Special Issue:

Advancements in Animal Health and Production in Low and Middle-Income Countries

Development and In Vivo Evaluation of Recombinant Multi-Epitope Vaccine (ABOR) with Chitin Microparticles as Adjuvant Against Brucella Abortus

Merriam Ghadhanfar Alwan١, Wameedh Hashim Abbas Alqatrani٢, Ibrahim Ayad Jihad3, Qais R. Lahhob4, Mustafa Mudhafar5,6, Hasan Ali Alsailawi7,8*, Mustafa Adnan Zaidan٩

١College of Dentistry , Al-Iraqia University; ٢Department of Microbiology, Al-Zahraa college of medicine, University of Basrah, Iraq; 3Department of chemistry and biochemistry, Al-Zahraa college of medicine, University of Basrah, Iraq; 4Collage of Pharmacy, National University of Science and Technology, Dhi Qar, 64001, Iraq; 5Department of Medical Physics, Faculty of Medical Applied Sciences, University of Kerbala, 56001, Karbala, Iraq; 6Department of Anesthesia Techniques and Intensive Care, Al-Taff university college, 56001, Kerbala, Iraq; 7Department of Basic Sciences, College of Dentistry, University of Kerbala, 56001, Karbala, Iraq; 8Department of Anesthesia Techniques, AlSafwa University College, Karbala, Iraq; ٩Al-Farahidi university, Baghdad, Iraq.

Abstract | Immunization plans need to function more efficiently since human health as well as cattle face a substantial threat from brucellosis which is transmitted to people through Brucella spp. Additional risk-free options must be developed given that existing live-attenuated vaccines including RB51 display two fundamental constraints which are diagnostic interference and residual disease potency. Research and analysis created and evaluated a new ABOR recombinant multi-epitope polypeptide vaccine that utilized antigenic Brucella abortus protein sequences. The polypeptide emerged from Escherichia coli BL21 bacteria and the study explored its binding with chitin microparticles when used as an adjuvant. Research into the immunogenic properties of guinea pigs involved performing tests on their serum and cellular immune responses. The ABOR+chitin vaccination stimuli led to IgG increases equaling RB51 vaccination levels according to ELISA analysis. The real-time RT-PCR examination confirmed the development of a Th1 dominant cytokine profile together with elevated levels of IFN-γ and IL-12 and TNF-α and reduced levels of IL-4 and IL-10. The ABOR+chitin treatment demonstrated superior ability to generate antigen-specific T-cell responses in comparison to RB51 vaccination in lymphocyte proliferation tests. Investigations at the tissue level showed that the vaccine administration resulted in no hazardous effects to the liver structure thus confirming its safety profile. A combination of ABOR with chitin seems to trigger a considerable immune system response which indicates its potential to replace live-attenuated vaccines in preventing brucellosis.

Keywords | Brucellosis, Brucella abortus, Recombinant vaccine, Chitin adjuvant, Immune response, Cytokines, Th1 immunity, IgG, Vaccine safety, Antigen-specific T-cell response


Received | June 27, 2025; Accepted | August 01, 2025; Published | August 12, 2025

*Correspondence | Hasan Ali Alsailawi, Department of Basic Sciences, College of Dentistry, University of Kerbala, 56001, Karbala, Iraq; Email: [email protected]

Citation | Alwan MG, Alqatrani WHA, Jihad IA, Lahhob QR, Mudhafar M, Alsailawi HA, Zaidan MA (2025). Development and in vivo evaluation of recombinant multi-epitope vaccine (ABOR) with chitin microparticles as adjuvant against brucella abortus. J. Anim. Health Prod. 13(s1): 89-97.

DOI | https://dx.doi.org/10.17582/journal.jahp/2025/13.s1.89.97

ISSN (Online) | 2308-2801

Copyright: 2025 by the authors. Licensee ResearchersLinks Ltd, England, UK.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).



INTRODUCTION

Caused through Brucella spp., facultative intracellular pathogens mostly affecting cattle, brucellosis is a zoonotic bacterial illness, that may be acquired through people through contacting diseased animals or consuming contaminated dairy products (Khorramizadeh et al., 2019). Reproductive failures, lower productivity, and trade restrictions within impacted areas cause the illness to have a major economic cost (Jacob and Curtiss, 2021). One for the most virulent species, Brucella abortus mostly affects cattle, and has been linked to serious human infections, thereby stressing the necessity for efficient management techniques (Zamri-Saad and Kamarudin, 2016). alongside live-attenuated vaccines as RB51, and S19 utilized extensively, the evolution for vaccinations has been very vital within brucellosis management. These vaccines have several important drawbacks, however, including residual virulence, possible toxicity to humans, and the capacity to cause miscarriage within pregnant animals, which calls for the hunt for safer, and more powerful substitutes ) (Gheibi et al., 2018; Kareem et al., 2023; Aziz et al., 2023). Brucella causes a complicated immunological response mostly including T-helper 1 (Th1) mediated immunity, which is necessary for bacterial clearance. Presenting Brucella antigens to lymphocytes, and inducing the release for pro-inflammatory cytokines including tumor necrosis factor-alpha (TNF-α), interleukin-12 (IL-12), and interferon-gamma (IFN-γ), macrophages first line for protection, and help to activate cytotoxic T cells, and macrophages (Schurig et al., 2002). Although the pathogen has developed strategies to avoid host defense through suppressing antigen presentation, and regulating cytokine release, hence causing persistent infections, this immune response is essential within the containment for Brucella infection (Babaoglu et al., 2018).

Live-attenuated strains, including RB51, which lacks the O-polysaccharide component for the lipopolysaccharide (LPS), therefore minimising their interference alongside serological diagnostic tests (Puspitoyani et al., 2020), current vaccination techniques for brucellosis mostly depend upon them. Though it has benefits, RB51 does not give 100% immunity against Brucella infection, and is not totally protective. Furthermore linked to miscarriages within pregnant cattle, and to ongoing infection within vaccinated animals is this agent (Yazdi et al., 2009; Ali et al., 2024; Al-Sailawi et al., 2024; Mohsen et al., 2024). Furthermore, studies indicate, that host genetics, and environmental circumstances affect the protective effectiveness for RB51, thereby stressing the necessity for different vaccination strategies (Dabral et al., 2019). Subunit vaccines—which include immunogenic proteins or peptides, that induce specific immune responses while reducing side effects—have lately attracted most attention within the field for vaccine development. These vaccinations lower the potential for diagnostic interference, and eradicate bacterial persistence (Monreal et al., 2004). Using multi-epitope chimeric proteins—which combine antigenic determinants coming from many Brucella proteins to improve immunogenicity—among the most exciting approaches Attractive possibilities for brucellosis prevention, studies show multi-component vaccinations produce stronger Th1-type response than single-component vaccines (Schurig et al., 2002).

We produced a recombinant multi-epitope polypeptide vaccine (ABOR) which was made from several Brucella protein antigenic regions. The recombinant Escherichia coli (E. coli) BL21 (DE3) produced polypeptides received purification before being combined with chitin as an adjuvant material for immunological stimulation. The veterinary vaccination research model of choice in this study was the frequently validated animal specimen of guinea pigs which were used for ABOR immunogenicity tests. This study evaluated immune responses to antibodies and cytokine production (IL-12, IFN-γ, TNF-α, IL-10) together with T-cell activation to determine its potential as a secure and efficient alternative to live-attenuated vaccines for treating brucellosis.

MATERIALS AND METHODS

Preparation of ABOR Polypeptide

Defined by researchers ABOR polypeptide integrates five Brucella abortus protein-based antigenic domains which engineers them with GS linkers for protein connection. The synthesized coding sequence included sites for restriction enzymes to allow the sequence to be cloned into the pET22b expression vector obtained from GeneCust, Luxembourg S.A. The expression of the multi-epitope recombinant protein took place in Escherichia coli BL21 (DE3) strains after plasmid transformation resulted in the recombinant plasmid. Purification of recombinant ABOR polypeptide started with standard induction of protein expression then proceeded with chromatographic affinity separation. The lyophilization process to create a future-useable product occurred at –40°C along with full vacuum conditions for three hours under Pizarro-Cerda et al. (2000). The laboratories situated in Iraq served as the site to execute every experimental process.

Preparation of Chitin Microparticles as an Adjuvant

The production of chitin microparticles consisted of sonicating pure chitin powder (C-7170 Sigma) dispersed in distilled water followed by filtration through a 40μm sieve (BD Falcon Mexico) and subsequent centrifugation at 2800×g for 10 minutes. A centrifugation step at 2800×g during 10 minutes collected the microparticles which had sizes under 40 μm. A solution with 100 μg/100 μL concentration of chitin microparticles was achieved through their resuspension in distilled water after drying at 40°C. The preparation of autoclaved chitin suspension occurred at 4°C for storage prior to its use. Particle size determination and distribution evaluation occurred through a laser particle size analyzer from Malvern Master Sizer based in the UK (de Figueiredo et al., 2015). The Limulus Amebocyte Lysate (LAL) kit from Cambrex tested both sterility and endotoxin absence in the prepared material. The absence of coagulation in the Limulus Amebocyte Lysate test results confirmed the endotoxin-free nature of the chitin-ABOR mixture (Starr et al., 2008). The entire adjuvant preparation process as well as testing operations ran within research laboratories based in Iraq.

Immunization Protocol

The registered biomedical research center in Iraq provided Guinea pigs (Cavia porcellus) that received maintenance under controlled environmental conditions with temperature set at 22 ± 2°C and a humidity level between 50 ± 5% under a 12 hour light/dark cycle schedule. The five-week-old animals with 300 ± 20 g weight received unrestricted food and water supply. The study included three animals per experimental group which received subcutaneous vaccine injections at ten-day intervals through 200 µL doses of vaccine formulations. The study utilized five different groups which received administration of either ABOR polypeptide with chitin adjuvant, commercial RB51 vaccine or chitin alone or ABOR polypeptide alone while serving as the negative control the animals received phosphate-buffered saline (PBS). Chitin-adjuvanted ABOR polypeptide and RB51 commercial vaccine along with their control treatments received a third subcutaneous immunization before spleen sample retrieval (Hess et al., 1998).

Lymphocyte Isolation and Culture

End of the immunization protocol required cardiac puncture blood collection while animals received anesthesia. The extraction process of spleens started with sterility protocols for preparing splenocyte isolation through Ficoll 1074 (Sigma) density gradient centrifugation. Separated lymphocytes received RPMI-1640 Biosera medium to which the penicillin solution contained 100 U/mL whereas streptomycin solution reached 100 μg/mL. The lab cells received incubation at 37°C inside a humidity chamber with 5% CO₂ atmospheric concentration and 80% humidity rate control. The researchers performed all immunological experiments in three replicate conditions to achieve high accuracy and repeatability (Peña-Blanco and García-Sáez, 2018). The Iraqi institutional guidelines authorized both the experimental procedures and the methods for animal management.

Assessment for ABOR-Specific IgG Levels via ELISA

Specific IgG levels within serum for vaccinated animals were ascertained through means for an enzyme-linked immunosorbent test (ELISA). within PBS, 96-well plates were briefly covered alongside various doses for the pure ABOR protein, and overnight incubated for 4°C. Three times the plates were washed; then, for room temperature, they were blocked for one hour using blocking buffer. Each well received 100 μL for diluted serum samples (1;500, and 1;200) subsequent to extra washing, and incubated for room temperature for 2.5 hours. The wells were cleaned, furthermore horseradish peroxidase (HRP)-conjugated anti-guinea pig IgG (1;10000 dilution within PBS) added, and incubated for one hour. Three, three, five, five’-Tetramethylbenzidine (TMB) substrate (Sigma) used to be used for colorimetric detection; the reaction used to be halted alongside 50 μL for 2N H₂SO₄. Measuring optical density (OD) for 450 nm alongside a reference wavelength for 630 nm, Du et al. (2000) found.

Cytokine Gene Expression Analysis Using RT-qPCR

Following manufacturer directions, total RNA used to be isolated coming from blood samples kept within RNAlater solution using a Gene All Hybrid-R RNA Purification Kit (South Korea). to remove genomic DNA contamination, the RNA used to be processed alongside 5 U for amplification-grade DNase I (Fermentas, Lithuania.). A NanoDrop-1000 spectrophotometer (Thermo Scientific) (Vemulapalli et al., 2000) evaluated purity, and concentration. M-MuLV reverse transcriptase (Fermentas, Lithuania) used to be used for cDNA synthesis; SYBR Green I mix (Roche Applied Sciences, Germany) used to be used for quantitative PCR within a StepOneTM instrument (Applied Biosystems). Denaturation for 95°C for 15 s, annealing for 60°C for 10 s, and extension for 72°C for 15 s for 45 cycles comprised the amplification settings. Using GAPDH as a housekeeping gene, gene expression used to be normalised; relative fold expression used to be furthermore analysed using the 2^−ΔΔCt approach (Takebe et al., 2003). The primers used within the RT-qPCR analysis are shown within the following Table 1.

This table emphasizes the particular primers used for amplifying genes linked to cytokine generation, which are essential for immunological regulation during a brucella infection as shown within the following Table 2. Designed using publicly accessible GenBank databases, the primer sequences were tested for efficiency, and specificity (Obrani et al., 2013).

Lymphocyte Proliferation Assay via Flow Cytometry

Carboxyfluorescein succinimidyl ester (CFSE) staining let one assess splenocyte proliferation. Labelled alongside 5 μM CFSE (Molecular Probes, USA), spleenocytes were incubated for 37°C, 5% CO₂, furthermore examined beneath a flow cytometer 72 hours later. Comparing the fluorescence intensity for experimental, and control groups allowed one to ascertain the proliferation index (PI) (Kim et al., 2016).

 

Table 1: The primers used within cytokine genes expression level assay through Real-Time RT-PCR.

Gene

Forward (5-3)

Reverse (5-3)

IL-4

tgacggtcattctcttctgcctc

aggagagtgtgtgttgaggtgctg

IL-12

acctccctagggcctcaccag

ggccttgtgaagttcactgttc

IL-5

ggaagctctggcaacactattc

tgcttcactctccgtcgctcc

IL-10

gccacccagagcagaccac

accctgccaaaggcagctcgg

TNF-α

tgcactttggggtgatcggcc

agccaccggcttgtcattatcg

IFN-γ

atgttggctcttcagttctg

catctgagttatctgcattc

IL-2

gttatgctttctcagagcaaccc

gctaaatttagcacctgctccac

GAPDH

gtagccatcaatgatccct

aaggctgagaatgggaagct

 

Statistical Analysis

Every experiment used to be run within triplicate; results were reported as mean ± standard deviation (SD). One-way analysis for variance (ANOVA) alongside Tukey’s post-hoc test used to be used to find statistical significance; p-values <0.05 were regarded statistically significant (Seleem et al., 2004). REST 2009 program (Qiagen, Germany) (Glomski et al., 2002) used to be used to examine real-time qPCR data.

 

RESULTS

Particle Size Distribution for Chitin Microparticles

The particle size distribution for chitin used to be investigated using a laser particle size analyzer within order to assess its adjuvant usefulness. The findings showed, that 90% for the chitin microparticles were less than 64.5 μm, 50% were below 23.6 μm, and 10% were lower than 6.01 μm, therefore suggesting an ideal size range for phagocytosis, and immunological activation. Figure 1 shows the size distribution profile, alongside a peak between 10–20 μm, therefore verifying the homogeneity for the microparticles.

 

Table 2: Summary for key findings.

Parameter

PBS Control

Chitin Alone

RB51 Vaccine

ABOR Alone

ABOR +Chitin

IgG Absorbance (450 nm)

Low

Moderate

High

Moderate

Highest

Cytokine Expression (IFN-γ, IL-12, TNF-α)

Low

Moderate

High

Moderate

Highest

Lymphocyte Proliferation (PI)

Low

Moderate

High

Moderate

Highest

IFN-γ/IL-10 Ratio

Low

Moderate

High

High

Highest

Histopathology (Liver Toxicity)

No damage

No damage

No damage

No damage

No damage

 

Humoral Immune Response; IgG Absorbance Levels

Guinea pigs immunised alongside ABOR polypeptide, and RB51 were used within the ELISA experiment to evaluate IgG-specific antibody levels. The results—shown within Figure 2—show, that compared to the PBS control group, ABOR + chitin, and RB51 groups had substantially greater IgG absorbance values. Particularly, the mean absorbance for 450 nm used to be 2.051 ± 0.217 for ABOR + chitin, and 1.864 ± 0.115 for RB51, proving that ABOR polypeptide may produce an equivalent antibody response to the commercial RB51 vaccination.

 

Serum Absorbance Levels within Infected and Non-Infected Cattle

Sera coming from healthy, and Brucella-infected calves were examined for IgG binding upon ABOR-coated plates to verify the immunogenicity for ABOR polypeptide within a genuine infection environment. Sera coming from infected calves had much higher absorbance values (mean 0.601 ± 0.218) than those coming from healthy animals (mean 0.218 ± 0.078, p = 0.0001, Figure 3).

 

Cytokine Gene Expression and Th1/Th2 Polarization

Real-time RT-PCR was used to evaluate the expression for important cytokines including IFN-γ, IL-2, IL-12, TNF-α (Th1 cytokines), and IL-4, IL-5, IL-10 (Th2 cytokines), thereby assessing the immune response for the molecular level. Figure 4 shows (p < 0.05), that within the ABOR + chitin group, IFN-γ, IL-12, and TNF-α were considerably raised compared to the RB51 group. Essential for Brucella clearance as well as cell-mediated immunity, these cytokines are also found within upon the other hand, the ABOR + chitin group considerably downregulated IL-10, IL-5, and IL-4 (which are linked alongside Th2 responses), hence showing a Th1-skewed immune response.

 

Lymphocyte Proliferation Index

Using a lymphocyte proliferation test, we assessed cellular immune responses. The proliferation index (PI) for splenocytes within many groups is shown within Figure 5. The lowest proliferation rate used to be coming from the PBS control group; ABOR + chitin produced the greatest PI (≈6.8), followed through RB51 (≈5.2).

 

IFN-γ/IL-10, and IFN-γ/IL-4 Ratios; Confirmation for Th1 Response

Calculated ratios for IFN-γ to IL-10, and IFN-γ to IL-4 might help to substantiate the Th1-skewing impact for the vaccination candidates even further. These ratios were significantly greater within the ABOR + chitin group than within RB51, and control groups, Figure 6 reveals.

 

Histopathological Evaluation for Liver Tissues

To evaluate possible toxicity for the ABOR polypeptide, liver tissues were histologically examined. Across experimental groups, no notable necrotic alterations, degeneration, or hepatocellular injury used to be seen.

DISCUSSION

Particle Size Distribution Analysis

These findings are in tandem with previous findings on effective activation of the antigen-presenting cells aided by smaller chitin microparticles (Lee et al., 2002). The percentage of the particle size analysis of chitin microparticles revealed that ninety percent of all particles were 64.5 1/16 less, fifty percent was under 23.6 1/16 and ten percent was under 6.01 1/16. These findings indicate that in the phagocytosis process via an antigen presenting cell (APCs), the majority of the chitin particles fall within an optimal size range- which is instrumental in effective activation of the immune system (Lee et al., 2002). Via macrophage, and dendritic cell activation, chitin, with its reported immunomodulating properties, has been proven to enhance innate, and adaptive immune response, as such promoting the expulsion of pro-inflammatory cytokines such as TNF- IL-12 (Puspitoyani et al., 2020). The extremely small size of these microparticles ensures that microparticles are efficiently absorbed via APCs which facilitates sustained display of antigen, and triggers Th1 responses a characteristic that is imperative in combating intracellular diseases such as Brucella abortus (Schurig et al., 2002). And the optimum particle size pretends that the microparticles of chitin can be effectively used as adjuvant in vaccination preparations, thus enhancing antigen containment, and augmenting the persistence and duration of the immune response.

Humoral Immune Response Implications

This implies, that a significant humoral immune response (Vemulapalli et al., 2000) may be generated through the recombinant antigen within concert alongside chitin. The ELISA findings showed, that the ABOR protein, especially within conjunction alongside chitin, produced a robust humoral immune response alongside absorbance values far above the PBS control, and similar to the RB51 vaccination. Indicating the great immunogenicity for the recombinant multi-epitope vaccination, the mean absorbance for 450 nm for the ABOR+chitin group (2.051 ± 0.217) used to be rather greater than, that for the RB51 vaccination (1.864 ± 0.115). This implies, that ABOR is able to induce the synthesis for antigen-specific IgG, a fundamental component for protective immunity against Brucella infection (Vemulapalli et al., 2000). through improving antigen presentation, and extending immune activation, chitin’s usage as an adjuvant most certainly helped to produce this response. Effective Brucella vaccines must generate strong, and lasting antibody-mediated immunity, hence the ABOR+chitin formulation shows a good choice for further research (Dorneles et al., 2015). Investigating its capacity to provide long-term defense against Brucella infection within cattle should be the main emphasis for further investigations.

Natural Infection Response Validation

This signifies, there are epitopes that can be recognized by the immune system spontaneously during an infection, thus it confirms that ABOR can be used as a possible vaccination antigen (Datta et al., 1990). The serological analysis of the infected, and healthy cattle serum indicated significantly high absorbance levels of IgG in the infected demographics (0.601 + 0.218) comparatively to the healthy controls (0.218 + 0.078) with p < 0.0001. This indicates, that the ABOR protein contains immunodominant epitopes, naturally identified by the immune system in an infection, thus indicating potential application as a diagnostic antigen or a vaccine component (Datta et al., 1990). in the context, that as a subunit vaccine, the capability of the ABOR protein to elicit potent antibody response in naturally occurring animals implies potentially high efficacy protection. Moreover, highlighted by these findings is the imperativeness of the selection of antigenic targets, which would be similar to the actual infection in order to ensure robust, and long-term protective immunity. in addition to the establishment of the protective efficacy of ABOR, future studies should also explore the functional properties of these antibodies, including antigen in opsonisation and bacterial clearance (Monreal et al., 2004).

Cytokine Profile and Immune Polarization

In a Brucella vaccination, such polarization is optimal since Th1 mediated responses correspond with protective immunity (Zhu et al., 2011). Analysis of ABOR + chitin treatment produced a greater output in Th1 cytokines (IFN-y, IL-12 and TNF-y) above those of RB51 and control groups as real-time RT-PCR results indicated. The IL-12 proteins and high IFN-gamma also stimulate the antigen-specific trigger action of cytotoxic T cells and macrophages (Zhu et al., 2011). The IL-10, IL-5 and IL-4 levels were lower in mice exposed to ABOR+chitin implying a diminished Th2 response activity that is commonly found in chronic infections of Brucella (Khorramizadeh et al., 2019). Optimum immune control over Th1 reactions must be obtained through the development of clinical vaccines that are guided by the previous needs regarding anti- Brucella defenses (Jacob and Curtiss, 2021). The protection ABOR+chitin combination against RB51 provokes is superior since it increases cell-mediated immunity, which is necessary to eliminate intracellular bacteria.

Cellular Immune Response Assessment

This would suggest, that ABOR polypeptide, particularly, when combined with chitin, efficiently primes the expansion of T-cells, the essential attribute of a robust adaptive immunological response (Rieger et al., 2011). Analysis of the lymphocyte proliferation assay indicated that the splenocytes taken from the ABOR(+)chitin inoculated guinea pigs had the proliferation index of ~6.8 and was significantly higher compared to that of the RB51 vaccinated guinea pig that had the proliferation index of ~5.2. The desired cellular defense to this antigen-specific response is evidence that the administration of ABOR formulation is a product that elicits protection against intracellular infections such as Brucella (Rieger et al., 2011). The immunostimulatory characteristics of chitin allow the APCs to take up antigens and present them to the T-helpers cells resulting in the increased T-cell activation as per Ugalde et al. (2003). ABOR-chitin combination signifies the possible utility as a superior vaccine because cellular immunity is essential to have in control of Brucella infections and the cellular immune response this vaccine construct produces is, in fact, more than that produced by RB51 Vaccine.

Th1 Response Confirmation and Clinical Implications

The IL-4-mediated Th2 responses are decreased by IFN- g as a result of which this fact establishes, the predominant induction of Th1 immune response by ABOR polypeptide- is the key event in the effective clearance of Brucella (Ugalde et al., 2003). As expected, a strong Th1-polarized immune system was corroborated by low IFN-/IL-10, and IFN-/IL-4 ratio in the AAOR+chitin incubated group, as compared to the RB51, and control groups. Although IL-10, and IL-4 are associated with immunosuppressive, and Th2 respectively, IFN- (interferon gamma) is an essential cytokine in intracellular killing of bacteria (Babaoglu et al., 2018). The more elevated IFN-gamma/IL-10, and IFN-gamma/IL-4 ratio also indicates, that the ABOR vaccination design promotes protective immunity, thus reducing the risk of persistent infection (Schurig et al., 2002). By reducing IL-10 immunoregulatory effect that is found to be high in chronic Brucella infection, ABOR+chitin then may provide increased protection as compared to RB51. A higher carrying out of large-scale animal experiments should be done to evaluate the long-term effects of this immunological polarization to bacterial clearance, and prevention of illnesses.

Safety Profile and Overall Assessment

This confirms the safety designation of ABOR polypeptide as a vaccination agent because it means, that obvious toxicity cannot be attributed to it (de Souza Filho et al., 2015). Results of this study highlight the immunogenic potential of the ABOR polypeptide as an alternative to the RB51 vaccination. The ABOR + chitin combination elicited high levels of IgG antibodies; vigorous T-cell stimulation and a Th1-predominant cytokine response to Brucella abortus; each of which is a fundamental requirement in the development of effective protection against Brucella abortus. Absence of toxicity adds to its more viability as effective and safe vaccination alternative. Further studies ought to be focused on the achievement of an evaluation of protective efficacy through the use of challenge tests on cattle models.

CONCLUSIONS AND RECOMMENDATIONS

Strong, and protective immune response against Brucella abortus is produced through the recombinant multi-epitope polypeptide vaccination (ABOR) within conjunction alongside chitin microparticles, the research showed. Essential for intracellular pathogen clearance, ABOR+chitin produced more IgG levels, improved cytokine production promoting Th1-mediated response, and more lymphocyte proliferation than the RB51 vaccination. Significantly, histological analysis verified the lack for toxicity, therefore supporting its possible use as a safe vaccination candidate.

More research should concentrate upon assessing ABOR’s long-term protective effectiveness within big animal models, including cattle, beneath field circumstances, thus advancing the development for ABOR as a feasible brucellosis vaccination. Furthermore, improving immunogenicity might be adjusting the adjuvant composition and evaluating many administration methods. Given the relevance for cellular immunity within brucellosis control, further studies should investigate the capacity for the vaccination to produce long-lasting memory responses. Moreover, combining proteomic, and genomic techniques can enable better choice for epitope for next-generation subunit vaccines. In the end, this work addresses safety issues, and shows the potential for ABOR+chitin as a viable substitute for live-attenuated vaccines, hence generating significant immune responses. Its further evolution, and confirmation might greatly help to manage brucellosis within areas for endemicity.

ACKNOWLEDGEMENTS

The authors acknowledge the Iraqi Ministry of Higher Education and Scientific Research funding support and access to the participating universities to provide the laboratories and technical support.

NOVELTY STATEMENT

The authors acknowledge the Iraqi Ministry of Higher Education and Scientific Research funding support and access to the participating universities to provide the laboratories and technical support.

AUTHOR’S CONTRIBUTIONS

Merriam Ghadhanfar Alwan: Design of study. Wameedh Hashim Abbas Alqatrani: ELISA and microbiology. Protein work. Ibrahim Ayad Jihad. Qais R. Lahhob: Animal experiments. Muhib: RT-qPCR. Hasan Ali Alsailawi: Head of the project and article. Mustafa Adnan Zaidan: Flow cytometry. Every author gave consent to the manuscript.

Conflict of Interest

There is no conflict of interest by the authors.

REFERENCES

Ali AS, Kadhim NA, Rasool EMA, Al-Erjan M, Lahhob QR, Mudhafar M (2024). Harnessing CRISPR-Cas9 gene editing for the eradication of inherited retinal diseases in purebred dogs: A path to preservation and health. J. Anim. Health Prod., 12: 145–156. https://dx.doi.org/10.17582/journal.jahp/2024/12.s1.145.156

Al-Sailawi HA, Hadi AA, Raheem HA, Mudhafar M, Dhahi SJ, Lahhob QR (2024). Impact of serratiopeptidase vs. N-acetyl cysteine (NAC) on skin grafting healing in albino male rabbits. Adv. Anim. Vet. Sci., 12: 1941-1947. https://dx.doi.org/10.17582/journal.aavs/2024/12.10.1941.1947

Aziz LM, Alhachami FR, Abdullah MA, S Abed A, Hassib Ali M, Al-Yasiri RM, Lahhob QR (2023). Molecular Characterization and Antibiotic Resistance Profile of Staphylococcus haemolyticus in Pregnant Women with Urinary Tract Infections. Iranian Journal of Medical Microbiology, 17: 354-360. https://dx.doi.org/10.30699/ijmm.17.3.354

Babaoglu UT, Ogutucu H, Demir G, Sanli D, Babaoglu AB, Oymak S (2018). Prevalence of Brucella in raw milk: An example from Turkey. Niger. J. Clin. Pract., 21: 907–911. https://doi.org/10.4103/njcp.njcp_211_17

Chen F, He Y (2009). Caspase-2 mediated apoptotic and necrotic murine macrophage cell death induced by rough Brucella abortus. PLoS ONE, 4: e6830. https://doi.org/10.1371/journal.pone.0006830

Dabral N, Burcham GN, Jain-Gupta N, Sriranganathan N, Vemulapalli R (2019). Overexpression of wbkF gene in Brucella abortus RB51WboA leads to increased O-polysaccharide expression and enhanced vaccine efficacy against B. abortus 2308, B. melitensis 16M, and B. suis 1330 in a murine brucellosis model. PLoS ONE, 14: e0213587. https://doi.org/10.1371/journal.pone.0213587

Datta AR, Wentz BA, Russell J (1990). Cloning of the listeriolysin O gene and development of specific gene probes for Listeria monocytogenes. Appl. Environ. Microbiol., 56: 3874–3877. https://doi.org/10.1128/aem.56.12.3874-3877

de Figueiredo P, Ficht TA, Rice-Ficht A, Rossetti CA, Adams LG (2015). Pathogenesis and immunobiology of brucellosis: Review of Brucella-host interactions. Am. J. Pathol., 185: 1505–1517. https://doi.org/10.1016/j.ajpath.2015.03.003

de Souza Filho JA, de Paulo Martins V, Campos PC, Alves-Silva J, Santos NV, de Oliveira FS, Menezes GB, Azevedo V, Cravero SL, Oliveira SC (2015). Mutant Brucella abortus membrane fusogenic protein induces protection against challenge infection in mice. Infect. Immun., 83: 1458–1464. https://doi.org/10.1128/IAI.02790-14

Dorneles EM, Sriranganathan N, Lage AP (2015). Recent advances in Brucella abortus vaccines. Vet. Res., 46: 76. https://doi.org/10.1186/s13567-015-0199-7

Du C, Fang M, Li Y, Li L, Wang X (2000). Smac, a mitochondrial protein that promotes cytochrome c-dependent caspase activation by eliminating IAP inhibition. Cell, 102: 33–42. https://doi.org/10.1016/S0092-8674(00)00008-8

Gheibi A, Khanahmad H, Kashfi K, Sarmadi M, Khorramizadeh MR (2018). Development of new generation of vaccines for Brucella abortus. Heliyon, 4: e01079. https://doi.org/10.1016/j.heliyon.2018.e01079

Glomski IJ, Gedde MM, Tsang AW, Swanson JA, Portnoy DA (2002). The Listeria monocytogenes hemolysin has an acidic pH optimum to compartmentalize activity and prevent damage to infected host cells. J. Cell Biol., 156: 1029–1038. https://doi.org/10.1083/jcb.200201081

Goel D, Rajendran V, Ghosh PC, Bhatnagar RJ (2013). Cell mediated immune response after challenge in Omp25 liposome immunized mice contributes to protection against virulent Brucella abortus 544. Vaccine, 31: 1231–1237. https://doi.org/10.1016/j.vaccine.2012.12.043

Grode L, Seiler P, Baumann S, Hess J, Brinkmann V, Eddine AN, Mann P, Goosmann C, Bandermann S, Smith D (2005). Increased vaccine efficacy against tuberculosis of recombinant Mycobacterium bovis bacille Calmette-Guerin mutants that secrete listeriolysin. J. Clin. Investig., 115: 2472–2479. https://doi.org/10.1172/JCI24617

Hess J, Miko D, Catic A, Lehmensiek V, Russell DG, Kaufmann SH (1998). Mycobacterium bovis Bacille Calmette-Guerin strains secreting listeriolysin of Listeria monocytogenes. Proc. Natl. Acad. Sci. USA, 95: 5299–5304. https://doi.org/10.1073/pnas.95.9.5299

Jacob JM, Curtiss R (2021). Characterization of Brucella abortus S19 as a challenge strain for use in a mouse model of brucellosis. Microbes Infect., 23: 104809. https://doi.org/10.1016/j.micinf.2021.104809

Kareem H, Jihad I, Hassan H, Znad M, Harbi M, Lahhob Q, Jasim A (2023). Biochemical and hematological variables in COVID-19 positive patients. Journal of Medicinal and Pharmaceutical Chemistry Research, 5: 609.

Khorramizadeh MR, Gheibi A, Khanahmad H, Kardar GA, Boshtam M, Rezaie S, Kazemi B (2019). Optimization and Comparison of Different Methods and Factors for Efficient Transformation of Brucella abortus RB51strain. Adv. Biomed. Res., 8: 37. https://doi.org/10.4103/abr.abr_14_19

Kim WK, Moon JY, Kim S, Hur J (2016). Comparison between Immunization Routes of Live Attenuated Salmonella Typhimurium Strains Expressing BCSP31, Omp3b, and SOD of Brucella abortus in Murine Model. Front. Microbiol., 7: 550. https://doi.org/10.3389/fmicb.2016.00550

Laemmli UK (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227: 680–685. https://doi.org/10.1038/227680a0

Lee SH, Cheung M, Irani V, Carroll J, Inamine J, Howe W, Maslow J (2002). Optimization of electroporation conditions for Mycobacterium avium. Tuberculosis, 82: 167–174. https://doi.org/10.1054/tube.2002.0335

Lobner D (2000). Comparison of the LDH and MTT assays for quantifying cell death: Validity for neuronal apoptosis? J. Neurosci. Methods, 96: 147–152. https://doi.org/10.1016/S0165-0270(99)00193-4

Mohsen AK, Jassim SE, Alaridhi TT, Al-Erjan AM, Lahhob QR, Mudhafar M (2024). Revolutionizing infectious disease management in animals through advanced phage therapy: a comprehensive strategy for the eradication of multidrug-resistant bacterial pathogens. J. Anim. Health Prod., 12: 157-167. https://dx.doi.org/10.17582/journal.jahp/2024/12.s1.157.167

Monreal D, Moreno E, Moriyón I, Grillo MJ, González D, Marín C, López-Goñi I, Mainar-Jaime RC, Blasco JM (2004). Rough vaccines in animal brucellosis: Structural and genetic basis and present status. Vet. Res., 35: 1–38. https://doi.org/10.1051/vetres:2003037

Motaharinia Y, Rezaee MA, Rashidi A, Jalili A, Rezaie MJ, Shapouri R, Hossieni W, Rahmani MR (2013). Induction of protective immunity against brucellosis in mice by vaccination with a combination of naloxone, alum, and heat-killed Brucella melitensis 16 M. J. Microbiol. Immunol. Infect., 46: 253–258. https://doi.org/10.1016/j.jmii.2012.03.011

Obrani S, Babi F, Maravi-Vlahoviek G (2013). Improvement of pBBR1MCS plasmids, a very useful series of broad-host-range cloning vectors. Plasmid, 70: 263–267. https://doi.org/10.1016/j.plasmid.2013.04.001

Olsen S, Boyle S, Schurig G, Sriranganathan NN (2009). Immune responses and protection against experimental challenge after vaccination of bison with Brucella abortus strain RB51 or RB51 overexpressing superoxide dismutase and glycosyltransferase genes. Clin. Vaccine Immunol., 16: 535–540. https://doi.org/10.1128/CVI.00419-08

Peña-Blanco A, García-Sáez AJ (2018). Bax, Bak and beyond—Mitochondrial performance in apoptosis. FEBS J., 285: 416–431. https://doi.org/10.1111/febs.14186

Pizarro-Cerda J, Moreno E, Gorvel JP (2000). Invasion and intracellular trafficking of Brucella abortus in nonphagocytic cells. Microbes Infect., 2: 829–835. https://doi.org/10.1016/S1286-4579(00)90368-X

Puspitoyani P, Sabdoningrum E, Handijatno D (2020). The Influence of Brucella Abortus Strain RB51 Vaccine Which is Given to the Mice (Mus musculus) and Infected by Local Isolat Brucella Suis for the Figure s of Hepatic Fibrosis of the Mice (Mus musculus). Adv. Anim. Vet. Sci., 8: 208–212. https://doi.org/10.17582/journal.aavs/2020/8.2.208.212

Rao M, Vogelzang A, Kaiser P, Schuerer S, Kaufmann SH, Gengenbacher M (2013). The Tuberculosis Vaccine Candidate Bacillus Calmette-Guérin Δ ureC:: Hly Coexpressing Human Interleukin-7 or-18 Enhances Antigen-Specific T Cell Responses in Mice. PLoS ONE, 8: e78966. https://doi.org/10.1371/journal.pone.0078966

Rieger AM, Nelson KL, Konowalchuk JD, Barreda DR (2011). Modified annexin V/propidium iodide apoptosis assay for accurate assessment of cell death. J. Vis. Exp., 24: e2597. https://doi.org/10.3791/2597

Schurig GG, Sriranganathan N, Corbel MJ (2002). Brucellosis vaccines: Past, present and future. Vet. Microbiol., 90: 479–496. https://doi.org/10.1016/S0378-1135(02)00255-9

Seleem MN, Vemulapalli R, Boyle SM, Schurig GG, Sriranganathan N (2004). Improved expression vector for Brucella species. BioTechniques, 37: 740, 742, 744. https://doi.org/10.2144/04375BM05

Starr T, Ng TW, Wehrly TD, Knodler LA, Celli J (2008). Brucella intracellular replication requires trafficking through the late endosomal/lysosomal compartment. Traffic, 9: 678–694. https://doi.org/10.1111/j.1600-0854.2008.00718

Takebe J, Champagne C, Offenbacher S, Ishibashi K, Cooper L (2003). Titanium surface topography alters cell shape and modulates bone morphogenetic protein 2 expression in the J774A. 1 macrophage cell line. J. Biomed. Mater. Res. Part A, 64: 207–216. https://doi.org/10.1002/jbm.a.10275

Ugalde JE, Comerci DJ, Leguizamón MS, Ugalde RA (2003). Evaluation of Brucella abortus phosphoglucomutase (pgm) mutant as a new live rough-phenotype vaccine. Infect. Immun., 71: 6264–6269. https://doi.org/10.1128/IAI.71.11.6264-6269.2003

Vemulapalli R, He Y, Boyle SM, Sriranganathan N, Schurig GG (2000). Brucella abortus strain RB51 as a vector for heterologous protein expression and induction of specific Th1 type immune responses. Infect. Immun., 68: 3290–3296. https://doi.org/10.1128/IAI.68.6.3290-3296.2000

Vemulapalli R, He Y, Cravero S, Sriranganathan N, Boyle SM, Schurig GG (2000). Overexpression of protective antigen as a novel approach to enhance vaccine efficacy of Brucella abortus strain RB51. Infect. Immun., 68: 3286–3289. https://doi.org/10.1128/IAI.68.6.3286-3289.2000

Yazdi HS, Kafi M, Haghkhah M, Tamadon A, Behroozikhah A, Ghane M (2009). Abortions in pregnant dairy cows after vaccination with Brucella abortus strain RB51. Vet. Rec., 165: 570. https://doi.org/10.1136/vr.165.19.570

Zamri-Saad M, Kamarudin MI (2016). Control of animal brucellosis: The Malaysian experience. Asian Pac. J. Trop. Med., 9: 1136–1140. https://doi.org/10.1016/j.apjtm.2016.11.007

Zhu J, Larson CB, Ramaker MA, Quandt K, Wendte JM, Ku KP, Chen F, Jourdian GW, Vemulapalli R, Schurig GG (2011). Characterization of recombinant B. abortus strain RB51SOD toward understanding the uncorrelated innate and adaptive immune responses induced by RB51SOD compared to its parent vaccine strain RB51. Front. Cell. Infect. Microbiol., 1: 10. https://doi.org/10.3389/fcimb.2011.00010