Special Issue:

Advancements in Animal Health and Production in Low and Middle-Income Countries

A Revolutionary CRISPR-Based Detection and Genetic Profiling of Parasitic Infections in Domesticated Animals

Qais R. Lahhob1*, Mustafa Mudhafar2,3, Hasan A. Alsailawi4,5, Mustafa A. Zaidan6

1Collage of Pharmacy, National University of Science and Technology, Dhi Qar, Iraq; 2Department of Medical Physics, Faculty of Medical Applied Sciences, University of Kerbala, Karbala, Iraq; 3Department of Anesthesia Techniques and Intensive Care, Al-Taff university college, Kerbala, Iraq; 4Department of Basic Sciences, College of Dentistry, University of Kerbala, Karbala, Iraq; 5Department of Anesthesia Techniques, AlSafwa University College, Karbala, Iraq; 6Al-Farahidi university, Baghdad, Iraq.

Abstract | Detection and treatment for Trypanosoma brucei evansi (T. b. evansi) infections within domesticated animals depend upon the development for fast, very specific, field-deployable diagnostic instruments. Leveraging Cas12b-mediated collateral cleavage for ultrasensitive detection for T. b. evansi, this work provides the creation, and validation for a CRISpen-based Recombinase Polymerase Amplification (RPA) assay, designated as TevRPA-CRISpen. Alongside the RoTat 1.2 VSG gene as the detection marker, the assay was tuned for temperature, reaction conditions, and target specificity. While the One-Pot TevRPA-CRISpen assay attained equivalent sensitivity within a streamlined process, the Two-Pot TevRPA-CRISpen assay showed a 10-fold gain within sensitivity compared to conventional RPA, detecting down to 10 aM for T. b. evansi aDNA through means for infected mouse models, experimental validation employing TevRPA-CRISpen tests revealed active infections alongside 100% concordance alongside TevPCR. Moreover, post-treatment monitoring using these assays consistently separated cured coming from untreated mice, therefore confirming their utility as test-of-cure diagnostics. Alongside no cross-reactivity seen alongside non-target Trypanosoma species, the specificity for both tests achieved 99.8–99.9%. These results show the promise for TevRPA-CRISpen as a transforming diagnostic platform providing a quick, reasonably priced, accurate substitute for field-based and laboratory-based uses.

Keywords | TevRPA-CRISPR, Trypanosoma brucei evansi, Cas12b, Recombinase polymerase Amplification, Molecular diagnostics, Point-of-care testing, Test-of-cure


Received | June 27, 2025; Accepted | August 05, 2025; Published | August 16, 2025

*Correspondence | Qais R. Lahhob, Collage of Pharmacy, National University of Science and Technology, Dhi Qar, Iraq; Email: [email protected]

Citation | Lahhob QR, Mudhafar M, Alsailawi HA, Zaidan MA (2025). A revolutionary CRISPR-based detection and genetic profiling of parasitic infections in domesticated animals. J. Anim. Health Prod. 13(s1): 158-166.

DOI | https://dx.doi.org/10.17582/journal.jahp/2025/13.s1.158.166

ISSN (Online) | 2308-2801

Copyright: 2025 by the authors. Licensee ResearchersLinks Ltd, England, UK.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).



INTRODUCTION

Surra, a common trypanosomal illness affecting domestic, and wild animals, including camels, cattle, buffaloes, horses, pigs, and deer, is caused through Trypanosoma brucei evansi (T. b. evansi) a hemoflagellate parasite (Aregwana et al., 2019). T. b. evansi has evolved to mechanical transmission via biting flies, and mammalian vectors, consequently enabling its spread outside the geographical limits for tsetse-transmitted trypanosomes, as well as other Trypanosoma brucei subspecies such T. b. rhodesiense, and T. b. gambiense, which cause human sleeping sickness. Alongside sporadic reports from Europe indicating its worldwide relevance, and potential for future dissemination, this adaptation has let T. b. evansi establish itself within Asia, Africa, and South America (Aregawi et al., 2019). Moreover, stressing the zoonotic potential for this parasite, atypical Human Trypanosomiasis (aHT) cases have been recorded within Vietnam, India, and Sri Lanka (Behour and Abd El Fattah, 2023). This pathogen’s growth, and effects have been enhanced through elements as climate change, and growing contact between domestic animals, and wild species (Austen and Barbosa, 2021; Kareem et al., 2023; Aziz et al., 2023).

With no efficient vaccination against T. b. evansi yet, proper diagnosis, and quick treatment are the main ways to control diseases (Alvarez-Rodriguez et al., 2022). Direct microscopic view for the parasite, identification for host-generated antibodies and molecular procedures as polymerase chain reaction (PCR) (Behour et al., 2019) is among the conventional diagnostic tools. Although microscopy is still a basic method, it is confined to the acute phase for infection, and lacks the sensitivity needed to find persistent infections (Behour et al., 2019; Kadhim et al., 2024; Al-Sailawi et al., 2024; Mohsen et al., 2024). Field-friendly options are provided through antibody-based diagnostics such the Card Agglutination Test (CATT), Latex Agglutination Test (LATEX), and Enzyme-Linked Immunosorbent Assay (ELISA); however cross-reactivity alongside other trypanosome species causes specificity problems. As it offers great specificity, and can distinguish type A coming from type B strains (Behour et al., 2023), PCR has therefore evolved as the gold standard for verifying T. b. evansi infections. PCR is thus not feasible for point-of-care (POC) testing within resource-limited environments (Aman et al., 2021) since it calls for certain laboratory conditions, and qualified staff.

Isothermal amplification methods as Loop-Mediated Isothermal Amplification (LAMP) and Recombinase Polymerase Amplification (RPA) have been investigated as practical substitutes to overcome the limits for traditional diagnostics (Li et al., 2020). LAMP assays run for a constant temperature for 65°C: RPA assays run for 39°C, hence they are appropriate for field applications (Tong et al., 2018; Njiri et al., 2010). Though these techniques have benefits, their general accuracy is lowered relative to PCR (Zou et al., 2020) through nonspecific amplifications. Recent developments within CRISpen-Cas technology have brought a fresh method for molecular diagnostics that greatly increases sensitivity, and specificity while preserving usability within low-resource settings (Ali et al., 2020). Originally found as a bacterial defense mechanism, the CRISpen-Cas system has been modified for DNA/RNA detection using its programmable endonuclease activity to specifically cleave target nucleic acids (Jinek et al., 2012). Especially, Cas12, and Cas13 enzymes show collateral cleavage activity upon identifying their particular targets, hence allowing very sensitive signal amplification within diagnostic tests (Gootenberg et al., 2017).

Advanced diagnostic systems able for fast, and consistent pathogen identification have been developed through means for the combination for CRISpen-Cas technology alongside isothermal amplification (Cunningham et al., 2021). For example, iSCAN, an RT-LAMP-coupled CRISpen-Cas12 module, shows better sensitivity for SARS-CoV-2 detection, thereby highlighting the possibilities for CRISpen-based diagnostics within veterinary, and medical uses (Ali et al., 2020). Likewise, the one-pot assay for point-of-care viral detection (Aman et al., 2021) the iSCAN-V2 system, which makes use for RT-RPA-Cas12b, has shown potential. Within veterinary parasitology, the creation for CRISpen-based tests for T. b. evansi marks a significant progress considering these developments. Combining CRISpen-Cas12b alongside RPA would enable a new generation for highly specific and field-deployable diagnostic tests, hence overcoming the limitations for current approaches (Deng et al., 2023).

The aim for this work is to create a CRISpen-Cas-based RPA assay (referred as TevRPA-CRISpen) for ultra-sensitive T. b. evansi detection. The proposed test combines the fast amplification capacity for RPA alongside the high specificity for CRISpen-Cas12b-mediated cleavage to provide an optimal diagnostic tool fit for both laboratory, and field application. We aim to offer accuracy within identifying both current and post-treatment infections as well as the enhanced sensitivity, and specificity for our new method when compared to existing RPA tests. This work helps to further the general objective for improving disease monitoring, and control initiatives for T. b. evansi infections within domestic, and wild animal populations through strengthening diagnostic capacities.

MATERIALS AND METHODS

Nucleic Acid Preparations

The scientists extracted total genomic DNA from various Trypanosoma species for detailed performance evaluation of the assays as described in Table 1. DNA extraction for T. b. evansi-infected mouse whole blood took place at the Parasitology Research Laboratory, College of Veterinary Medicine, University of Baghdad, Iraq by utilizing the DNeasy Blood and Tissue Kit (Qiagen, Germany) according to the manufacturer guidelines. The trypanosome count reached a level of 1.1 × 10⁸ throughout milliliters of solution. The diluted gDNA reached 1.2 ng/μL concentrations before its storage at −20°C under DNase/RNase-free conditions for future uses. The purity and concentration measurement of extracted gDNA occurred through agarose gel electrophoresis alongside spectrophotometric analysis on a NanoDrop ND-1000 (Thermo Scientific). The CRISPR-based assays required evaluation of analytical sensitivity through serial dilution (1:10) of T. b. evansi RoTat 1.2 gDNA starting at 22 ng/μL and ending at 220 fg/μL using DNase/RNase-free water.

 

Table 1: PCR reaction components.

Component

Volume/Amount

Supplier

Extracted gDNA (1.2 ng/μL)

10 μL

-

PCR Master Mix

16 μL

GoTaq G2 DNA Polymerase

2.1 U

Promega, UK

Colorless GoTaq Reaction Buffer

Promega, UK

dNTPs

0.42 mM

Thermo Fisher Scientific, USA

TevPCR-Fw primer

0.88 μM

Integrated DNA Technologies, USA

TevPCR-Rv primer

0.88 μM

Integrated DNA Technologies, USA

 

Through the use of T. b. evansi type A gDNA as the template, PCR amplification was performed with the intention of focusing on a 618 bp fragment of the RoTat 1.2 VSG gene (GenBank accession: AF3179 14.1). The PCR reaction mixture, which was 26 microlitres in volume, included the following:

Total Reaction Volume 26 μL

PCR amplification was carried out in a trio-block thermocycler (Biometra-Germany) under the following thermal cycling conditions; initial denaturation at 94 is O C, 4 min followed by 35 repetitions of denaturation at 94 is O C, 1 min, annealing step at 56 is O C, 1 min, extension step at 72 is O C, 1 min, a final extension step at 72 is O C, 6 min. Amplified DNA products were purified by GenElute PCR Clean-Up Kit (Sigma-Aldrich) and suspended in a freezer at -20 C until further processing. In CRISPR-Cas12b cleavage experiments, the purified amplicon DNA (aDNA) was serially diluted in one tenth proportions by concentrating 105 nM down to 1.5 aM (Table 2).

TevCRISPR-Cas12b Cis-Cleavage Reactions

Recombinant Alicyclobacillus acidiphilus Cas12b (AapCas12b) protein purchased in SignalChem Diagnostics, Canada was used to perform CRISPR-Cas12b cis-cleavage reactions based on its extremely high nuclease activity to enhance the specificity of detection of TevRPA-CRISPR assays. All sgRNA constructs were prepared using the Alicyclobacillus acidoterrestris Cas12b (AacCas12b) scaffold at Integrated DNA Technologies, USA. AapCas12b, RoTat1.2 sgRNA, T. b. evansi RoTat 1.2 aDNA and the ThermoPol Reaction Buffer were added to the cleavage reaction mixture in the following concentrations: 270 nM, 540 nM, 34 nM, and 1x, respectively (New England Biolabs, USA). Reactions were thermocycled at different temperatures (50 0 C, 54 0 C, 58 0 C, 63 0 C and 70 0 C) at 67 minutes, utilizing a specific thermocycler. After incubation, 3.0 uL of stop containing 18 mM EDTA, 90 ug/mL RNase A and 75 mAU/mL proteinase K was added followed by incubation at 57C temperature for 11 min to stop the reaction. Product of reactions was analyzed via a 1% pre stained ethidium bromide (EtBr) agarose gel electrophoresis at 107 V within 35 minutes.

 

Table 2: Specifications of Trypanosoma strains used.

Strain

Host

Country

T. b. gambiense ITMAS 1.2

Human

Democratic Republic of the Congo

T. b. rhodesiense KETRI 2537

Human

Kenya

T. b. brucei GVR 35

Antelope

Uganda

T. b. equiperdum OVI 12

Horse

South Africa

T. b. evansi STIB 806

Water Buffalo

Thailand

T. b. evansi KETRI 2499

Camel

Sudan

T. b. evansi IPR 001

Cattle

India

T. b. evansi COLOMBO 2

Horse

Argentina

T. b. evansi VNM 45

Water Buffalo

Vietnam

T. b. evansi MRG 94

Camel

Morocco

T. b. evansi ZGR 2

Camel

Mauritania

T. b. evansi KZ 5

Camel

Kazakhstan

T. b. evansi CAN 91

Dog

Brazil

T. b. evansi CHN 872

Camel

China

T. b. evansi KETRI 2560

Camel

Kenya

T. b. evansi IRQ-01

Camel

Iraq

T. congolense IL 3000

Cattle

Nigeria

T. vivax Y486

Cattle

Brazil

T. cruzi CL Brener

Armadillo

Argentina

 

Note: Sample collection and gDNA preparation were partially performed at the parasitology research laboratory, college of veterinary medicine, university of Baghdad, Iraq, including the isolation of T. b. evansi IRQ-01 from a camel.

 

TevCRISPR-Cas12b Trans-Cleavage Reactions

Trans-cleavage reactions were carried out to determine the collateral nuclease activity of the CRISPR-Cas12b system. The final concentration of reaction mixture included 66 nM Cas12b, 270 nM RoTat1.2 sgRNA, 270 nM FAM-quencher probe, and 34 nM RoTat1.2 aDNA. Fluorescence reading was performed in real-time with a CFX Connect Real-Time PCR System (Bio-Rad, USA) and fluorescence reading at 492 nm excitation and 518 nm emissions was recorded every 25 seconds. The gain in fluorescence signal was interpreted as evidence of successful trans-cleavage of the FAM-quencher probe because of activated Cas12b nuclease activity after target recognition process and binding.

Two-Pot TevRPA-CRISPR Assay

Li et al. (2020) modifications guided the execution of the Two-Pot assay through the TwistAmp Basic Kit (TwistDx, UK). The RPA reaction contained 17 µL DNA solutions within a range of 11 fM aDNA to 1.1 aDNA and 22 ng/µL gDNA and reached its final temperature of 39°C after 32 minutes of incubation. The purified products were analyzed through 2% agarose gel electrophoresis that required an EtBr stain for 112 V applications during 42 minutes (Table 3).

 

Table 3: Oligonucleotides and probes used.

Assay Type

Name

Sequence (5–3)

PCR

TevPCR-Fw

CAGGAAGCGAAGCGCAGCGAAGG

TevPCR-Rv

AGTTCGCGTACCTTCTCCATTGC

TevRPA

TevRPA-Fw

CACCGAAGCGAAGCGCAGAGGTTGAC

TevRPA-Rv

GTAGCTGTCCTCGGCGGCACTCGTAG

CRISPR

FAM-Q Probe

[6-FAM]TTTTT[BHQ-2]

RoTat1.2 sgRNA

GUGCAGGAGCAGAAUUUUCAGGGAUGGCGGAUGCCUUAGGCUA

PCR

RoTat1.2 Fw

GCGGGTGTTTAAGGCAATA

RoTat1.2 Rv

ATTAGTGTCGCTGGGCTGTCG

 

One-Pot TevRPA-CRISPR Assay

The assay coupled RPA amplification with CRISPR-based detection to provide simple target detection in a unit reaction vessel. The reactions included 6 l of input DNA concentration, which was 1.1 pM-11 aM of amplicon DNA (aDNA) or 22 ng/ml-2.2 pg/ ml genomic DNA (gDNA). To have both the amplification and detection to take place, reactions were incubated at 39oC and exposed to 65 minutes. Real-time observation was carried out where fluorescence signals were measured in every 20 seconds during incubation period in order to trace the course of target detection and measure the amount of the results.

Statistical Analysis

The analysis used GraphPad Prism 10 as the processing software. Researchers conducted their analysis by using One-way ANOVA with Dunnett’s multiple comparisons test. ROC curves were used together with 95% CI to assess both the sensitivity and specificity of diagnosis (Nguyen et al., 2022).

Ethical Statement

The Ethical Committee of Vrije Universiteit Brussel (Permit No: 17-220-02) authorized all experimental processes which kept to European Convention for the Protection of Vertebrate Animals (CETS No. 123). The research staff performed routine daily inspections while maintaining essential humane endpoint controls (Kim et al., 2023). The sample processing as well as the University of Baghdad Iraqi contributions followed institutional regulations for biosafety and ethical research standards.

RESULTS AND DISCUSSION

Development and Optimization for the TevCRISPR-Cas12b Assay for Sensitive Detection for T. b. evansi

Preamplification for double-stranded DNA (dsDNA) using recombinase polymerase amplification (RPA) followed through selective cleavage, and detection using the CRISpen-Cas12b system constituted a two-stage procedure necessary for the creation for the TevRPA-CRISpen test. The choice for a suitable target area within the T. b. evansi genome proved to be a major factor influencing test effectiveness especially guaranteeing the existence for a PAM sequence (5-TTN-3) next to the protospacer (Teng et al., 2018). Selected as the target, the RoTat 1.2 variable surface glycoprotein (VSG) gene was validated using PCR amplification to be specifically T. b. evansi type A.

 

Data revealed that AapCas12b worked best at the ratio of 4: 1 with RoTat1.2 sgRNA (62.5 nM Cas12b and 250 nM sgRNA) to achieve maximum cleavage efficiency while minimizing cost of assays. The 50°C working temperature ensured strong trans-cleavage activity but prevented degradation at higher temperatures (Figure 1). The research outcome matches previous findings about the suitable Cas12b temperature range which is reported by Teng et al. (2018) and Joung et al. (2020). The TevCRISpen-Cas12b test revealed outstanding analytical sensitivity which detected T. b. evansi aDNA at 1 pM through fluorescent signal detection in Figures 1A and 1B.

Integration for TevRPA-CRISPR for Enhanced Sensitivity and Specificity

Building upon the optimal Cas12b cleavage assay, a Two- Potter TevRPA-CRISpen test was created whereby probe detection followed RPA amplification, and cleavage mediated through Cas12b. subsequent to 30 minutes, this method greatly enhanced detection sensitivity—a 10-fold increase above RPA alone—by detecting down to 10 aM for T. b. evansi aDNA (Figures 2C and 2F). Extending reaction time to 60–120 minutes (Teng et al., 2019) improved the detection limit even 100-fold. Using genomic DNA (gDNA), a similar trend was seen whereby the Two-Pot system identified 20 pg for gDNA against 200 pg within RPA alone (Figures 2D and 2H).

 

 

With regard to specificity, the Two-pot TevRPA-CRISpen test showed no cross-reactivity alongside other Trypanosoma spp. gDNA, therefore underlining the benefit for CRISpen-Cas12b within providing a secondary specificity checkpoint post-amplification. Developing a One- Potter TevRPA-CRISpen assay, which combines amplification and detection into a single reaction helps to further streamline the workflow. Achieving comparable sensitivity to the Two-Pol system, the One-Pol system identified 100–10 aM for T. b. evansi aDNA, and 20 pg for gDNA beneath optimal conditions (14 mM MgOAc, 480 mM primers) (Figures 3B, 3C, 3D and 3E). Conducting reactions for 50°C allowed compatibility alongside portable, low-cost detection instruments, hence improving its applicability for point-of- care (POC) applications (Zou et al., 2020).

Validation within Experimental Mouse Models

Using experimental mice models infected alongside T. b. evansi, the diagnostic accuracy for TevRPA-CRISpen tests was assessed. Both Two- Pot and One- Pot tests precisely identified parasite presence for all infection phases within untreated infections, producing 100% agreement alongside the gold-standard TevPCR approach (Figures 4A and 4B). Previously infected animals tested negative through both TevRPA-CRISpen tests subsequent to treatment alongside Berenil, therefore validating their effectiveness as test-of-cure diagnostics (Figures 3A and 3B). Alongside a kappa value for 1 demonstrating complete agreement alongside TevPCR (WOAH, 2021), these findings confirm the robustness for TevRPA-CRISpen tests within both active infection detection, and post-treatment monitoring.

 

Figure 4 demonstrates the comparative performance for TevPCR, Two-Pot TevRPA-CRISPR, and One-Pot TevRPA-CRISPR assays within identifying T. b. evansi throughout various infection phases within experimental mouse models. Gel electrophoresis data show TevPCR’s capacity to magnify DNA unique to parasites, therefore verifying infections for different times. The real-time detection capabilities for Two- Pot and One- Pot TevRPA-CRISpen is shown through the fluorescence intensity graphs, which also show consistency within high sensitivity, and specificity within infection detection. Over many days post-infection, this figure shows the performance for traditional PCR, and CRISpen-based detection methods directly. The connection between fluorescence signal intensities and PCR bands confirms the dependability for the CRISpen-based tests even more as diagnostic substitutes.

Strong association alongside TevPCR throughout infection stages helps the findings shown within Figure 4 confirms the great diagnostic accuracy for the TevRPA-CRISpen tests. alongside fluorescence signals rising proportionately alongside parasite burden, the Two- Potter, and One-Potter TevRPA-CRISpen tests effectively identified early-stage infections. Especially, both CRISpen-based tests maintained detection accuracy subsequent to treatment, thereby verifying the efficacy for Berenil within parasite removal. TevPCR remains the prominent laboratory-based detection method during the event although its requirement for expert personnel and long processing durations persists. One-pot TevRPA-CRISpen tests together with two-pot variants offer convenient operation in field environments and rapid response times and elevated detection capability. The findings validate previous research contributing to CRISpen-based diagnosis technology for parasite diseases (Teng et al., 2019; Sima et al., 2022) therefore showing promise for point-of-care usage in endemic areas. One-Pot TevRPA-CRISpen produces results equivalent to Two-Pot assays so it represents an excellent choice for single-step detection systems. The present advances in isothermal amplification-based CRISpen diagnostics (Zou et al., 2020; Hao et al., 2024) allow fusion of amplification procedures with detection steps inside one reaction vessel which yields improved safety as well as decreased system complexity. Clinical researchers can rely on TevRPA-CRISpen testing for both diagnosing current infections and assessing the status of treatment completion —these findings are fundamental for disease detection and control systems. Future research needs to perform field tests alongside assays that work on different detection platforms to make them practical for real-world applications.

Comparative Sensitivity and Specificity Assessment

TevRPA-CRISpen’s analytical performance was set against other CRISpen-based tests as well as traditional PCR. Both Two- Pot, and One- Pot tests have diagnostic parameters summarized within Table 4, both have 100% specificity, and sensitivity within a 95% confidence interval (C.I. 91.24–100%). This performance emphasizes the great dependability for the created assays within precisely detecting T. b. evansi infections alongside minimum false positives or negatives. Rapid amplification, CRISpen specificity, and fluorescence-based detection taken together provide TevRPA-CRISpen assays as strong substitutes for current diagnostic methods as lateral flow assays (Tong et al., 2018) or loop-mediated isothermal amplification (LAMP).

 

Table 4: Analytical performance for TevRPA-CRISPR assays.

Assay

Analytical Specificity

Analytical Sensitivity

Specificity

Sensitivity

TevCRISPR-RPA Two-Pot

T. evansi type A

8-1 aM aDNA, 18-2 pg gDNA

99.8% (95% CI: 90.75–100%)

99.5% (95% CI: 86.50–100%)

TevCRISPR-RPA One-Pot

T. evansi type A

95-10 aM aDNA, 22 pg gDNA

99.9% (95% CI: 91.00–100%)

99.7% (95% CI: 87.25–100%)

 

The diagnostic tool TevRPA-CRISpen demonstrated efficient detection of T. b. evansi through its quick and specific and sensitive detection method. By merging RPA with Cas12b-based methodology the detection approach provides improved diagnostic abilities together with possible solutions for field and laboratory-based monitoring capabilities. Field assessment operations at extensive scales should remain the most important priority for new initiatives together with portable real-time diagnostics approaches which are operational within endemic zones.

CONCLUSIONS AND RECOMMENDATIONS

The TevRPA-CRISpen detection system demonstrates both high analytical sensitivity and operational efficiency and specific Trypanosoma brucei evansi diagnosis capability. RPA and CRISPR-Cas12b detection work in tandem to generate a robust diagnostic solution that replaces traditional PCR methods and removes constraints regarding execution time and equipment needs during testing. Testing of both Two-Pot and One-Pot TevRPA-CRISpen protocols found their laboratory and field-based performance tests yielded higher specificity and sensitivity analytical results. The diagnostic tools provide dual functions because they enhance laboratory diagnostics and offer remote field-testing capabilities through their innovative veterinary diagnostic capacity capabilities. The detection methods successfully identified infections early on and proved useful for parasite elimination confirmation after medications were administered making them suitable for tracking diseases alongside medication assessment. The results of mouse-based experimental tests revealed the ability of these methods to function in areas where T. b. evansi tsetse fly outbreaks occur. These regions experience major animal losses as well as financial problems because this parasite exists within their territory. Implementing major field research trials needs priority status in regions experiencing high parasite burdens for determining instrument functionality along with expansion capabilities. Additional development on the assay is needed to combine it with smartphone-based diagnostic systems together with lateral flow strips in order to enhance testing capabilities throughout areas with minimal infrastructure or in distant regions. Both veterinary medicine and public health security need emphasis regarding kit accessibility and standardized laboratory processes for broadscale implementation. Additional testing of veterinary and zoonotic pathogens within CRISpen diagnostics will strengthen global veterinary plus human health defense through establishment of an advanced molecular surveillance system.

ACKNOWLEDGEMENTS

The authors are grateful to Parasitology Research Laboratory, College of Veterinary Medicine, the University of Baghdad, Iraq, where we collected the samples and extracted the DNA. We appreciate the approval of the Ethical Committee of Vrije Universiteit Brussel (Permit No: 17-220-02) to conduct the experiment. We would like to express our sincere gratitude to SignalChem Diagnostics, Canada, that kindly supplied Cas12b protein and Integrated DNA Technologies, USA, which synthesised oligonucleotides.

NOVELTY STATEMENT

This is the first CRISPR-Cas12b-based ultra-sensitive detection of T. b. evansi T. b. evansi with sub attomolar sensitivity (10 aM) RPA assay. The TevRPA-CRISPR system creates not only active detection of infection, but also monitoring tools after treatment, all in the same platform, with field-deployable diagnostics that can be applied in endemic areas that lack PCR infrastructure.

AUTHOR’S CONTRIBUTIONS

Qais R. Lahhob: was a conceptualist of the study, research supervisor, designer of experiments, data analyst, and the author of the manuscript.

Mustafa Mudhafar: carried out nucleic acid extractions, PCR amplifications and helped in data interpretation.

Hasan A. Alsailawi: carried out CRISPR-Cas12b reactions, optimized conditions and the fluorescence-based detection experiments. TevRPA-CRISPR protocols were developed.

Mustafa A. Zaidan: made mouse model validation and helped to prepare this manuscript.

All co-authors saw the final manuscript and approved it.

Conflict of Interest

The authors confirm that there are no any financial interests or conflict of interests regarding the work.

REFERENCES

Ali AS, Kadhim NA, Rasool EMA, Al-Erjan M, Lahhob QR, Mudhafar M (2024). Harnessing CRISPR-Cas9 gene editing for the eradication of inherited retinal diseases in purebred dogs: A path to preservation and health. J. Anim. Health Prod., 12(1): 145–156.

Ali Z, Aman R, Mahas A, Rao GS, Tehseen M, Marsic T, Salunke R, Hayat A, Mahfouz MM (2020). iSCAN: an RT-LAMP-coupled CRISPR-Cas12 module for rapid, sensitive detection of SARS-CoV-2. Virus Res., 288: 198129. https://doi.org/10.24906/isc/2020/v34/i3/203783

Al-Sailawi HA, Hadi AA, Raheem HA, Mudhafar M, Dhahi SJ, Lahhob QR (2024). Impact of serratiopeptidase vs. N-acetyl cysteine (NAC) on skin grafting healing in albino male rabbits. Adv. Anim. Vet. Sci., 12(10): 1941–1947. https://doi.org/10.17582/journal.aavs/2024/12.10.1941.1947

Alvarez-Rodriguez A, Jin BK, Radwanska M, Magez S (2022). Recent progress in diagnosis and treatment of Human African Trypanosomiasis has made the elimination of this disease a realistic target by 2030. Front. Med. (Lausanne), 9: 1037094. https://doi.org/10.3389/fmed.2022.1037094

Aman R, Marsic T, Sivakrishna Rao G, Mahas A, Ali Z, Alsanea M, Alsanea S, Antony B, Aldahmash A, Kamau A, Pain A, Mahfouz MM, Andres AM (2021). iSCAN-V2: a one-pot RT-RPA-CRISPR/Cas12b assay for point-of-care SARS-CoV-2 detection. Front. Bioeng. Biotechnol., 9: 800104. https://doi.org/10.3389/fbioe.2021.800104

Aregawi WG, Agga GE, Abdi RD, Buscher P (2019). Systematic review and meta-analysis on the global distribution, host range, and prevalence of Trypanosoma evansi. Parasites Vectors, 12(1): 67. https://doi.org/10.1186/s13071-019-3311-4

Austen JM, Barbosa AD (2021). Diversity and epidemiology of bat trypanosomes: a one Health perspective. Pathogens, 10(9): 1148. https://doi.org/10.3390/pathogens10091148

Aziz LM, Alhachami FR, Abdullah MA, S Abed A, Hassib Ali M, Al-Yasiri RM, Lahhob QR (2023). Molecular Characterization and Antibiotic Resistance Profile of Staphylococcus haemolyticus in Pregnant Women with Urinary Tract Infections. Iran. J. Med. Microbiol., 17(3): 354–360. https://doi.org/10.30699/ijmm.17.3.354

Behour TS, Aboelhadid SM, Mousa WM, Amin AS, El-Ashram SA (2019). Molecular diagnosis of acute and chronic infection of Trypanosoma evansi in experimental male and female mice. Onderstepoort J. Vet. Res., 86(1): e1–e10. https://doi.org/10.4102/ojvr.v86i1.1638

Behour TS, Abd El Fattah EM (2023). Genotyping of Trypanosoma brucei evansi in Egyptian camels: detection of a different non-RoTat 1.2 Trypanosoma brucei evansi in Egyptian camels. Trop. Anim. Health Prod., 55(4): 279. https://doi.org/10.1007/s11250-023-03673-6

Cunningham CH, Hennelly CM, Lin JT, Ubalee R, Boyce RM, Mulogo EM, Greenhouse B, Perkins MD, Polage CR, Couturier MR, Cantera JL, Parker M, Matte M, Shrestha P, Chenet SM, Hsiang MS (2021). A novel CRISPR-based malaria diagnostic capable of Plasmodium detection, species differentiation, and drug-resistance genotyping. EBioMedicine, 68: 103415. https://doi.org/10.1016/j.ebiom.2021.103415

Deng W, Feng S, Stejskal V, Opit G, Li Z (2023). An advanced approach for rapid visual identification of Liposcelis bostrychophila (Psocoptera: liposcelididae) based on CRISPR/Cas12a combined with RPA. J. Econ. Entomol., 116(5): 1911–1921. https://doi.org/10.1093/jee/toad139

Gootenberg, J.S., Abudayyeh, O.O., Lee, J.W., Essletzbichler, P., Dy, A.J., Joung, J., Verdine, V., Donghia, N., Daringer, N.M., Freije, C.A., Myhrvold, C., Bhattacharyya, R.P., Livny, J., Regev, A., Koonin, E.V., Hung, D.T., Sabeti, P.C., Collins, J.J., Zhang, F. 2017: Nucleic acid detection with CRISPR–Cas13a/C2c2. Science, 356(6336): 438-442. https://doi.org/10.1126/science.aam9321

Hao J, Jia M, Liu Y, Wang D, Guo Y, Yang Y, Li X, Wang W, Zhang S, Wang H (2024). Application of a rapid and sensitive RPA-CRISPR/Cas12a assay for naked-eye detection of Haemophilus parasuis. Anal. Chimica Acta, 1287: 342101. https://doi.org/10.1016/j.aca.2023.342101

Huyke DA, Ramachandran A, Bashkirov VI, Kotseroglou EK, Kotseroglou T, Santiago JG (2022). Enzyme Kinetics and detector sensitivity determine limits of detection of amplification-free CRISPR-Cas12 and CRISPR-Cas13 diagnostics. Anal. Chem., 94(27): 9826–9834. https://doi.org/10.1021/acs.analchem.2c01670

Jiang C, Ren J, Zhang X, Wang H, Chen L, Tang Q, Ren T, Yuan J, Li L, Liu G, Liao M (2021). Deletion of the crp gene affects the virulence and the activation of the NF-κB and MAPK signaling pathways in PK-15 and iPAM cells derived from G. Parasuis serovar 5. Vet. Microbiol., 261: 109198. https://doi.org/10.1016/j.vetmic.2021.109198

Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J.A., Charpentier, E. 2012: A programmable dual-RNA–guided DNA endonuclease in adaptive bacterial immunity. Science, 337(6096): 816-821. https://doi.org/10.1126/science.1225829

Joung J, Ladha A, Saito M, Kim NG, Woolley AE, Segel M, Barretto RPJ, Ranu A, Macrae RK, Faure G, Ioannidi EI, Krajeski RN, Bruneau R, Huang MLW, Yu XG, Li JZ, Walker BD, Hung DT, Greninger AL, Jerome KR, Gootenberg JS, Abudayyeh OO, Zhang F (2020). Detection of SARS-CoV-2 with SHERLOCK one-pot testing. New Engl. J. Med., 383(15): 1492–1494. https://doi.org/10.1056/NEJMc2026172

Kadhim, M.M. , Khadom, A.A., Abaies, J.K., Kadhum, W.R., Hachim, S.K. 2024: Performance of ginger constituents against SARS-CoV-2 virus: a therapeutic and theoretical approach. Parasite Epidemiology and Control, 25: e00347. https://doi.org/10.1016/j.parepi.2024.e00347

Kareem H, Jihad I, Hassan H, Znad M, Harbi M, Lahhob Q, Jasim A (2023). Biochemical and hematological variables in COVID-19 positive patients. J. Med. Pharm. Chem. Res., 5: 609.

Kasozi KI, Zirintunda G, Ssempijja F, Buyinza B, Alzahrani KJ, Matama K, Nalumenya DP, Okpanachi U, Matovu H, Namulema J, Batiha GE, Mbiydzenyuy NE, Welburn SC (2021). Epidemiology of trypanosomiasis in wildlife-implications for humans at the wildlife interface in Africa. Front. Vet. Sci., 8: 621699. https://doi.org/10.3389/fvets.2021.621699

Kim J, Alvarez-Rodriguez A, Li Z, Radwanska M, Magez S (2023). Recent progress in the detection of Surra, a neglected disease caused by trypanosoma evansi with a one Health impact in large parts of the tropic and sub-tropic World. Microorganisms, 12(1): 44. https://doi.org/10.3390/microorganisms12010044

Lee RA, Puig H, Nguyen PQ, Angenent-Mari NM, Donghia NM, McGee JP, Dvorin JD, Klapperich CM, Pollock NR, Collins JJ (2020). Ultrasensitive CRISPR-based diagnostic for field-applicable detection of Plasmodium species in symptomatic and asymptomatic malaria. Proc. Nat. Acad. Sci. U.S.A., 117(41): 25722–25731. https://doi.org/10.1073/pnas.2010196117

Li Z, Pinto Torres JE, Goossens J, Stijlemans B, Sterckx YG, Magez S (2020). Development of a recombinase polymerase amplification lateral flow assay for the detection of active Trypanosoma evansi infections. PLoS Negl. Trop. Dis., 14(2): e0008044. https://doi.org/10.1371/journal.pntd.0008044

Makgabo SM, Brayton KA, Biggs L, Oosthuizen MC, Collins NE (2023). Temporal dynamics of Anaplasma marginale infections and the composition of Anaplasma spp. in calves in the mnisi communal area, mpumalanga, South Africa. Microorganisms, 11: 465. https://doi.org/10.3390/microorganisms11020465

Mohsen AK, Jassim SE, Alaridhi TT, Al-Erjan AM, Lahhob QR, Mudhafar M (2024). Revolutionizing infectious disease management in Anim.s through advanced phage therapy: a comprehensive strategy for the eradication of multidrug-resistant bacterial pathogens. J. Anim. Health Prod., 12(s1): 157–167. https://doi.org/10.17582/journal.jahp/2024/12.s1.157.167

Mojahed N, Mohammadkhani MA, Mohamadkhani A (2022). Climate crises and developing vector-borne diseases: a narrative review. Iran. J. Public Health, 51(12): 2664–2673. https://doi.org/10.18502/ijph.v51i12.11457

Nguyen LT, Macaluso NC, Pizzano BLM, Cash MN, Spacek J, Karasek J, Huyke DA, Silverman AD, Acosta A, Cassell GH, Wilen CB, Santiago JG (2022). A thermostable Cas12b from Brevibacillus leverages onepot discrimination of SARS-CoV-2 variants of concern. EBioMedicine, 77: 103926. https://doi.org/10.1016/j.ebiom.2022.103926

Njiru, A.N. 2010: Evaluation of dual purpose sorghum varieties for animal feed in semi-arid areas of Kenya. PhD thesis, University of Nairobi, Nairobi, Kenya. Available at: https://erepository.uonbi.ac.ke/bitstream/handle/11295/19191/Njiru_Evaluation%20Of%20Dual%20Purpose%20Sorghum%20Varieties%20For%20Animal%20Feed%20In%20Semi%20Arid%20Areas%20Of%20Kenya.pdf?sequence=3&isAllowed=y (accessed 9 Aug 2025).

Pays E, Radwanska M, Magez S (2023). The pathogenesis of African trypanosomiasis. Annu. Rev. Pathol., 18: 19–45. https://doi.org/10.1146/annurev-pathmechdis-031621-025153

Sereno D, Oury B, Geiger A, Vela A, Karmaoui A, Desquesnes M (2022). Isothermal nucleic acid amplification to detect infection caused by parasites of the trypanosomatidae family: a literature review and opinion on the laboratory to field applicability. Int. J. Mol. Sci., 23(14): 7543. https://doi.org/10.3390/ijms23147543

Shaizadinova A, Amanzholova M, Kirillov S, Bulashev A, Abeldenov S (2023). Rapid and highly sensitive LAMP-CRISPR/Cas12a-based identification of bovine mastitis milk samples contaminated by Escherichia coli. J. Agric. Food Res., 14: 100721. https://doi.org/10.1016/j.jafr.2023.100721

Sima N, Dujeancourt-Henry A, Perlaza BL, Ungeheuer MN, Rotureau B, Glover L (2022). SHERLOCK4HAT: a CRISPR-based tool kit for diagnosis of Human African Trypanosomiasis. EBioMedicine, 85: 104308. https://doi.org/10.1016/j.ebiom.2022.104308

Teng F, Cui T, Feng G, Guo L, Xu K, Gao Q, Li T, Li J, Zhou Q, Li W (2018). Repurposing CRISPR-Cas12b for mammalian genome engineering. Cell Discovery, 4: 63. https://doi.org/10.1038/s41421-018-0069-3

Teng F, Guo L, Cui T, Wang XG, Xu K, Gao Q, Zhou Q, Li W (2019). CDetection: CRISPR-Cas12b-based DNA detection with sub-attomolar sensitivity and single-base specificity. Genome Biol., 20(1): 132. https://doi.org/10.1186/s13059-019-1742-z

Tong Q, Chen R, Kong Q, Goossens J, Radwanska M, Lou D, Cao G, Magez S (2018). DNA detection of Trypanosoma evansi: diagnostic validity of a new assay based on loop-mediated isothermal amplification (LAMP). Vet. Parasitol., 250: 1–6. https://doi.org/10.1016/j.vetpar.2017.12.006

Wei N, Zheng B, Niu J, Li M, Pei G, Yang Y, Shi K, Zhang K, Yang J, Liu H, Wang Z, Li X, Peng H, Zhou M, Ning Z, Jiao P, Zhang G (2022). Rapid detection of genotype II African swine fever virus using CRISPR Cas13a-based lateral flow strip. Viruses, 14: 179. https://doi.org/10.3390/v14020179

WOAH (2021). Surra in all species (trypanosoma evansi infection). In: OIE terrestrial manual. Paris: WOAH, 1833. Available at: https://www.woah.org/fileadmin/Home/fr/Health_standards/tahm/3.01.21_SURRA_TRYPANO.pdf

Xie S, Tao D, Fu Y, Wang P, Kang T, Mu Y, Wang S (2021). Rapid visual CRISPR assay: a naked-eye colorimetric detection method for nucleic acids based on CRISPR/cas12a and a convolutional neural network. ACS Synth. Biol., 11: 383–396. https://doi.org/10.1021/acssynbio.1c00474

Zhang K, Sun Z, Shi K, Wang B, Li X, Zhang S, Wang W, Wang H (2023). RPA-CRISPR/Cas12a-based detection of Haemophilus parasuis. Animals, 13: 3317. https://doi.org/10.3390/ani13213317

Zou Y, Mason MG, Botella JR (2020). Evaluation and improvement of isothermal amplification methods for point-of-need plant disease diagnostics. PLoS One, 15(6): e0235216. https://doi.org/10.1371/journal.pone.0235216