N.A.
CC/1409	China	KU744560.1	N.A.
WC/1203	China	KU744558.1	N.A.
JL/1404	China	KU744559.1	N.A.
GX0101	China	JX844666.1	vvMDV
LTS	China	KP888838.1	N.A.
HS/1412	China	KU744561.1	vMDV

Att, attenuated; N.A., not available; v, virulent; vv, very virulent; vv+, very virulent plus.

Sequencing and phylogenetic analysis

The PCR products were gel puriﬁed and sequenced by a commercial sequencing service (Sangon Biotech, China). The nucleotide sequence data of the JuRong 2023 strain were obtained from the company, and those of other strains were collected from GenBank. The data were subsequently analysed with MegAlign software. Additionally, phylogenetic trees for the Meq genes were constructed with MEGA 5.0 software. At this stage, the neighbour‒joining method with 1000 bootstrap replicates was used. The MDV-1 strains in Table II were used to construct the phylogenetic tree and calculate pairwise sequence identity.

Results

Clinical necropsy and histopathological assays

Sick chickens approximately 3 months of age that had already been immunized with the CVI988 vaccine were found in JuRong, Jiangsu Province. Clinical symptoms of MD, such as anorexia, inability to stand up, and loss of weight, were recorded by the owners in approximately 30 chickens. Seven of the chickens were subsequently sent to our laboratory, and the samples were numbered 1 to 7. One of them was dead on arrival and was labelled sample 1. All the chickens were necropsied for gross pathological examination in the Veterinary Pathology Laboratory. Feather samples were collected from these chickens. The nodules in the spleen and liver of four out of the seven chickens were revealed by clinical necropsy. Figure 1A and B shows the nodular lesions, which were white or grey in colour, in the spleen and liver of chicken sample 1. No obvious lesions were found in other organs or leg nerves. The histopathological features included pleomorphic lymphoid cells and other mitotic features in the spleen (Fig. 1C). Infiltrating lymphoid cells were present in the liver, which led to destruction of the tissue structure, corresponding to the classic lesions observed for MDV (Fig. 1D).

Detection of the MDV genome by PCR

Genomic DNA extracted from feather follicle samples of sick chickens was used to detect the MDV genes. The 132-bp tandem repeat regions (Fig. 2A) and Meq (Fig. 2B) genes were detected in all the samples via PCR. CEFs infected with Md5 and CVI988, which are MDV serotype 1 strains, were used as MDV-positive controls. The negative control was CEF cells. Following PCR using primers specific for 132-bp tandem repeat regions, positive amplification products were obtained from all the samples.

Except for samples 4 and 5, in which multiple bands were amplified, the amplified bands of the other samples were similar to those observed in the Md5-positive control (Fig. 2A). The designed sequence of the Meq primers was used to distinguish between Meq and L-Meq to identify field strains and the vaccine strain CVI988. The amplification product of Meq, approximately 786 bp in length, was detected in six samples. This product was still detected in sample 2, along with the additional larger L-Meq product, as in CVI988. This indicated that the viruses from the seven samples all belonged to MDV serotype 1, which included the virulent strain and the vaccine strain.

Isolation of the MDV field strain

In this study, a total of 60 pooled feather follicle samples were collected from six chickens, except for sample 2, and were cultured on CEFs. MDV was isolated from sample 1. There were very small plaques on the CEFs after 7 days of culture in the first passage (Fig. 3A). We also found small plaques after 5 days of culture in the second passage (Fig. 3B). The infected cells were plaque-cloned, and the isolates were propagated in 6-well plates. The formation of bright and enlarged plaques, which is a typical cytopathogenic effect (CPE), was observed beginning at three days of the third passage (Fig. 3C-F). Four separate wells from the plaque-purified samples were collected for PCR detection of the Meq sequence. As demonstrated in Figure 4, Meq bands could be detected in 3 wells of CEFs infected with MDV, similar to what was observed for the Md5-positive control. There were two bands in well 2, which were similar to the band for CVI988. The resulting isolated virus was called JuRong 2023.

Phylogenetic and evolutionary analysis of MDV based on Meq

Based on the examination of the MDV genome by PCR and postmortem examinations, we amplified the

Meq gene from sample 1. The complete sequences of the Meq genes, approximately 1020 bp in length, were successfully amplified from the genome of feather pulp. A phylogenetic tree based on the Meq gene sequences of 24 MDVs, including 19 isolates from China, was constructed to analyse the evolutionary relationships between strains. The remaining 5 strains, except for CVI988 from the Netherlands, were all isolated from the USA. Among them, HNLC107, HNLC502, HNXZ105, HNGS101, HNGS101, HNGS206, HNLC202, HNLC401 HNLC203 and SD-2012 were able to bypass the protective effects of the CVI988 vaccine (Song et al., 2022). Phylogenetic analysis of Meq revealed that our MDV strain (JuRong 2023) was most closely related to SD-2012, which induced more than 50% mortality under vaccine protection (Fig. 5). This may partially explain why JuRong2023 bypassed the protective effects of the CVI988 vaccine.

Amino acid sequence analysis of virulent strains

To identify associated changes, we aligned the Meq amino acid sequences of the 14 strains with the CVI988 sequence. Among them, the American strains GA, RB1B and Md5 were standard virulent strains. The remaining were Chinese isolates that could evade the CVI988 vaccine. As shown in Table III, we detected a total of 9 amino acid site substitutions in JuRong 2023 compared with CVI988. The D to Y substitution at position 80, the V to A substitution at position 115, the P to R substitution at position 176, and the P to A substitution at position 217 were the most common substitutions among the 11 Chinese strains that have been reported to bypass the protective effects of the CVI988 vaccine.

Discussion

In recent decades, MD has essentially been controlled by vaccines. However, GaHV-2 strains have evolved continuously in terms of virulence and can overcome the immune responses induced by the currently available vaccines (Zhang et al., 2016). In recent years, outbreaks of MD have been frequently reported in many regions in China, such as Henan, Shandong, and Jiling (Zhang et al., 2016; Deng et al., 2021; Song et al., 2022). Usually, MD is detected at 4-6 weeks of age in broilers and 10-12 weeks of age in hens (Okwor and Eze, 2011). In general, young chickens infected with virulent MDV strains may have high mortality rates at 8–16 dpi (Stephens et al., 1980). In the present study, gross and histopathological examinations revealed lymphomatous lesions in visceral organs, such as the liver and spleen; these findings were

Table III. Amino acid substitutions of virulent MDV.

Isolate

Amino acid site

115

133

139

176

217

277

283

318

320

326

332

CVI988/Rispens

JuRong2023

SD-2012

Md5

RB1B

LMS

HNXZ105

HNGS101

HNGS206

HNLC107

HNLC202

HNLC203

HNLC401

HNLC502

·, means the amino acid type in this site was the same as the CVI988/ Rispens amino acid sequence. The most commonly found substitutions in China virulent strains are labeled in red.

mostly consistent with previously reported cases of MD (poultry diseases). Furthermore, molecular sequencing is one of the most reliable methods for classifying genotypes.

Latent infection is a prerequisite for lymphocyte transformation, and Meq plays an important role in this process. It has various functions, including functions in DNA binding, chromatin remodelling and transcriptional regulation (Jones et al., 1992). Animal experiments have indicated that the Meq-negative mutant MDV BAC does not induce the formation of tumours in chickens (Lupiani et al., 2004). Thus, Meq was used as a molecular marker for typing virus strains. The 132-bp tandem repeat region can be used as an important target gene to differentiate field strains from vaccine strains (Tian et al., 2011). In this study, we used Meq and 132-bp tandem repeat regions as target genes for detecting field strains in pathological materials collected from chicken flocks in JuRong. MDV was isolated from pooled feather follicles of chickens. Bright and enlarged cells were observed beginning five days after the second passage, and a clear CPE was observed at three passages; these findings are characteristic of MDV and were confirmed by PCR.

A phylogenetic tree based on the Meq amino acid sequences of the JuRong 2023 isolate and 23 MDV reference strains in the GenBank database was generated via the neighbour‒joining method. Bootstrap confidence limits for 1,000 replicates are indicated above each branch and are presented in Figure 5. It has been reported that four strains (LTS, HNGS101, 206, and HNXZ105) have mortality rates ranging from 30% to 50%, and six strains (HNLC202, 203, 401,502, and 107; SD-2012) have mortality rates greater than 50% (Yu et al., 2013). The same distribution of strains was observed in the analysis of the phylogenetic tree, which showed that the JuRong 2023 isolate and the SD-2012 isolate belong to the same group. Although the infected chickens in the flock from which the JuRong 2023 strain was isolated were euthanized, the mortality rate was unknown. It was speculated that JuRong 2023 is a virulent strain. This indicates that the transmission of virulent strains occurs across different regions in China. This may be partly responsible for the recent outbreaks in immunized chicken flocks in JuRong, Jiangsu Province. Overall, these findings indicate that the efficacy of the most frequently used CVI988 vaccine has started to decrease over the last 10 years in China.

The Meq sequence has been shown to correlate with GaHV-2 virulence and contains numerous repeat sequences of four prolines (PPPP repeats), which have been shown to have a strong negative association with viral oncogenicity and pathogenicity (Renz et al., 2012). It has been reported that positions 176 and 217 of the Meq protein harbour the second proline in proline-rich repeat regions, and mutations at these positions (PPPP to PNPP) may lead to increased virulence (Shamblin et al., 2004). As demonstrated in Table III, compared with the reference strain CVI988, the strain JuRong 2023 had mutations at positions 71 (S to A), 80 (D to Y), 115 (V to A), 176 (P to R), 217 (P to A) and 326 (I to T). According to a previous study, the changes at positions 71, 176 and 217 are positively related to increases in virulence (Shamblin et al., 2004). Mutations at positions 80 (D to Y) and 115 (V to A) were widely found in Chinese isolates (Tian et al., 2011). These mutations have been detected in several Chinese isolates and may be characteristic of GaHV-2 isolates in China (Yu et al., 2013). This evaluation showed that the mutations at positions 80, 115, 176, and 217 affect the function of the virus and are worthy of attention in China.

The detection of virulent MDV from the Jurong chicken farm further demonstrated that the Meq genes of GaHV-2 strains isolated from commercial flocks in China exhibit significant genetic diversity and are correlated with increased virulence. It seems that most of the virulent Chinese strains share a similar Meq amino acid sequence, although they differ from the non-Chinese strains and vaccine strains. For the control of MD in chicken flocks, constant surveillance of newly isolated field strains is necessary to reveal the characteristics of endemic Chinese MDVs to develop better vaccines and control programs. The field strain used to challenge MD-vaccinated birds to evaluate the immune protection efficacy of different MD vaccines, CVI988, HVT, CVI988+HVT, and 814, needs to be further studied.

Declarations

Funding

This work was supported by the Natural Science Fund Project of Jiangsu Vocational College of Agriculture and Forestry (Grant No. 2019kj007), the Natural Science Fund Project of Colleges in Jiangsu Province (Grant No. 20KJB230011), the Natural Science Foundation of China (Grant No. 32202799), the Jiangsu Province Blue Engineering Project, and the Natural Science Fund Project of Jiangsu Vocational College of Agriculture and Forestry (Grant No. 2020kj062).

IRB approval and consent to participate

This study was approved by the author’s institution (Nanjing Agricultural University ethics committee), and owner consent was obtained for the animals used for the postmortem examinations.

Availability of data and materials

Our findings are contained within the manuscript.

Consent for publication

Consent was obtained from the owner of the animal for publication of this case report.

Statement of conflict of interest

The authors have declared no conflict of interest.

References

Boodhoo, N., Gurung, A., Sharif, S. and Behboudi, S., 2016. Marek’s disease in chickens: A review with focus on immunology. Vet. Res., 47: 119. https://doi.org/10.1186/s13567-016-0404-3

Bulow, V.V. and Biggs, P.M., 1975. Differentiation between strains of Marek’s disease virus and turkey herpesvirus by immunofluorescence assays. Avian Pathol. J. WVPA, 4: 133-146. https://doi.org/10.1080/03079457509353859

Calnek, B.W., 1986. Marek’s disease a model for herpesvirus oncology. Crit. Rev. Microbiol., 12: 293-320. https://doi.org/10.3109/10408418509104432

Calnek, B.W., 2001. Pathogenesis of Marek’s disease virus infection. Curr. Topics Microbiol. Immunol., 255: 25-55. https://doi.org/10.1007/978-3-642-56863-3_2

Davidson, I. and Borenstein, R., 1999. Multiple infection of chickens and turkeys with avian oncogenic viruses: Prevalence and molecular analysis. Acta Virol., 43: 136-142.

Davison, F. and Nair, V., 2005. Use of Marek’s disease vaccines: Could they be driving the virus to increasing virulence? Expert Rev. Vaccines, 4: 77-88. https://doi.org/10.1586/14760584.4.1.77

Deng, Q., Shi, M., Li, Q., Wang, P., Li, M., Wang, W., Gao, Y., Li, H., Lin, L., Huang, T. and Wei, P., 2021. Analysis of the evolution and transmission dynamics of the field MDV in China during the years 1995-2020, indicating the emergence of a unique cluster with the molecular characteristics of vv+ MDV that has become endemic in southern China. Transbound. Emerg. Dis., 68: 3574-3587. https://doi.org/10.1111/tbed.13965

Gatherer, D., Depledge, D.P., Hartley, C.A., Szpara, M.L., Vaz, P.K., Benkő, M., Brandt, C.R., Bryant, N.A., Dastjerdi, A., Doszpoly, A., Gompels, U.A., Inoue, N, Jarosinski, K.W., Kaul, R., Lacoste, V., Norberg, P., Origgi, F.C., Orton, R.J,, Pellett, P.E., Schmid, D.S,, Spatz, S.J., Stewart, JP., Trimpert, J., Waltzek, T.B. and Davison, A.J. 2021. ICTV virus taxonomy profile: Herpesviridae 2021. J. Gen. Virol., 102. https://doi.org/10.1099/jgv.0.001673

Grewal, G., Singh, B. and Singh, H., 1977. Epidemiology of Marek’s disease: Incidence of viral specific antigen in feather follicle epithelium of domestic fowl of Punjab. Indian J. Poult. Sci., 12: 1-5.

Jones, D., Lee, L., Liu, J.L., Kung, H.J. and Tillotson, J.K., 1992. Marek disease virus encodes a basic-leucine zipper gene resembling the fos/jun oncogenes that is highly expressed in lymphoblastoid tumors. Proc. natl. Acad. Sci. USA, 89: 4042-4046. https://doi.org/10.1073/pnas.89.9.4042

Kenzy, S., McLean, G., Mathey, W. and Lee, H., 1964. Preliminary observations of gamefowl neurolymphomatosis. J. Nat. Cancer Inst., 17: 121-130.

Kobayashi, S., Kobayashi, K. and Mikami, T., 1986. A study of Marek’s disease in Japanese quails vaccinated with herpesvirus of turkeys. Avian Dis., 30: 816-819. https://doi.org/10.2307/1590591

Lesnik, F., Pauer, T., Vrtiak, O.J., Danihel, M., Gdovinova, A. and Gergely, M., 1981. Transmission of Marek’s disease to wild feathered game. Vet. Med., 26: 623-630.

Liu, J.L., Teng, M., Zheng, L.P., Zhu, F.X., Ma, S.X., Li, L.Y., Zhang, Z.H., Chai, S.J., Yao, Y. and Luo, J., 2023. Emerging hypervirulent marek’s disease virus variants significantly overcome protection conferred by commercial vaccines. Viruses, 15. https://doi.org/10.3390/v15071434

Lupiani, B., Lee, L.F., Cui, X., Gimeno, I., Anderson, A., Morgan, R.W., Silva, R.F., Witter, R.L., Kung, H.J. and Reddy, S.M., 2004. Marek’s disease virus-encoded Meq gene is involved in transformation of lymphocytes but is dispensable for replication. Proc. natl. Acad. Sci. USA, 101: 11815-11820. https://doi.org/10.1073/pnas.0404508101

Okwor, E. and Eze, D., 2011. Outbreak and persistence of marek’s disease in batches of birds reared in a poultry farm located in Nsukka, South East Nigeria. Int. J. Poult. Sci., 10: 617-620. https://doi.org/10.3923/ijps.2011.617.620

Read, A.F., Baigent, S.J., Powers, C., Kgosana, L.B., Blackwell, L., Smith, L.P., Kennedy, D.A., Walkden-Brown, S.W. and Nair, V.K., 2015. Imperfect vaccination can enhance the transmission of highly virulent pathogens. PLoS Biol., 13: e1002198. https://doi.org/10.1371/journal.pbio.1002198

Renz, K.G., Cooke, J., Clarke, N., Cheetham, B.F., Hussain, Z., Fakhrul, I.A.F., Tannock, G.A. and Walkden-Brown, S.W., 2012. Pathotyping of Australian isolates of Marek’s disease virus and association of pathogenicity with meq gene polymorphism. Avian Pathol. J. WVPA, 41: 161-176. https://doi.org/10.1080/03079457.2012.656077

Shamblin, C.E., Greene, N., Arumugaswami, V., Dienglewicz, R.L. and Parcells, M.S., 2004.Comparative analysis of Marek’s disease virus (MDV) glycoprotein-, lytic antigen pp38- and transformation antigen Meq-encoding genes: Association of meq mutations with MDVs of high virulence. Vet. Microbiol., 102: 147-167. https://doi.org/10.1016/j.vetmic.2004.06.007

Song, B., Zeb, J., Hussain, S., Aziz, M.U., Circella, E., Casalino, G., Camarda, A., Yang, G., Buchon, N. and Sparagano, O., 2022. A review on the marek’s disease outbreak and its virulence-related meq genovariation in Asia between 2011 and 2021. Anim. Open Access J. MDPI, 12. https://doi.org/10.3390/ani12050540

Stephens, E.A., Witter, R.L., Nazerian, K. and Sharma, J.M., 1980. Development and characterization of a Marek’s disease transplantable tumor in inbred line 72 chickens homozygous at the major (B) histocompatibility locus. Avian Dis., 24: 358-374. https://doi.org/10.2307/1589703

Tian, M., Zhao, Y., Lin, Y., Zou, N., Liu, C., Liu, P., Cao, S., Wen, X. and Huang, Y., 2011. Comparative analysis of oncogenic genes revealed unique evolutionary features of field Marek’s disease virus prevalent in recent years in China. Virol. J., 8: 121. https://doi.org/10.1186/1743-422X-8-121

Weiss, R.A. and Biggs, P.M., 1972. Leukosis and marek’s disease viruses of feral red jungle flow and domestic fowl in Malaya. J. natl. Cancer Inst., 49: 1713-1725. https://doi.org/10.1093/jnci/49.6.1713

Witter, R.L., Calnek, B.W., Buscaglia, C., Gimeno, I.M. and Schat, K.A., 2005. Classification of Marek’s disease viruses according to pathotype: Philosophy and methodology. Avian Pathol. J. WVPA, 34: 75-90. https://doi.org/10.1080/03079450500059255

Witter, R.L., 1997. Increased virulence of Marek’s disease virus field isolates. Avian Dis., 41: 149-163. https://doi.org/10.2307/1592455

Yu, Z.H., Teng, M., Luo, J., Wang, X.W., Ding, K., Yu, L.L., Su, J.W., Chi, J.Q., Zhao, P., Hu, B., Zhang, G.P. and Liu, J.X., 2013. Molecular characteristics and evolutionary analysis of field Marek’s disease virus prevalent in vaccinated chicken flocks in recent years in China. Virus Genes, 47: 282-291. https://doi.org/10.1007/s11262-013-0942-y

Yu, Z.H., Zhang, Y.P., Lan, X.G., Wang, Y.N., Guo, R.R., Li, K., Gao, L., Qi, X.L., Cui, H.Y., Wang, X.M., Gao, Y.L. and Liu, C.J., 2023. Differences in pathogenicity and vaccine resistance discovered between two epidemic strains of Marek’s disease virus in China. Viruses, 15. https://doi.org/10.3390/v15040945

Zhang, Y.P., Lv, H.C., Bao, K.Y, Gao, Y.L., Gao, H.L., le, Qi. X., Cui, H.Y., Wang, Y.Q., Li, K., Gao, L., Wang, X.M. and Liu, C.J., 2016. Molecular and pathogenicity characterization of Gallid herpesvirus 2 newly isolated in China from 2009 to 2013. Virus Genes, 52: 51-60. https://doi.org/10.1007/s11262-015-1264-z

Zheng, L.P., Teng, M., Li, G.X., Zhang, W.K., Wang, W.D., Liu, J.L., Li, L.Y., Yao, Y., Nair, V. and Luo, J., 2022. Current epidemiology and co-infections of avian immunosuppressive and neoplastic diseases in chicken flocks in central China. Viruses, 14. https://doi.org/10.3390/v14122599