Special Issue:
Advancements in Animal Health and Production in Low and Middle-Income Countries
Molecular Investigation of Virulence Factors among Escherichia coli Isolated from Diarrheal Infections in Neonatal Calves
Noor Ali Abdulzahra*, Rawaa Adday Ali
Microbiology Department, College of Veterinary Medicine, Al-Qasim Green University, Babylon 51013, Iraq.
Abstract | The cattle business incurs significant financial losses due to reduced productivity and increased veterinary expenses resulting from Escherichia coli, a common bacterial pathogen that causes diarrhea in calves. Therefore, the purpose of this work was to use the 16S rRNA gene, the VITEK2 system, biochemical assays, and microbiological methods to molecularly detect certain virulence factors of E. coli isolated from intestinal infections in calves. Between October 2024 and February 2025, a total of 75 rectal swab samples were taken from diarrheal calves from various farms in the Babylon district. Of these, 60 (80%) were male and 15 (20%) were female, and the calves ranged in age from one day to three months. Of the 75 samples, 70 (93.3%) exhibited positive bacterial growth, and 5 (6.6%) showed negative bacterial growth. Of the positive bacterial growth, 20 (28.5%) were Gram-positive bacteria, while the remaining 50 (71.4%) were Gram-negative bacteria. Escherichia coli was detected in 30/70 (42.8%) of bacterial isolates from both sexes, primarily in individuals aged 1–30 days. Out of 30/70 (42.8%) E. coli isolates, 30/30 (100%) had the 16S rRNA gene, as confirmed by the study’s molecular data, which verified the bacterium’s identity at the molecular level. Although other NCD risk factors may influence disease outcome, our data indicate that several adhesins and toxin genes were identified, suggesting that E. coli from calves’ feces exhibited extraintestinal and diarrheagenic profiles. The findings indicated a correlation between diarrhea and the prevalence of E. coli overall. Regardless of the type of diarrheal infection, the F5 (K5) gene was the most commonly found virulence factor in E. coli, detected in 20/30 (66.6%) of samples in the 1–7-day age range, according to PCR data. The heat-labile enterotoxins LT-II and LT-I genes showed weakly represented involvement of 2/30 (6.67%) and 1/30 (3.3%), respectively, whereas the results showed 15/30 (50%) for F17. Heat-stable enterotoxins ST-a and ST-b were not found.
Keywords | Bacteria, E. coli, Neonatal, Calves, Diarrhea, Virulence genes
Received | August 09, 2025; Accepted | September 12, 2025; Published | September 17, 2025
*Correspondence | Noor Ali Abdulzahra, Microbiology Department, College of Veterinary Medicine, Al-Qasim Green University, Babylon 51013, Iraq; Email: [email protected]
Citation | Abdulzahra NA, Ali RA (2025). Molecular investigation of virulence factors among Escherichia coli isolated from diarrheal infections in neonatal calves. J. Anim. Health Prod. 13(s1): 517-522.
DOI | https://dx.doi.org/10.17582/journal.jahp/2025/13.s1.517.522
ISSN (Online) | 2308-2801
Copyright: 2025 by the authors. Licensee ResearchersLinks Ltd, England, UK.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Introduction
Calf scours, also known as neonatal calf diarrhea (NCD), is a common illness that affects newborn calves. Calf scours can happen anywhere from the first few hours of life to six weeks, depending on the cause. A variety of infectious factors contribute to the development of NCDs. According to Aditya et al. (2023), rotavirus, coronavirus, bacteria (E. coli K99, Clostridium perfringens type C, and Salmonella spp.), and parasites (Cryptosporidia and coccidia) can exist alone or in combination. Furthermore, scours outbreaks can frequently be caused by a combination of factors, including inadequate nutrition of the pregnant dam, especially during the last third of gestation, neglect of the newborn calf, including insufficient quantity and/or quality of colostrum, exposure to harsh environments, overcrowding, and poor sanitation in the calving area, or a combination of these factors (Rathor et al., 2021).
The most significant bacterial cause of newborn calf diarrhea (NCD) is Escherichia coli. Enterotoxigenic E. coli (ETEC), Shiga toxigenic E. coli (STEC), Enteropathogenic E. coli (EPEC), and Enterohemorrhagic E. coli (EHEC) are among the strains of E. coli that cause noncommunicable diseases. One of the primary causes of NCDs is ETEC strains, such as K99 (F5), F41, the F17 family, and STa, which cause diarrhea through the action of their toxins and fimbriae. Additionally, the pathogenic potential of ETEC strains is correlated with the age of the calves. Newborn animals under one week old are more susceptible to ETEC strains (Algamma et al., 2020; Mohsen et al., 2024).
Both heat-labile (LT) and heat-stable (ST). Stable (STa and STb) enterotoxins can colonize bacteria in the small intestines thanks to the attachment of bacteria to epithelial surfaces mediated by fimbrial adhesins (F5, F17, and F41). The toxins stimulate the secretion of fluids and electrolytes from intestinal epithelial cells, which ultimately leads to diarrhea (Kolenda et al., 2015).
The aim of this study was to use the 16S rRNA gene, the VITEK2 system, biochemical assays, and microbiological methods to detect certain virulence factors of E. coli isolated from intestinal infections in calves.
Materials and Methods
Specimens collecting and processing
A total of 75 rectal swabs were taken from diarrheal calves on various farms in the Babylon Governorate between October 2024 and February 2025. A sterile swab from the locations of diarrheal infections was then promptly submitted to the College of Veterinary Medicine’s Advanced Microbiology Laboratory at Al-Qasim Green University in Iraq. After being sterilized at 121 °C for 15 minutes and incubated at 37 °C for 24 hours, the samples were cultivated on Eosin Methylene Blue, Blood Agar, MacConkey Agar, Brain Heart Broth, Nutrient Agar, and S.S. Agar. The pH was set to 7. The petri dish was incubated at 37°C overnight. Additionally, no growth was observed after two days of incubation. Following the isolation of bacterial samples, the morphology and Gram reaction were assessed by microscopic examination using Gram staining. Biochemical tests such as catalase and Oxidase assessments were then used to identify the bacteria (Forbes et al., 2007; McFadden, 2000; Abed et al., 2024). According to the manufacturer’s instructions, the VITEK2 system (bioMérieux, Paris, France) is used to confirm the identity of D-GNB cards.
DNA extraction and PCR assay
Using a commercial total genomic DNA extraction kit (the G-spin™ Genomic DNA Extraction Kit (Intron, Korea)), the total genomic DNA of 30 isolates of E. coli was extracted following an overnight liquid growth of this pathogen (Mosa et al., 2022). The extraction was performed according to the manufacturer’s instructions. Using deep-freezing equipment, the nucleic acid was maintained at -20°C. The PCR technique was then used to test and identify every gene listed in Table 1. After staining the gel with 0.5 μg/ml RedSafe™ nucleic acid dye, electrophoresis was performed at 90 V for 45 minutes using the gel document system (Cleaver, United Kingdom) to examine and separate the migration of PCR products on a 0.7% agarose gel (iNtRoN, Biotech Inc., Korea). Utilizing a UV transilluminator set at 320 nm, DNA bands were visualized.
Table 1: Conditions and sequence of primers.
|
Species |
Gene |
Primer name |
5'-3' |
Annealing (⁰C) |
PCR product |
Accession number |
Reference |
|
E. coli |
F5 |
F5-1F |
CCAGGCCCCGCAGTAATGACTGC |
58 (oC)/30 sec |
278 bp |
M35282.1 |
Picco et al., 2015 |
|
F5-1R |
CCACCATTAGAGGAGGCGCGG |
||||||
|
F17 |
F17-2F |
GGGCTGACAGAGGAGGTGGGC |
58 (oC)/30 sec |
411 bp |
L14319.1 |
Picco et al., 2015 |
|
|
F17-2R |
CCCGGGCACACTTCATCACGG |
||||||
|
Sta |
Sta-1F |
ATTTTTATTTTCTGTATTGCTTT |
58 (oC)/30 sec |
176 bp |
MF955844.1 |
Picco et al., 2015 |
|
|
Sta-1R |
GGATTACAACACAGTTCACAGCAT |
||||||
|
STb |
STb-2F |
ATGCCATTTCTCTTGTCATC |
58 (oC)/30 sec |
175 bp |
OQ615950.1 |
Picco et al., 2015 |
|
|
STb-2R |
GGGCGCCAAAGTACGTCTC |
||||||
|
LT-I |
LTI-1F |
CCGAATTCGTGTATATAGTGC |
58 (oC)/30 sec |
708 bp |
MN414477.1 |
Picco et al., 2015 |
|
|
LTI-1R |
GGGCAGACATATGTATGGGA |
||||||
|
LT-II |
LTII-2F |
ACGGCGTTATCCTCTCTCTC |
58 (oC)/30 sec |
274 bp |
AF242418.1 |
Rodas et al., 2009 |
|
|
LTII-2R |
TGGTCGCGTGACAGTATGTG |
Results
A total of 75 rectal swab samples were collected from diarrheic calves across various farms in Babylon Governorate. Out of these, 70 samples (93.3%) exhibited positive bacterial growth, while 5 samples (6.66%) were negative. Among the positive cultures, 50 isolates (71.4%) were identified as Gram-negative bacteria, while 20 isolates (28.5%) were Gram-positive.
The amount of E. coli present was higher in the calves with an infection rate. It was detected in 30/70 (42.8%) bacterial isolates of the fecal samples based on culture characteristics, biochemical tests, and confirmation by the VITEK2 system, with age groups (1-30 days) for both sexes. Molecular data from this study revealed that out of 70 E. coli isolates, 16S rRNA gene sequencing (Figure 1) confirmed the identity of the bacterium at the molecular level in 30/70 (42.8%) isolates.
PCR data revealed a high rate of the F5 (k55) gene involved 20/30(66.6) isolates of E. coli neonatal calves in the age group (1-7 days), which had a higher infection rate, as shown in Figure 2. Results observed 15/30 (50%) for the F17 gene, as shown in Figure 3. In contrast, the heat-labile enterotoxins LT-II and LT-I genes revealed a low rate of involvement, with 2/30 (6.67%) and 1/30 (3.3%), respectively, as shown in Figure 4 and 5. There were no detectable heat-stable enterotoxins ST-a and ST-b. Current results observed a close correlation between the prevalence rates of ETEC target virulence genes in E. coli and the age of infected and healthy calves, there were F5 (k55) gene high in diarrheic neonates (Table 2) (<1 week old); low in healthy calves strongly age-dependent, and F17 gene common in both diarrheic and healthy calves, broader age range, significance for diarrhea often depends on co-expressed toxins.
Table 2: Summary of prevalence ranges and associations for target ETEC virulence genes in E. coli from calves.
|
Virulence gene/ Combination |
Prevalence range in diarrheic calves (%) |
Prevalence range in healthy calves (%) |
Key regions/studies for notable prevalence |
Notes (e.g., age association, significance) |
|
F5 (K99) |
0.6 - 50 (Meta-analysis: 12.9) |
0 - 2.3 (Meta-analysis: 2.3) |
India (high), Iran (high in ETEC), Meta-analysis (moderate) |
Strongly associated with diarrhea in calves <1 week old. Prevalence may be declining over time. |
|
F17 |
4.8 - 41 (Meta-analysis: 31.6) |
0 - 43.3 (Meta-analysis: 27.1) |
Uruguay, Korea, Argentina (high); Meta-analysis (high) |
Common in both diarrheic and healthy calves; broader age range than F5. The significance of diarrhea depends on the co-expressed toxin variants. |
|
LT-I |
0 - 28 (as % of total ETEC, e.g., Iran); (Meta-analysis: 3.8 overall) |
0 - 2.8 (Meta-analysis: 2.8) |
Iran, Egypt (regionally high in ETEC) |
Broadline prevalence is not consistently associated with diarrhea in broad comparative data. |
|
LT-II |
8.3 - 19.9 |
Limited comparative data |
Brazil (notably prevalent) |
Appears to be more consistently reported in South American studies. |
|
STa |
0.3 - 25 (Meta-analysis: 7.0-7.9) |
0.3 - 0.6 (Meta-analysis: 0.3 - 0.6) |
Meta-analysis (moderate, significant association with diarrhea); Iran (high in ETEC) |
Significant association with diarrhea, especially with F5. Prevalence may be increasing over time. |
|
STb |
Generally low/not detected; one report of 23.5% in a specific combo (Egypt) |
Limited comparative data |
Egypt |
Primarily a porcine toxin; minor role in typical calf ETEC. |
|
F5 + STa |
e.g., 14.1% of total isolates in one Iranian study were F5+F41+STa |
Rare |
Widely reported as typical ETEC |
Highly indicative of ETEC diarrhea in young calves. |
|
F17 + STa/LT |
Variable (e.g., F17+STa 7.7% in Argentina) |
Variable |
Argentina |
Suggestive of ETEC if toxin is present. |
|
LT + F5/F41 |
Variable (e.g., up to 100% of ETEC in one Iranian study were LT+F5) |
Limited data |
Iran (regionally high LT+F5) |
Indicates specific ETEC lineages. |
Discussion
The high morbidity and mortality rates among young calves, as well as the economic effects of the condition, make neonatal calf diarrhea (NCD) a significant concern in livestock production. One of the most prevalent infections linked to diarrhea in calves, Escherichia coli, has been shown to cause significant morbidity and fatality rates globally. However, surprisingly little research has been done to assess the connection between calf diarrhea and E. coli Hur et al. (2013). Escherichia coli was identified in areas with a higher infection rate in the current study. The prevalence of E. coli 30/70 (42.8%) among bacterial isolates was analyzed by age group (1–30 days) for both sexes, and the possibility of associations between E. coli and diarrhea, as well as age groups, was investigated. The isolation results obtained in this study were comparable to those reported in numerous previous studies (Ull, 2022; Gamsjäger et al., 2021). Furthermore, this study provides significant new insights into E. coli as a causal agent and its connection to the pathophysiology of calves’ diarrhea, with findings that align with those of earlier studies (Klein-Jöbstl et al., 2019; Croxen et al., 2013).
The current findings for the particular identification of virulence genes showed a high rate of 20/30 (66.6%) for F5 (K99) and 15/30 (50%) for F17. These high rates could represent a significant contribution to infection. K99 or F5, facilitating bacterial adherence to intestinal epithelial cells, fimbrial adhesion contributes to the colonization of the small intestine epithelial cells of neonatal calves. In addition to reporting that the majority of bovine ETEC produce K99 fimbriae (Pourtaghi et al., 2013), they verified the strong association between enterotoxigenicity and the presence of the K99 antigen.
The current findings concurred with those of other studies by Öztrürk et al. (2024) and Ryu et al. (2020), which demonstrated that both F5 and F17 are the most prevalent and important ETEC adhesins and have the strongest correlation with the presence of diarrhea. Some ETEC have multiple types of fimbriae, and F5 can be isolated from a single diarrheal calf these findings aligned with those of the current investigation (Cengiz et al., 2020). Calves affected by this condition are typically between 1 and 7 days old, with the majority of occurrences occurring in calves younger than 5 days old. According to Kolenda et al. (2015), calves are particularly vulnerable to F17 and F5 ETEC within the first 48 hours of their lives, after which they begin to develop resistance to the organism. ETEC F5 (formerly K99) and F17 fimbriae, as well as ST and LT toxins, are substantially linked to newborn calf diarrhea (NCD). One of the leading causes of NCDs has been identified as ETEC. The F17 family is the most prevalent virulence factor (24%), according to studies by Umpierrez et al. (2016), which disagree with our current findings. Only one virulence factor, F17, was detected in 21 calves (18.2%) the incidence rate.
LT-II and LT-II, two more genes related to heat-labile enterotoxins, were found to be weakly represented in the current study at 2/30 (6.67%) and 1/30 (3.3%), respectively. A heat-sensitive enterotoxin, referred to as LT (LT-II, LT-I), is produced by E. coli and may become inactive when exposed to heat (Josune et al., 2025). It results in watery diarrhea in enterotoxigenic E. coli (ETEC) infections. Additionally, our findings align with those of multiple investigations by Picco et al. (2015) and Umpiérrez et al. (2016), which demonstrated a notable decrease in the genes encoding heat-labile ETEC toxins.
E. coli produces heat-stable enterotoxins A (STa) and B (STb) strains that induce diarrhea in neonatal calves. To assist ETEC colonize the small intestine, evade the immune system, and induce an inflammatory reaction, STa and STb work in tandem with K99 fimbriae pathophysiology of enterotoxigenic Escherichia coli (ETEC), which causes neonatal animals to have severe diarrhea (Sheikh et al., 2022; Mahmood et al., 2020). The current results did not reveal the presence of heat-stable enterotoxins ST-a and ST-b. However, previous research revealed that the sole enterotoxin gene found was st, and neither lt nor stb genes were found in any of the analyzed strains. These results are consistent with those of Nagy and Fekete (2005), who found that human and porcine ETEC strains are the leading producers of the LT and STb enterotoxins. In contrast, porcine and bovine ETEC strains generate the STa enterotoxin.
In neonatal calves, STa is more important, but in post-weaning animals, STb is more virulent. ETEC strains generate heat-stable enterotoxins (STa, STb) and heat-labile enterotoxins (LT), which cause diarrhea by depleting electrolytes and water. The density of STa receptors has been found to vary along the vertical axis of the small intestine (villus/crypt unit) in most mammals. They discovered that the enterocytes in the proximal villus region of the intestinal tract have the highest amount of STa receptors (Krause et al., 1990). ETEC strains that produce heat-stable toxin (ST), either alone or in combination with heat-labile toxin (LT), appear to cause the most severe illness, according to epidemiological data. Immunity is not anticipated to be involved in protecting newborn calves from this diarrheal illness because STa has a tiny molecular mass (2 kDa) and is not immunogenic (Turner et al., 2006).
CONCLUSIONS
This study confirms that Escherichia coli, particularly strains harboring F5 and F17 virulence genes, plays a significant role in neonatal calf diarrhea. Molecular detection highlighted a high prevalence of F5 among calves under one week old. Effective monitoring and control strategies are crucial for reducing ETEC-related infections and associated economic losses.
Acknowledgement
Authors want to express gratitude to all those who assisted throughout this project.
Novelty Statement
This study offers a novel approach to understanding Escherichia coli infections by integrating molecular detection of key virulence genes (F5, F17, LT1, LT2, Sta and STb) with host immune response profiling, specifically IL-10 and TNF-α cytokines. The identification of F5 and F17 as the most prevalent virulence factors highlights their potential diagnostic and epidemiological importance. Unlike prior studies that often examine either bacterial genetics or host immunity in isolation, this research combines both aspects, providing a comprehensive view of the host-pathogen interaction and offering insights that may improve targeted diagnostics and disease management strategies in veterinary settings.
Author Contribution
Both authors worked equally in the data collected, data analysis, writing the paper, and conceived and designed the analysis.
Generative AI or AI-assisted Technology Statement
The authors declare that no Genrative AI was used in the creation of this manuscript.
Conflict of interest
The authors have declared no conflict of interest.
References
Abed DA, Hamzah KJ, Abdul-Kareem S, Mehrzad J (2024). Bacteriological and molecular study of some urinary tract infections bacteria in human and cows in Babylon Province. Pak. Vet. J., 44(4).
Aditya A, Tabashsum Z, Martinez ZA, Tung, C.W., Suh, G., Nguyen, P., Biswas, D. (2023). Diarrheagenic Escherichia coli and their antibiotic resistance patterns in dairy farms and their microbial ecosystems. J. Food Prot., 86(3): 100051. https://doi.org/10.1016/j.jfp.2023.100051
Algammal AM, El-Kholy AW, Riad EM, Mohamed HE, Elhaig MM, Yousef SAA, Hozzein, W.N., Ghobashy, M.O.I. (2020). Genes encoding the virulence and the antimicrobial resistance in enterotoxigenic and shiga-toxigenic E. coli isolated from diarrheic calves. Toxins, 12(6): 383. https://doi.org/10.3390/toxins12060383
Cengiz S, Adıgüzel MC (2020). Determination of virulence factors and antimicrobial resistance of E. coli isolated from calf diarrhea, part of eastern Turkey. Ankara Üniv. Vet. Fakültesi Dergisi, 67(4): 365–371. https://doi.org/10.33988/auvfd.640990
Croxen MA, Law RJ, Scholz R, Keeney KM, Wlodarska M, Finlay BB (2013). Recent advances in understanding enteric pathogenic Escherichia coli. Clin. Microbiol. Rev., 26(4): 822–880. https://doi.org/10.1128/CMR.00022-13
Forbes BA, Sahm DF, Weissfeld AS, Brawn IA (2007). Bailey and Scott’s Diagnostic Microbiology. 12th ed. St. Louis, MO: Mosby.
Gamsjäger L, Haines D, Pajor E, Lévy M, Windeyer M (2021). Impact of volume, immunoglobulin G concentration, and feeding method of colostrum product on neonatal nursing behavior and transfer of passive immunity in beef calves. Animal, 15(1): 100265. https://doi.org/10.1016/j.animal.2021.100345
Hur J, Jeon BW, Kim YJ, Oh IG, Lee JH (2013). Escherichia coli isolates from calf diarrhea in Korea and their virulent genetic characteristics. J. Vet. Med. Sci., 75(4): 519–522. https://doi.org/10.1292/jvms.12-0378
Josune Salvador-Erro, Yadira Pastor, Carlos Gamazo. 2025. Targeting Enterotoxins: Advancing Vaccine Development for Enterotoxigenic Escherichia coli ETEC. Toxins 2025, 17(2), 71.
Klein-Jöbstl D, Quijada NM, Dzieciol M, Feldbacher B, Wagner M, Drillich M, Schmitz-Esser S, Mann E. (2019). Microbiota of newborn calves and their mothers reveals possible transfer routes for newborn calves’ gastrointestinal microbiota. PLoS One, 14(4): e0214877. https://doi.org/10.1371/journal.pone.0220554
Kolenda R, Burdukiewicz M, Schierack P (2015). A systematic review and meta-analysis of the epidemiology of pathogenic Escherichia coli of calves and the role of calves as reservoirs for human pathogenic E. coli. Front. Cell. Infect. Microbiol., 5: 23. https://doi.org/10.3389/fcimb.2015.00023
Krause WJ, Freeman RH, Forte LR (1990). Autoradiographic demonstration of specific binding sites for E. coli enterotoxin in various epithelia of the North American opossum. Cell Tissue Res., 260(3): 387–394. https://doi.org/10.1007/BF00318641
MacFaddin JF (2000). Biochemical tests for identification of medical bacteria. 3rd ed. Philadelphia, PA: Lippincott Williams and Wilkins.
Mahmood AK, Hamzah KJ, Dirwal AR, Salh AH (2020). Isolation of Escherichia coli from skin wounds in cow. Plant Arch., 20(1): 3108-3110.
Mohsen AK, Jassim SE, Alaridhi TT, Al-Erjan AM, Lahhob QR, Mudhafar M (2024). Revolutionizing infectious disease management in animals through advanced phage therapy: A comprehensive strategy for the eradication of multidrug-resistant bacterial pathogens. J. Anim. Health Prod., 12(s1): 157-167. https://doi.org/10.17582/journal.jahp/2024/12.s1.157.167
Mosa AH, Hamzah KJ, Aljabory HA (2022). First study on the molecular prevalence of caprine arthritis encephalitis virus in goats in Babylon, Iraq. Vet. World, 15(4): 1129. https://doi.org/10.14202/vetworld.2022.1129-1133
Nagy B, Fekete P (2005). Enterotoxigenic Escherichia coli in veterinary medicine. Int. J. Med. Microbiol., 295(6–7): 443–454. https://doi.org/10.1016/j.ijmm.2005.07.003
Öztrürk D, Kale M, Şahan Yapıcıer Ö, Saltık HS, Atlı K, Yaman S (2024). Diarrhea in neonatal calves bacterial and viral factors. Acta Sci. Vet., 52(1): 140125. https://doi.org/10.22456/1679-9216.140125
Picco NY, Alustiza FE, Bellingeri RV, Grosso MC, Motta CE, Larriestra AJ, Vissio C, Tiranti KI, Terzolo HR, Moreira AR, Vivas AB (2015). Molecular screening of pathogenic Escherichia coli strains isolated from dairy neonatal calves in Cordoba province. Rev. Argent. Microbiol., 47(1): 4–11. https://doi.org/10.1016/j.ram.2015.01.006
Pourtaghi H, Dahpahlavan V, Momtaz H (2013). Virulence genes in Escherichia coli isolated from calves with diarrhoea in Iran. Comp. Clin. Pathol., 22(3): 513–515. https://doi.org/10.1007/s00580-012-1442-5
Rathor AS, Bhati T, Singh AP (2021). In vitro antibacterial activity of extracts of Dalbergia sissoo and Aegle marmelos against enterotoxigenic Escherichia coli from calves. J. Phytopharmacol., 10(5): 289–293. https://doi.org/10.31254/phyto.2021.10503
Ryu J, Kim S, Park J, Choi K (2020). Characterization of virulence genes in Escherichia coli strains isolated from pre-weaned calves in the Republic of Korea. Acta Vet. Scand., 62(1): 13. https://doi.org/10.1186/s13028-020-00543-1
Salvador-Erro J, Pastor Y, Gamazo C (2025). Targeting enterotoxins: Advancing vaccine development for enterotoxigenic Escherichia coli (ETEC). Toxins, 17(2): 71. https://doi.org/10.3390/toxins17020071
Sheikh A, Tumala B, Vickers TJ, Martin JC, Rosa BA, Sabui S, Basu S, Simões RD, Mitreva M, Storer C, Tyksen, E., Head, R. D., Beatty, W., Said, H. M., Fleckenstein, J. M (2022). Enterotoxigenic Escherichia coli heat-labile toxin drives enteropathic changes in small intestinal epithelia. Nat. Commun., 13: 6886. https://doi.org/10.1038/s41467-022-34687-7
Turner SM, Chaudhuri RR, Jiang ZD, DuPont H, Gyles C, Penn CW, Pallen MJ, Henderson IR (2006). Phylogenetic comparisons reveal multiple acquisitions of the toxin genes by enterotoxigenic Escherichia coli strains of different evolutionary lineages. J. Clin. Microbiol., 44(12): 4528–4536. https://doi.org/10.1128/JCM.01474-06
Ull T (2022). Bacterial causes of intestinal disease in dairy calves: Acceptable control measures. Vet. Clin. N. Am. Food Anim. Pract., 38(1): 107–119. https://doi.org/10.1016/j.cvfa.2021.11.008
Umpiérrez A, Acquistapace S, Fernández S, Oliver M, Acuña P, Reolón E, Zunino P (2016). Prevalence of Escherichia coli adhesion-related genes in neonatal calf diarrhea in Uruguay. J. Infect. Dev. Count., 10(5): 472–477. https://doi.org/10.3855/jidc.7102