Molecular Characterization and Genetic Identification of Pakistani Partridges Through DNA-Barcoding

Muhammad Zia ul Haq1, Asim Iqbal1, Rana Manzoor Ahmad2,

Aftab Ahmad Anjum1, Aqsa Arshad2, Muhammad Wasim1, Sehrish Firyal1, Muhammad Tayyab1, Agha Wasif1 and Ali Raza Awan1*

1Institute of Biochemistry and Biotechnology, University of Veterinary and Animal Science, Lahore, Pakistan

2Department of Zoology, Government College University, Lahore, Pakistan

ABSTRACT

Now a days, DNA barcoding using COI gene (mitochondrial cytochrome c oxidase subunit I) has gained more attention, because of these barcodes validity and simplicity for identification of bird species has increased a lot. In present study, 650bp region of COI gene of two bird species, Chukar patridge (Alectoris chukar) and Sand patridge (Ammoperdix heyi) are sequenced. Total 6 birds (03 birds from each species) were selected. Each sample was aligned with its reference sequence of COI gene available on NCBI and every nucleotide position which did not align with reference sequence was studied to identify SNPs. Our results demonstrated that A. chukar formed a single cluster with Alectoris philbyi while Alectoris rufa and Alectoris melanocephala were a bit distant relatives of A. chukar. The study clearly suggesting efficacy and accuracy of DNA barcodes for molecular identification and characterization of species. Further, barcoding technique used for analysis of molecular diversity and genetic identification of partridges provide a valuable information about population structure, phylogenetic history, molecular conservation and species identification.

Article Information

Received 30 June 2023

Revised 05 December 2023

Accepted 20 December 2023

Available online 13 August 2024

(early access)

Published 05 July 2025

Authors’ Contribution

ARA developed the idea and supervised the research. MZH, AI and AAA and MW prepared material and collected data. Data was analysed by MZH, AI, SF and MT. The gene analysis and submission was done by MZH, AW, AA and AI. RMA and AA has drafted the manuscript.

Key words

Alectoris chukar, Ammoperdix heyi, COI gene, DNA barcoding, Molecular characterization

DOI: https://dx.doi.org/10.17582/journal.pjz/20230630100651

* Corresponding author: [email protected]

0030-9923/2025/0004-1993 $ 9.00/00

Copyright 2025 by the authors. Licensee Zoological Society of Pakistan.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

Being an indispensable piece of biological system, birds are abundant creature that exist on earth. They have shown a regular approach towards plants pollination and in control of bugs. The accumulated excrement of birds is widely used as compost. In addition, meat of few feathered creatures is utilized as a healthy diet worldwide. Through environment, a few winged animals transport assortment of things like seed scattering, dust transportation and microorganisms spread as well (Valentini et al., 2008).

The partridges (non-migratory birds) belong to genus Alectoris of family Phasianidae and considered as birds of hilly, open and dry terrains. They show huge variations in their morphological characteristics (greyish breast and back, buff belly and reddish legs). Their face is white, usually prominent with dark gorget and are known as rotund birds. There are various reported species of partridges including Philby’s patridge (Alectoris philbyi), chukar patridge (Alectoris chukar), rock patridge (Alectoris graeca) and Red- legged patridge (Alectoris rufa). The representatives of these birds are found inhibit in northern side of Africa, southern Europe and across Pakistan in Asia. Among all above given species, red-legged partridge and chukar have been introduced to Hawaii and Canada. However, the hybrid between these two species are also common in Great Britain (Khan et al., 2010). Although sand partridges (Ammoperdix heyi) and chukars (Alectoris chukar sinaica) of the Negev Desert are sympatric in some areas, sand partridges are endemic to arid regions, whereas chukars are primarily mesophilous (Kleinhaus et al., 1985).

A methodology of DNA barcoding using COI sequences (cytochrome oxidase subunit I) has extensive potential in discrimination of species that are closely related across diverse phyla in kingdom Animalia (Herbert et al., 2003a, b). A single barcode of DNA act as a rapid tool in discovery of lineages within a huge population that might be regarded as undiscovered species (Tavares and Baker, 2008). In addition, this methodology is useful to differentiate species when it is difficult to match adults with immature specimens like fish larvae (Peg et al., 2006) or species having polymorphic life cycle (Lane et al., 2007). Ilegal trading of animal by products from endanger species can also be monitored via this genetic tool (Valentini et al., 2008; Waugh, 2011).

In recent era, barcoding of DNA has been utilized for bird’s species identification in different regions of the world. However, barcodes of some species such as chukar patridge and sand patridge have not been established tenaciously (Chaves et al., 2008). So, in present work the sequencing of COI gene (having 650bp region) of both targeted species chukar patridge and sand patridge were performed and their sequences are matched with previously determined sequences of other species of same genus.

Materials and methods

Six birds from two different species (3 birds from each species) were selected randomly during the year 2012 to 2016 with the participation of the Punjab Wildlife and Parks Department and Pet Center of University of Veterinary and Animal Sciences, Lahore. The bird’s identification was made based upon their morphological characters.

Blood samples (100-300 μl) were collected from brachial wing vein of each in a vial having 40µL of EDTA solution (0.5M, pH 8.0) and stored at -20°C before extraction of genomic DNA according to Sambrook and Russel (2001) using Thermo Fisher Scientific Kit, USA. This DNA was used for amplification of COI gene using primers as follows (Hebert et al., 2004).

F 5’ TTCTCCAACCACAAAGACATTGGCAC 3’

R 5’ ACGTGGGAGATAATTCCAAATCCTG 3’

The PCR products (700bp) was sequenced on Applied Bimolecular System Instrument ABI 3100 Genetic Analyzer in Center for Applied Molecular Biology, Punjab, Pakistan. Sequences were analyzed by Bio Edit software and for homology and Clustal W2 was used for pairwise alignment.

By making use of Fast Minimum Evolution Method, phylogenetic trees for both the bird species were constructed in which COI gene sequences of Pakistani patridges were compared with all available sequences of birds to look over their phylogeny and taxonomy (Desper and Gascuel, 2004; Danish et al., 2008). The MEGA 6.0 software was used for further phylogenetic analysis.

Results and discussion

In the present study, the COI gene of Pakistani patridges were sequenced. The sequences of gene were submitted to National Centre for Biotechnology Information Genbank and different analysis of COI gene sequences were performed including homology analysis. The homology anatomization of the reference sequence and COI gene sequences of closest species; chukar patridge and sand patridge disclosed single nucleotide polymorphisms at various sites in COI gene sequences. The phylogenetic tree using 650bp nucleotide segment of COI gene was created followed by the comparison of COI gene sequences of both Chukar patridge and Sand patridge with all available sequences of patridges. The results showed that A. chukar formed a single cluster with Alectoris philbyi. A. rufa and Alectoris melanocephala were a bit distant relatives of A. chukar (Fig. 1). In addition, A. heyi showed a single cluster relationship with Francolinus genus. The genus Francolinus formed a single cluster indicated that F. francolinus and its sister species are sharing a common ancestor. Outer group of A. chukar; F. francolinus and F. pondicerianus are Chinese Arborophila bruneopectus (KC352730.2) bar-backed partridge, showed that Pakistani A. chukar, F. francolinus and F. pondicerianus had evolved from Chinese bar backed partridge (Fig. 2).

Many investigators also used mitochondrial control region sequences for phylogenetic and molecular diversity analysis of avain species (Lerner et al., 2009; Ozaki et al., 2010). A study was designed by Huang et al. (2007) in which he utilized mitochondrial control regions for analysis of phylogeographical structure of rusty patridges (neck-laced patridges). The control region sequences have demonstrated phylogeographical structure existence among population of rock patridges resulting from genetic divergence in Southern refugia (Lucchini and Randi, 1998).

Further, Fleischer et al. (2006) had conducted an experiment for DNA analysis of seven endangered specimens of wood- pecker (Campephilus principalis) and showed the documentation of their molecular diversity. The sequence analysis of these wood peckers had provided an essential DNA barcode resource for discernment of these endangered species. Although patridges have not considered threatened, it is likely that many vulnerable local populations exist within the range of species resulting from hunting and habitat loss and may need special attention (Kark et al., 1999). Barilani et al. (2007) in his study have disclosed introgessive hybridization, suggesting that the released captive-bred patridges have hybridized and reproduced in nature polluting the wild rock patridge population’s gene pool in Greece. It means that a fine understanding of evolutionary history and phylogeography provides important information about habitat preference and physical barriers influence on gene flow in birds (Morris-Pocock et al., 2010).

Conclusion

In conclusion, the 650bp sequence of mitochondrial cytochrome c oxidase subunit I act as an important

 

 

phylogenetic marker because trees that are obtained with its data set coincides with pre-established phylogeny of patridges species.

Acknowledgments

We are highly thankful to Higher Education Commission (HEC), Pakistan for their tremendous contribution and financial support to the first author of this article during this research work.

Conflict of interest statement

The authors have declared no any conflict of interest in this study.

References

Barilani, M., Sfougaris, A., Giannakopoulos, A., Mucci, N., Tabarroni, C. and Randi, E., 2007. Conserv. Genet., 8: 343–354. https://doi.org/10.1007/s10592-006-9174-1

Chaves, A.V., Clozato, C.L., Lacerda, D.R., Sari, E.H.R. and Santos, F.R., 2008. Mol. Ecol. Resour., 8: 1169–1177. https://doi.org/10.1111/j.1755-0998.2008.02218.x

Danish, M.T., Geerlinds, E., Solkner, J., Thea, S., Thieme, O. and Wurzinger, M., 2008. Characterization of Indigenous chicken production system in Cambodia. FAO.

Desper, R. and Gascuel, O., 2004. Mol. Biol. Evol., 21: 587-598. https://doi.org/10.1093/molbev/msh049

Fleischer, R.C., Kirchman, J.J. and Dumbacher, J.P., 2006. Biol. Lett., 2: 466–469. https://doi.org/10.1098/rsbl.2006.0490

Hebert, P.D.N., Penton E. H., Burns, J.M., Janzen, D. and Hallwachs, W., 2004. Proc. natl. Acad. Sci. USA., 101: 14812–14817. https://doi.org/10.1073/pnas.0406166101

Huang, Z., Liu, N., Luo, S. and Long, J., 2007. Mol. Phylogenet. Evol., 43: 379–385. https://doi.org/10.1016/j.ympev.2007.01.005

Kark, S., Alkon, P.U., Safriel, U.N. and Randi, E., 1999. Conserv. Biol., 13: 542–552. https://doi.org/10.1046/j.1523-1739.1999.98150.x

Khan, H.A., Arif, I.A. and Shobrak, M., 2010. Evol. Bioinf., 6: 151. https://doi.org/10.4137/EBO.S6014

Kleinhaus, S., Pin show, B., Bernstein, M.H. and Degen, A.A., 1985. Physiol. Zool., 58: 105-116. https://doi.org/10.1086/physzool.58.1.30161224

Lane, C.E., Lindstrom, S.C. and Saunders, G.W., 2007. Mol. Phylogenet. Evol., 44: 634–648. https://doi.org/10.1016/j.ympev.2007.03.016

Lerner, H.R., Johnson, J.A., Lindsay, A.R., Kiff, L.F. and Mindell, D.P., 2009. PLoS One, 4: e7336. https://doi.org/10.1371/journal.pone.0007336

Lucchini, V. and Randi, E., 1998. Heredity, 81: 528–536. https://doi.org/10.1038/sj.hdy.6884130

Morris-Pocock, J.A., Steeves, T.E., Estela, F.A., Anderson, D.J. and Friesen, V.L., 2010. Mol. Phylogenet. Evol., 54: 883–896. https://doi.org/10.1016/j.ympev.2009.11.013

Ozaki, K., Yamamoto, Y. and Yamagishi, S., 2010. Genes Genet. Syst., 85: 55–63. https://doi.org/10.1266/ggs.85.55

Peg, G.G., Sinclair, B., Briskey, L. and Aspden, W.J., 2006. Austral. Sci. Mar., 70: 7–12. https://doi.org/10.3989/scimar.2006.70s27

Sambrook, J. and Russel, D.W., 2001. Molecular cloning: A laboratory manual 111. Cold spring Laboratory press. Cold spring Harbour.

Tavares, E.S. and Baker, A.J., 2008. BMC Evol. Biol., 8: 81. https://doi.org/10.1186/1471-2148-8-81

Valentini, A., Pompanon, F. and Taberlet, P., 2008. Tree, 24: 110–117. https://doi.org/10.1016/j.tree.2008.09.011

Waugh, W.J., 2011. DNA barcoding the birds of New Zealand: A thesis presented in fulfillment of the requirements for the degree of Doctor of Philosophy in Molecular Biosciences at Massey University, Auckland, New Zealand. Doctoral dissertation, Massey University.