Molecular Epidemiology of Enteric Pathogens Associated with Diarrheal Disease in Goat Kids

Maria Azmat, Jawaria Ali Khan*, Muhammad Ijaz, Kamran Ashraf and Omer Naseer

Department of Clinical Medicine, University of Veterinary and Animal Sciences, Lahore, Pakistan

ABSTRACT

Neonatal diarrhea is one of the leading cause of mortalities in goats leading to economic losses. The current research was conducted to study the prevalence of Salmonella and Escherichia coli in diarrheic goat kids. Fecal samples of 200 diarrheic goats up to two months of age were collected from different government and private sector veterinary hospitals, livestock farms and small households in and around district Bahawalpur between year 2021 and 2022 on seasonal basis. Microbiological samples underwent processing to isolate E. coli and Salmonella, and the identification of these isolates was achieved through a combination of cultural, morphological, and biochemical characteristics, complemented by molecular characterization. PCR results showed amplification of 521 bp segment of the invA gene and 314bp of K99 gene in Salmonella and E. coli, respectively. The results revealed that bacterial prevalence was 43.5%, among which E. coli prevalence was 23.5% and Salmonella prevalence was 17.5%. Moreover, in male goat kids, both Salmonella and E. coli infection rate was higher (65.71% and 31.25% respectively) as compared to females (7.27% and 13.64% respectively). Concerning the local breeds, Desi breed has the highest prevalence of Salmonella (21.21%) and E. coli (29.41%). Seasonal variations were found to be statistically significant in Salmonella with high prevalence in winter (41.18%) but non- significant in E. coli with high prevalence in Autumn (29.41%). Furthermore, varying factors impact infection rates such as, age, weather conditions, management practices and hygiene measures.


Article Information

Received 05 October 2023

Revised 08 March 2024

Accepted 26 March 2024

Available online 29 May 2024

(early access)

Published 01 July 2025

Authors’ Contribution

MA and JAK conceptualized the study. MA collected the samples and analyzed them. MI, KA and ON validate the data and helped in investigation. MA and JAK drafted the manuscript. MI, ON and KA reviewed and improved the manuscript.

Key words

Neonatal goats, Diarrhea, Salmonella, E. coli, Prevalence, PCR

DOI: https://dx.doi.org/10.17582/journal.pjz/20231005073531

* Corresponding author: [email protected]

0030-9923/2025/0004-1855 $ 9.00/00

Copyright 2025 by the authors. Licensee Zoological Society of Pakistan.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).



INTRODUCTION

Diarrhea represents the primary cause of both high morbidity and mortality among young animals, resulting in substantial economic losses in the global livestock industry (Yadegari et al., 2019; Shrivastava et al., 2022). Diarrhea leads to deficit of health and drop in production potential of animals (Koirala and Bhandari, 2019). According to the National Animal Health Monitoring System, approximately 57% of calf deaths at the weaning stage can be attributed to diarrhea (Cho and Yoon, 2014). Small ruminants play a vital role in the agricultural systems of developing countries, both economically and ecologically (Devendra, 2005). The mortality rate for lambs typically falls within the range of 10 to 25%, while estimates for goat kid mortality range from 11.5 to 37% (Thiruvenkadan and Karunanithi, 2007).

The causes of diarrhea in sheep and goats encompass both non-infectious and infectious factors (Abdou et al., 2021). Among bacterial pathogens, enterotoxigenic E. coli (ETEC) and Salmonella hold significant economic importance (Achá et al., 2004). Although the presumed cause is typically attributed to specific bacteria like E. coli, investigations into diarrhea among both young kids and adult goats have consistently been unable to identify specific causes in the majority of instances (Gavin et al., 2018). In both cattle and dairy goats, research has demonstrated variations in the expression patterns of different virulence genes in E. coli, depending on the host’s age, season and geographic location (Dwell et al., 2008; Fernández et al., 2009). E. coli typically induces watery diarrhea and weakness in newborn calves aged 1–4 days. Usually, death often ensues within 24 h as a result of severe dehydration (Cho et al., 2010). Additionally, stress has been identified as a factor that can lead to an elevated prevalence of specific virulent strains (Bach et al., 2004; Ndegwa et al., 2020). Salmonella infection stands as a prevalent cause of diarrheal illness in both sheep and goat flocks (Shabana et al., 2017). The extent of Salmonella infection’s impact varies, contingent on bacterial factors such as serovar, virulence, and antimicrobial susceptibility. It’s worth noting that the global count of identified Salmonella serovars exceeds 2600, with new serovars emerging annually (Jajere, 2019).

Understanding the epidemiology, prevalence, and virulence factors of these pathogens in specific regions is crucial for effective disease management and prevention strategies. The current research was conducted to study the prevalence of E. coli and Salmonella in diarrheic goats in Bahawalpur, Pakistan (Fig. 1).

MATERIALS AND METHODS

A total of 200 goats suffering from clinical signs of diarrhea (irrespective of breed and sex) up to two months of age were included in this study. The fecal samples were collected directly from the diarrheic goats and the data was recorded using a pre-tested form termed as Data Capture form (DCF). The parameters in DCF included age, breed, sex, duration of diarrhea, fecal scoring, season, stagnant water, colostrum feeding, environmental condition, and body condition.

Each animal’s rectum was used to collect approximately 5 g of feces. DNA from colonies of positive samples were extracted using bacterial DNA extraction kit (WizPrepTM gDNA cell/tissue kit, Korea) and confirmed through PCR (Haq et al., 2017) by using new primers.

Isolation and purification of E. coli and Salmonella

Bacterial pathogens like E. coli and Salmonella were identified and isolated by culturing (Kar et al., 2017; Haq et al., 2017). The samples were mixed with 5mL phosphate buffer saline solution in test tubes, followed by inoculation on Nutrient Agar were further streaked on MaCconkey agar and EMB agar and incubated further at 37℃ aerobically for 24 h. Only pink colonies from MaCconkey agar, and green metallic sheen colonies from EMB agar were chosen for E. coli. These colonies were further purified by multiple streaking methods on the MacConkey agar and EMB agar and further processed for identification and confirmation of E. coli.

For isolation and purification of Salmonella, bacterial cultures were streaked on to nutrient agar, yielding translucent circular Salmonella colonies after 24 h and then streaked onto Salmonella-shigella agar (SSA), incubated at 37°C for 24 h, and processed to purify the bacteria by multiple streaking method.

Pure colonies were proceeded for identification of E. coli by observing macroscopic, microscopic and biochemical characters. It was followed by motility test using hanging drop method (Cheesbrough, 2009).

The isolates that were Gram negative after the gram staining were then subjected for the biochemical tests which include different tests, MR test, VP test, indole test, catalase test, oxidase test, citrate utilization test and urease test and H2S production tests (Reiner, 2010; Koneman, 2016).

Molecular diagnosis of bacteria

For molecular diagnosis of bacteria positive fecal samples were processed for detection of E. coli and Salmonella DNA, using primer sequence specific for inaA gene and F5 gene (Tables I and II).

 

Table I. Primer sets used for characterization of E. coli and Salmonella.

Gene

Primer sequence

5’ →3’

Length of PCR product (bp)

invA

F TTGTTACGGCTATTTTGACCA

521

R CTGACTGCTACCTTGCTGATG

F5

F TATTATCTTAGGTGGTATGG

314

R GGTATCCTTTAGCAGCAGTATTTC

 

Table II. Biochemical characteristics of Salmonella and E. coli.

Biochemical test

Salmonella

E. coli

Gram staining

Negative

Negative

Motility

Positive

Positive

Catalase test

Positive

Positive

Oxidase test

Negative

Negative

Indole test

Negative

Positive

Methyl red test

Positive

Positive

Citrate utilization test

Positive

Negative

VogesProskauer test

Negative

Negative

 

For genomic DNA extraction of Gram-negative bacteria fresh culture of isolates was taken from MaCconkey agar plates and transferred into micro centrifuge tube (1.5ml) containing normal saline from fecal samples using genomic DNA extraction Kit (GeneAll®, Exgene™ Catalogue No. 105-101).

PCR recipe was arranged in an absolute volume of 20μl containing of 10μl of TOPreal™ qPCR 2x PreMIX, 2μl of DNA sample and 1μmol of separately primer. Reaction was cycled 35 times afterwards first denaturation at 95°C for 5 min with denaturation at 95°C, annealing at 60°C and extension phase at 72°C, each phase was given 45 seconds, last elongation at 72°C for 10 min was done. A negative control was involved in each PCR run. The PCR yields were detected on agarose gel (2%)for positive bands against a 100bp molecular ladder. Amplified products were visualized using UV Transilluminator.

Statistical analysis

The data were statistically analyzed using SPSS 25.0 version. Analysis of variance (ANOVA) was used in case of more than two variables within group while Student’s t-test was employed for the two groups.

RESULTS

Prevalance of E. coli and Salmonella in diarrhoeic goats

Out of 200 samples 47 goats were positive for E. coli and 35 goats were positive for Salmonella infection after initial identification on basis of microscopic examination and biochemical profile. The PCR analysis confirmed the presence of Salmonella by 521bp amplified band of invA gene and E. coli by amplified band of K99 gene.

The results revealed that bacterial prevalence was 43.5% (97/200). Among which E. coli prevalence was 23.5% and Salmonella prevalence was 17.5% in Bahawalpur district, Punjab, Pakistan.

Age

The goats were examined across three age groups: G1 (0-15 days), G2 (16-30 days), and G3 (>30 days). Among these groups, 18.60% goats in G1, 22.22% goats G2, and 13.83% goats in G3 were tested positive for Salmonella (Table III). The statistical analysis indicated that age was a significant factor (P>0.05) in relation to Salmonella infection. In case of E. coli infection, maximum positive cases were recorded in G1 (34.88%) while in G2 and G3 the positive cases were 20.63% and 20.21%, respectively (Table III). In the present study, age factor was significant (P<0.05): Salmonella infection was found to be most infected G2 while G1 was found to be most infected age group with E. coli.

Breed

The results showed that Desi breed has the maximum rate (21.21%) of infection followed by Beetal (19.35%), Teddy (17.78) and Rajanpuri breeds (13.33) (Table III). The results were non-significant (P>0.05) for Salmonella infection causing diarrhea.

In case of E. coli, the results showed that Desi breed showed maximum (29.41%) positive cases followed by Teddy (26.09%) and Beetal (24.59%). The Rajanpuri breed had the least infected cases in terms of percentage (16.95%). The variations on the basis of breed were found to be significant (p<0.05). In both cases, Desi breed was most infected.

Gender/Sex

Regarding sex, male goats showed more prevalence in both infections: Salmonella 65.71% and E. coli 31.25% (Table III). Infections in female were 7.27% in the case of Salmonella while 13.64% in the case of E. coli. The results were significant (P<0.05) in both infections.

 

Table III. Prevalence of Salmonella and Escherichia coli infection in diarrheic goats kids.

Parameters

Salmonella

E. coli

Positive/ total (%)

P value

Positive

P value

Age

0-15 days

8/43 (18.60 %)

0.038

15/43 (34.88 %)

0.013

16-30days

14/63 (22.22%)

13/63 (20.63 %)

>30days

13/63 (13.83%)

19/94 (20.21 %)

Breed

Teddy

8/45 (17.78 %)

0.756

12/46 (26.09 %)

0.001

Beetal

12/62 (19.35%)

15/61 (24.59 %)

Rajanpuri

8/60 (13.33 %)

10/59 (16.95 %)

Desi

7/33 (21.21 %)

10/34 (29.41 %)

Sex

Male

23/35 (65.71%)

0.001

35/112 (31.25%)

0.004

Female

12/165 (7.27%)

12/88 (13.64 %)

Season

Winter

7/17 (41.18 %)

0.073

12/46 (26.09 %)

0.001

Spring

6/46 (13.04 %)

10/59 (16.95 %)

Summer

13/68 (19.12%)

15/61 (24.59 %)

Autum

9/69 (13.04 %)

10/34 (29.41 %)

Colostrum feeding

Yes

26/128(20.3%)

0.016

19/102 (18.63%)

0.097

No

9/72(12.50 %)

28/98 (28.57 %)

Duration of diarrhea

1 Day

8/57 (14.04 %)

0.066

22/84 (26.19 %)

0.063

2 Day

13/64 (20.31%)

14/71 (19.72 %)

3 or >3 days

14/79 (17.72%)

11/45 (24.44 %)

Body condition

Fatty

4/51 (7.84 %)

0.579

8/43 (18.60 %)

0.027

Emaciated

20/82 (24.39%)

30/94 (31.91%)

Good

11/67 (16.42%)

9/63 (14.29 %)

Environmental condition

Good

8/57 (14.04 %)

0.069

9/71 (12.68 %)

0.037

Fair

11/61 (18.03%)

22/47 (46.81%)

Poor

16/82 (19.51%)

16/82 (19.51%)

Stagnant water

Yes

23/118 (19.4%)

0.037

34/108 (31.48%)

0.004

No

12/82 (14.63%)

13/91 (14.13 %)

Fecal scoring

1 (Normal feces)

4/21 (19.05%)

0.047

4/18 (22.22 %)

0.003

2 (Semi solid feces)

12/73 (16.44%)

10/46 (21.74%)

3(Dysentery)

6/49 (12.24 %)

3/35 (8.57 %)

4(Very liquid)

8/36 (22.22 %)

19/58 (32.76%)

5 (Watery)

5/21 (23.81 %)

11/43 (25.58%)

 

 

Seasonal analysis

The seasonal analysis revealed that Salmonella infection was highest (41.18%) during winter season followed by summer (19.12%). The percentage of infection was same in spring and autumn (13.04%). The seasonal variations were found to be non-significant (p<0.05).

The prevalence of E. coli infection was highest in Autumn (29.41%) followed by winter (26.09%) and summer (24.59%). The infection rate was minimum in spring (16.95%) (Table III). The seasonal variations were found to be significant statistically (p<0.05).

Colostrum feeding

A total of 128 goats were given colostrum’s feeding among which 26 (20.31%) showed Salmonella cases (Table III). The results were found to be significant (P<0.05).

In the case of E. coli, 102 goats were given colostrum feeding among which 19 (18.63%) showed infection (Table III). Overall, the results were non-significant (P>0.05).

Diarrhea Duration

In the context of diarrhea duration among goats, the data indicated that goats with a one-day duration of diarrhea had a lower Salmonella (14.04%) rate while higher (26.19%) E. coli infection, whereas those with a two-day duration showed a higher rate of infection in Salmonella (20.31%) and lower rate in E. coli (19.72%) infection as compared to one-day duration. Furthermore, goats experiencing diarrhea for three or more days exhibited an infection rate of 17.72% in Salmonella and 24.44% in case of E. coli (Table III). The study revealed that there were no statistically significant associations between diarrhea duration and Salmonella infection (p>0.05) as well as between E. coli infection and diarrhea duration (p<0.05).

Body condition

Regarding body conditions, the results stated that emaciated goats showed maximum (24.39%) positive cases while good healthy goats showed 11% positive cases of Salmonella followed by lowest infection rate in fatty goats 7.84% (Table III). The results were non-significant (P>0.05). In case of E. coli infection, emaciated goats had maximum (31.91%) prevalence followed by fatty condition (18.60%) and healthy goats in good condition (14.29%) (Table III). The results were statistically significant (P<0.05). In both infections, emaciated condition had maximum prevalence.

Environmental condition

Regarding environmental condition, the data revealed that good environmental condition showed 14.04% Salmonella infection, fair environmental condition showed 18.03% positive cases while poor condition showed 19.51% infection (Table III). In this study, the results were non-significant (P>0.05). In the case of E. coli, the results revealed that fair environmental condition showed maximum (46.81%) positive cases of infection (Table III) followed by poor (19.51%) and good environmental condition (12.68%). The results were statistically significant (P<0.05).

Stagnant water

The presence of stagnant water showed 19.49% positive cases of Salmonella as compared to its absence (14.63%) (Table III). E. coli infection was also more prevalent (31.48%) in the presence of stagnant water as compared to its absence (14.13%) (Table III). The findings were significant (P<0.05) in both cases of infections.

Fecal scoring

The maximum cases (23.81%) of infection were recorded in watery feces (score 5) followed by liquid feces (score 4) and normal feces (score 1) with 22.22 and 19.05% respectively. Infection rate in semi solid feces (score 2) was 16.44%. Least number of cases for positive infection were recorded in score 3 (dysentery) with 12.24% infection rate (Table III). In case of E. coli infection, maximum positive cases were recorded in fecal score 4 (32.76%) followed by score 5 (25.58%) and score 1 (22.22%) (Table III). The results were found to be significant (P<0.05) in both infections.

DISCUSSION

Neonatal diarrhea is one of the leading causes of calf death in animal industry (Urie et al. 2018). Diarrhea and health issues in young goats pose significant challenges to the well-being of these animals, impacting the overall profitability of the goat industry (Cheng et al., 2021). It is essential to gain a deeper insight into potential biomarkers that can serve as indicators for mortality and morbidity in neonatal goats suffering from diarrhea (Dwyer et al., 2015). The current study revealed that bacterial prevalence was 43.5% in goat kids.

E. coli stands as the primary and most influential factor responsible for neonatal diarrhea in ruminants (Brunauer et al., 2021). The E. coli prevalence in this study was much lower (23.5%) than prevalence reported by previous studies in diarrheic goats; such as, 57.8% (Shabana and Enazi, 2020), 48.7% (Abd El-Tawab et al., 2020), 31.7% (Kiziltepe and Ayvazoğlu, 2022) and 27.3% (Osman et al., 2013). Mishra et al. (2018) identified 193 isolates out of 300 (64.3%). The differences in E. coli prevalence may be linked to variations in geographic distribution, calf age, weather conditions, management practices, and hygiene measures (Alam et al., 2009; Vanselow et al., 2017; Abd El-Tawab et al., 2020).

The Salmonella prevalence was 17.5% in the current study which was lower than E. coli infection. Lower rate (7%) of Salmonella infection in goats was also reported by Hawwas et al. (2022), 3.86% by Farouk et al. (2021) and 3.49% by Abd El-Twab et al. (2016). Another study reported 75.6% E. coli and 18.1% Salmonella infection in diarrheic calves (El-Seedy et al., 2016). Diagnosing salmonellosis in sheep and goats poses challenges because the clinical symptoms are not specific (OIE, 2000). Contaminated water can be considered as one of the leading causes of Salmonella infection in goat kids (Ghimire and Bhattarai, 2019).

Young goats are vulnerable to diarrhea during the initial week of their lives (Caffarena et al., 2021). In case of Salmonella infection G2 was found to be most infected. The results were in accordance with Grünberg (2020) and Duffy et al. (2010). In case of E. coli G1 was most infected age group. Moreover, the Salmonella isolation rate was highest (13.5%) between one and two years of age (Hawwas et al., 2022). E. coli K99 was found to be most common factor of diarrhea in kids in Kuwait (Majeed et al., 2018; Abdou et al., 2021) and Saudi Arabia (Shabana et al., 2017).

Male goats showed more prevalence in both infections, Salmonella (65.71%) and E. coli (31.25%). In Ethiopia, a hundred percent higher isolation rate of Salmonella was recorded in males as compared to females (0%). Saha et al. (2014) also reported higher (15.78%) prevalence in male goats as compared to females (10.71%).

The seasonal analysis revealed that Salmonella infection was highest (41.18%) during winter season followed by summer (19.12%). The percentage of infection was same in spring and autumn (13.04%). In case of E. coli infection, the prevalence was highest in Autumn (29.41%) followed by winter (26.09%) and summer (24.59%). Abdou et al. (2021) recorded more cases of E. coli diarrhea in dry season as compared to wet season.

Conclusions

Neonatal diarrhea poses a significant threat to goat mortality, leading to economic losses. A year-long research project examined Salmonella and Escherichia coli prevalence in diarrheic goat kids. Fecal samples from 200 goats under two months old were collected from various sources in the Bahawalpur district. Microbiological analysis identified bacterial presence, with higher rates in male goat kids compared to females. Local Desi breed goats had the highest prevalence. Seasonal variations were significant for Salmonella, favoring winter, while E. coli showed no significant seasonal variation.

Declarations

Funding

The study was not funded by any organization.

IRB approval

The study was approved by the IRB of University of Veterinary and Animal Sciences, No/624/DVM, dated: (16/02/2022).

Statement of conflict of interest

The authors have declared no conflict of interest.

References

Abd El-Twab, A.A., El-Hofy, I.F. and Amira, M.R., 2016. Molecular characterization of Quinolones and β-lactams resistant Salmonella Serovars determinants in diarrheic calves, lambs and goats-kids in the Middle of Nile Delta, Egypt. Benha Vet. med. J., 30: 171-182. https://doi.org/10.21608/bvmj.2016.31361

Abd El-Tawab, A.A., Maarouf, A.A., El-Hofy-Fatma, I. and Nesma, M.G.A., 2020. Phenotypic characterization of some food poisoning bacteria isolated from meat and meat products in Kaliobia, Egypt. Benha Vet. med. J., 38: 146-151. https://doi.org/10.21608/bvmj.2020.25678.1186

Abdou, N.E., Majeed, Q.A.H., El-Azazy, O.M.E., Tahrani, L.M.A., AlAzemi, M.S. and Alajmi, A., 2021. Risk factors of diarrhea in small ruminants in Kuwait. Iran. J. Vet. Res.22: 146.

Achá, S.J., Kuhn, I., Jonsson, P., Mbazima, G., Katouli, M. and Mollby, R.S., 2004. Studies on calf diarrhoea in Mozambique: Prevalence of bacterial pathogens. Acta Vet. Scand., 45: 27–36. https://doi.org/10.1186/1751-0147-45-27

Acha, S.J., Kühn, I., Jonsson, P., Mbazima, G., Katouli, M. and Möllby, R., 2004. Studies on calf diarrhoea in Mozambique: prevalence of bacterial pathogens. Acta Vet. Scand.45: 1-10. https://doi.org/10.1186/1751-0147-45-27

Alam, M.J., Renter, D.G., Ives, S.E., Thomson, U.D., Sanderson, W.M., Hollis, C.L. and Nagaraja, G.T., 2009. Potential associations between fecal shedding of Salmonella in feedlot cattle treated for apparent respiratory disease and subsequent adverse health outcomes. J. Vet. Res., 40: 1-13. https://doi.org/10.1051/vetres:2008040

Bach, S.J., McAllister, T.A., Mears, G.J. and Schwartzkopf-Genswein, K.S., 2004. Long-haul transport and lack of preconditioning increases fecal shedding of Escherichia coli and Escherichia coli O157: H7 by calves. J. Fd. Prot., 67: 672–678. https://doi.org/10.4315/0362-028X-67.4.672

Brunauer, M., Roch, F.F. and Conrady, B., 2021. Prevalence of worldwide neonatal calf diarrhoea caused by bovine rotavirus in combination with bovine coronavirus, Escherichia coli K99 and Cryptosporidium spp.: A meta-analysis. Animals, 11: 1014. https://doi.org/10.3390/ani11041014

Caffarena, R.D., Casaux, M.L., Schild, C.O., Fraga, M., Castells, M., Colina, R., Maya, L., Corbellini, L.G., Riet-Correa, F. and Giannitti, F., 2021. Causes of neonatal calf diarrhea and mortality in pasture-based dairy herds in Uruguay: A farm-matched case-control study. Braz. J. Microbiol., 52: 977-988. https://doi.org/10.1007/s42770-021-00440-3

Cheng, Y., Yang, C., Tan, Z. and He, Z., 2021. Changes of intestinal oxidative stress, inflammation, and gene expression in neonatal diarrhoea kids. Front. Vet. Sci.8: 598691. https://doi.org/10.3389/fvets.2021.598691

Cheesbrough, M., 2009. District laboratory practice in tropical countries. 2nd ed. Cambridge University Press, Cambridge, UK. 62-70: 178-180.

Cho, Y., Kim, W., Liu, S., Kinyon, J.M. and Yoon, K.J., 2010. Development of a panel of multiplex real-time polymerase chain reaction assays for simultaneous detection of major agents causing calf diarrhea in feces. J. Vet. Diagn. Invest., 22: 509–517. https://doi.org/10.1177/104063871002200403

Cho, Y.I. and Yoon, J., 2014. An overview of calf diarrhea infectious etiology, diagnosis, and intervention. J. Vet. Sci., 15: 1–17. https://doi.org/10.4142/jvs.2014.15.1.1

Devendra C., 2005. Small ruminants in Asia; contribution to food security, poverty alleviation and opportunities for productivity enhancement. In: Proceeding of international workshop on small ruminant production and development in South East Asia. MEKARN, Nong Lam, HCMC, Vietnam, 19-32.

Dewell, G.A., Simpson, C.A., Dewell, R.D., Hyatt, D.R., Belk, K.E., Scanga, J.A., Morley, P.S., Grandin, T., Smith, G.C., Dargatz, D.A. and Wagner, B.A., 2008. Impact of transportation and lairage on hide contamination with Escherichia coli O157 in finished beef cattle. J. Fd. Prot., 71: 1114–1118. https://doi.org/10.4315/0362-028X-71.6.1114

Duffy, L.L., Small, A. and Fegan, N., 2010. Concentration and prevalence of Escherichia coli O157 and Salmonella serotypes in sheep during slaughter at two Australian abattoirs. Aust. Vet. J., 88: 399–404. https://doi.org/10.1111/j.1751-0813.2010.00623.x

Dwyer, C.M., Conington, J., Corbiere, F., Holmøy, I.H., Muri, K., Nowak, R., Rooke, J., Vipond, J. and Gautier, J.M., 2016. Invited review: Improving neonatal survival in small ruminants: Science into practice. Animal, 10: 449-459. https://doi.org/10.1017/S1751731115001974

El-Seedy, F.R., Abed, A.H., Yanni, H.A. and Abd El-Rahman, S.A.A., 2016. Prevalence of Salmonella and E. coli in neonatal diarrheic calves. Beni-Suef Univ. J. Basic appl. Sci., 5: 45-51. https://doi.org/10.1016/j.bjbas.2015.11.010

Farouk, M.M., El-Molla, A., Salib, F.A. and Soliman, Y.A., 2021. Epidemiology of Salmonella species in diarrheic sheep and goats. Pakistan J Zool., 54: 1-9. https://doi.org/10.17582/journal.pjz/20201012161016

Fernández, D., Rodriguez, E.M., Arroyo, G.H., Padola, N.L. and Parma, A.E., 2009. Seasonal variation of Shiga toxin-encoding genes (stx) and detection of E. coli O157 in dairy cattle from Argentina. J. appl. Microbiol., 106: 1260–1267. https://doi.org/10.1111/j.1365-2672.2008.04088.x

Gavin, W.G., Porter, C.A., Hawkins, N., Schofield, M.J. and Pollock, J.M., 2018. Johne’s disease: A successful eradication programme in a dairy goat herd. Vet. Rec., 182: 483-483. https://doi.org/10.1136/vr.104507

Grünberg, W., 2020. Salmonellosis in animals. The Merck veterinary manual.

Ghimire, T.R. and Bhattarai, N., 2019. A survey of gastrointestinal parasites of goats in a goat market in Kathmandu, Nepal. Journal of parasitic diseases: Official organ of the Indian Society. Parasitology, 43: 686–695. https://doi.org/10.1007/s12639-019-01148-w

Haq, I., Durrani, A.Z., Khan, M.S., Mushtaq, M.H. and Ahmad, I., 2017. A study on causes of pathogenic diarrhea in foals in Punjab, Pakistan. J. Equine Vet. Sci., 56: 88-92. https://doi.org/10.1016/j.jevs.2017.05.010

Hawwas, H.A.E.H., Aboueisha, A.K.M., Fadel, H.M. and El-Mahallawy, H.S., 2022. Salmonella serovars in sheep and goats and their probable zoonotic potential to humans in Suez Canal Area, Egypt. Acta Vet. Scand., 64: 17. https://doi.org/10.1186/s13028-022-00637-y

Jajere, S.M., 2019. A review of Salmonella enterica with particular focus on the pathogenicity and virulence factors, host specificity and antimicrobial resistance including multidrug resistance. Vet. World, 12: 504–521. https://doi.org/10.14202/vetworld.2019.504-521

Kar, J., Barman, T.R., Sen, A. and Nath, S.K., 2017. Isolation and identification of Escherichia coli and Salmonella sp. from apparently healthy Turkey. Int. J. Adv. Res. Biol. Sci., 4: 72-78.

Kiziltepe, Ş. and Ayvazoğlu, C., 2022. Iğdır Yöresindeki Neonatal Kuzularda İshal Etkenlerinin Araştırılması. ISPEC J. agric. Sci., 6: 189-194. https://doi.org/10.46291/ISPECJASvol6iss1pp189-194

Koirala, A. and Bhandari, P., 2019. Seroprevalence of paratuberculosis in goat of Lumbini zone, Nepal. Nepal J. agric. Sci., 18: 115-121.

Koneman, E.W., 2016. Color atlas and textbook of diagnostic microbiology. J.B. Lippincott Company, Philadelphia, PA.

Majeed, Q.A., El-Azazy, O.M., Abdou, N.E.M., Al-Aal, Z.A., El-Kabbany, A.I., Tahrani, L.M., AlAzemi, M.S., Wang, Y., Feng, Y. and Xiao, L., 2018. Epidemiological observations on cryptosporidiosis and molecular characterization of Cryptosporidium spp. in sheep and goats in Kuwait. Parasitol. Res., 117: 1631–1636. https://doi.org/10.1007/s00436-018-5847-1

Mishra, A.K., Singh, D.D., Gururaj, K., Kumar, A., Dixit, A., Shrama, N., Gupta, G. and Yadav, S., 2019. Molecular characterization of diarrhoegenic Escherichia coli isolated from neonatal goat-kids. J. Anim. Res., 9: 51-59. https://doi.org/10.30954/2277-940X.01.2019.7

Ndegwa, E., Alahmde, A., Kim, C., Kaseloo, P. and O’Brien, D., 2020. Age related differences in phylogenetic diversity, prevalence of Shiga toxins, Intimin, Hemolysin genes and select serogroups of Escherichia coli from pastured meat goats detected in a longitudinal cohort study. BMC Vet. Res., 16: 1-15. https://doi.org/10.1186/s12917-020-02479-0

Office International des Épizooties (OIÉ). 2000. Salmonellosis. Manual of standards for diagnostic tests and vaccines. OIÉ. Paris, pp. 832-842.

Osman, K.M., Mustafa, A.M., Elhariri, M. and Abdelhamed, G.S., 2013. The distribution of Escherichia coli serovars, virulence genes, gene association and combinations and virulence genes encoding serotypes in pathogenic E. coli recovered from diarrhoeic calves, sheep and goat. Transbound. Emerg. Dis., 60: 69-78. https://doi.org/10.1111/j.1865-1682.2012.01319.x

Reiner, K., 2010. Catalase test protocol. Am. Soc.Microbiol., 1:1-9.

Saha, G.K., Paul, A.K., Samad, M.A., Islam, M.A. and Khan, M.S.R., 2014. Prevalence of Salmonella associated with goats in Bangladesh. Suranaree J. Sci. Technol., 21: 193-199.

Shabana, I.I., Bouqellah, N.A. and Zaraket, H., 2017. Investigation of viral and bacterial enteropathogens of diarrheic sheep and goats in Medina, Saudi Arabia. Trop. Biomed., 34: 944-955.

Shabana, I.I. and Al-Enazi, A.T., 2020. Investigation of plasmid-mediated resistance in E. coli isolated from healthy and diarrheic sheep and goats. Saudi J. biol. Sci., 27: 788-796. https://doi.org/10.1016/j.sjbs.2020.01.009

Shrivastava, S., Mishra, K.K., Shrivastava, N., Walwadkar, K.K., Singh, A.K. and Risheen, G.D., 2022. Prevalence of caprine diarrhea due to Escherichia coli in the Vindhya region (Rewa) of Madhya Pradesh. Gene, 10: 13-14.

Thiruvenkadan, A.K. and Karunanithi, K., 2007. Mortality and replacement rate of Tellicherry and its crossbred goats in Tamil Nadu. Indian J. Anim. Sci., 77: 590–594.

Urie, N.J., Lombard, J.E., Shivley, C.B., Kopral, C.A., Adams, A.E., Earleywine, T.J., Olson, J.D. and Garry, F.B., 2018. Preweaned heifer management on US dairy operations: Part V. Factors associated with morbidity and mortality in preweaned dairy heifer calves. J. Dairy Sci., 101: 9229-9244. https://doi.org/10.3168/jds.2017-14019

Vanselow, B.A., Hornitzky, M.A., Walker, K.H., Eamens, G.J., Bailey, G.D., Gill, P.A., Coates, K., Corney, B., Cronin, J.P. and Renilson, S., 2017. Salmonella and on farm risk factors in healthy slaughter-age cattle and sheep in Eastern Australia. Aust. Vet. J., 85: 498-502. https://doi.org/10.1111/j.1751-0813.2007.00233.x

Yadegari, Z., Brujeni, G.N., Ghorbanpour, R., Moosakhani, F. and Lotfollahzadeh, S., 2019. Molecular characterization of enterotoxigenic Escherichia coli isolated from neonatal calves diarrhea. Faculty of Veterinary Medicine, Urmia University, Urmia, Iran. Vet. Res. Forum, 10: 73-78.