Isolation and Characterization of Vagococcus fluvialis from Deceased Pigs in Jiangsu, China
Zhixin Guan1,2, Abdul Wahaab2, Mohsin Nawaz3, Muhammad Naveed Anwar4,
Yuhao Li2, Junjie Zhang2,5, Muhammad Muddassir Ali6, Abdul Tawaab7,
Ali Ahmad Sheikh8, Zhiyong Ma2, Dengke Zhong5*, Mingfu Niu1* and
Jianchao Wei2*
1Henan University of Science and Technology, 263 Kaiyuan Road, Luoyang, 471023, China.
2Shanghai Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Shanghai 200241, China.
3Faculty of Veterinary and Animal Sciences, University of Poonch, Rawlakoot, Azad Jammu and Kashmir, Pakistan.
4Institute of Microbiology, University of Agriculture, Faisalabad, Pakistan.
5Shanghai Vocational and Technical College of Agriculture and Forestry, Shanghai 201600, China.
6Institute of Biochemistry and Biotechnology, University of Veterinary and Animal Sciences, 54000, Lahore, Pakistan.
7University of Agriculture, Faisalabad, Sub Campus Toba Tek Singh, 36050, Pakistan.
8Institute of Microbiology, University of Veterinary and Animal Sciences, Lahore, 54000, Pakistan.
ABSTRACT
The Gram-positive Vagococcus fluvialis has been regarded as a potential bacterial pathogen. It has been isolated from the environment, birds, fishes, and mammals with a slight knowledge of their species. V. fluvialis is also believed to act as pro-biotic in fishes. However, in mammals, it is frequently isolated from infectious tissues, including on rare occasions from humans and livestock lesions. Pigs’ infestation with V. fluvialis is rarely reported. Here, we have presented the first report of V. fluvialis isolated and characterized from deceased pigs in Jiangsu province of China. Three V. fluvialis strains were isolated from deceased pigs presenting different clinical symptoms between October 2020 to January 2021. The bacterial strains were identified by MALDI-TOF MS and were confirmed by 16S rRNA sequencing and biochemical profiling. Broth micro dilutions were used to assess the minimal inhibitory concentration of the antimicrobials of veterinary interest. The isolated strains all were resistant to clindamycin, erythromycin and tetracycline. The data described will be important to assess the epidemiology and tackle the likelihood of out-breaks associated with V. fluvialis across pig herds. It may also provide a basis to understand the behavior of various antimicrobial drugs against this potential pathogen, which could facilitate development of guidelines for combating the possible threats to the pig industry/herds in the region associated with this bacterium.
Article Information
Received 13 March 2024
Revised 03 May 2024
Accepted 10 May 2024
Available online 02 October 2024
(early access)
Published 25 September 2025
Authors’ Contribution
JW, MN, DZ and ZM designed and supervised the research. ZG, YL and JZ performed investigation and samples collection. ZG, AW, MN, MNA, MMA, AT and AAS collected and analyzed data. JW, ZG and AW wrote and edited the manuscript. All authors read and approved the final manuscript.
Key words
Vagococcus fluvialis, Isolation and identification, 16S rRNA sequencing, Minimum inhibitory concentration (MIC), Antimicrobials, Phylogenetic analysis
DOI: https://dx.doi.org/10.17582/journal.pjz/20240313174156
* Corresponding author: [email protected], [email protected], [email protected]
0030-9923/2025/0006-2645 $ 9.00/00
Copyright 2025 by the authors. Licensee Zoological Society of Pakistan.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Introduction
The Vagococcus fluvialis is a catalase-negative, Gram-positive bacterium, preliminary isolated in 1974 from river water and chicken feces. These isolates were formerly identified as a member of the genus Lactococcus; however, 16S rRNA gene sequencing modified their classification to a new genus i.e. Vagococcus (Collins et al., 1989). A second species, known as Vagococcus salmoninarum, was described following a molecular taxonomy investigation (Wallbanks et al., 1990). Even though they are separate, the genera Vagococcus and Enterococcus shared a tight evolutionary relationship, and some species are challenging to distinguish purely on phenotypic traits. There have only been a few reports of V. salmoniarum being isolated from sick salmonoid fish and rainbow trout (Schmidtke and Carson, 1994), and V. fluvialis being isolated in 1994 from the lesions of various mammals i.e., horses, pigs, cattle, and cats (Pot et al., 1994).
V. fluvialis was firstly reported to be associated with human infections in 1997 (from peritoneal fluid, wounds, and blood culture). However, these isolations were different from those which were isolated from the pig (unknown clinical source) both by SDS-PAGE profile and phenotypically (Teixeira et al., 1997). Until now, only a few studies have briefed the spreading of this bacterium in humans. One isolate from rare infective endocarditis and the other from a root-filled tooth which is associated with periarticular lesions (Al-Ahmad et al., 2008; Jadhav and Pai, 2019). V. fluvialis was also reported as a possible probiotic for fishes in vitro and in vivo and has been shown to defend against Vibrio anguillarum (a significant fish disease), and to have immunomodulatory effects on the host (Roman et al., 2012, 2013; Sorroza et al., 2012). It has a distinctive lipid pattern with a high concentration of D-alanylcardiolipin (Fischer and Arneth-Seifert, 1998). There are not many reports of V. fluvialis being the cause of sickness in pigs. Teixeira et al (Teixeira et al., 1997) identified and isolated several strains from multiple body organs, suggesting that this agent may contribute to opportunistic and systemic infection in pigs.
Fewer studies have described isolation, biological characteristics, and antibiotic resistance of isolated V. fluvialis strains, which may have great significance in epidemiology, clinical diagnosis, and control/therapy. Here, we reported the phenotypic and genotypic characteristics of three V. fluvialis isolates. We have constructed a 16S phylogenetic tree using other reported strains to establish their phylogenetic relationship with other available isolates. Furthermore, we have studied their susceptible/resistance against various available antimicrobials (through MIC) which all are still rare and vital information for this genus in the swine production system.
Materials and Methods
Sample collection and bacteria isolation
Forty-eight samples (containing heart, liver, spleen, lung, kidneys, brain, lymph node, and nasal swabs) were collected from six suddenly deceased fattening pigs (80-180 days old), with a history of dyspnea (information provided by a veterinary doctor of the farm). The sampled pigs were raised in three technified swine forms, located in two different counties of Jiangsu province in PR China. Simultaneously, 30 samples (ten from each farm, containing blood and nasal swabs (each five) were collected from the same farms as control from healthy pigs. After wiping the internal organs or bleeding points with a sterile inoculum ring, then each sample was directly streaked on Columbia agar (Difco and BBL, Detroit, MI, USA), with 5% sheep blood and incubated at 37°C for 24 h. One presumptive colony from each plate was inoculated in brain heart infusion medium (Difco and BBL, Detroit, MI, USA) supplemented with 5% fetal bovine serum and incubated at 37 °C for 24 h for further analysis. All the samples described above and prepared cultures were screened through PCR (Zeng et al., 2014; Sunaga et al., 2020) by using specially designed oligo dt primers (primer sequences are summarized in Table I) for 12 possible porcine respiratory pathogens (Actinobacillus pleuropneumoniae (App), Bordetella bronchiseptica (Bb), Glaesserella parasuis (Gps), Pasteurella multocida (Pm), Streptococcus suis (SS), Mycoplasma hyopneumoniae (Mh), porcine circovirus 2 (PCV2), pseudorabies virus (PRV), swine influenza A virus (IAVs), porcine reproductive and respiratory syndrome virus (PRRSV), porcine respiratory coronavirus (PRCV) and porcine hemagglutinating encephalomyelitis virus (PHEV).
Species identification by MALDI-TOF-MS
Species identification was performed by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) (VITEK MS, BioMérieux, Marcy-lʼ Etoile, France) according to the manufacturer’s instructions. Bacterial mass spectra in the range of 2–20 kDa were acquired using a Microflex™ mass spectrometer (Bruker Daltonik GmbH, Bremen, Germany). The results were checked through Myla software (MALDI Bio Typer™ 3.0). Two replicates of each sample were placed in plate wells and two readings were made for each sample. The obtained spectra were compared to the manufacturer’s library and standard Bruker interpretative criteria were applied; scores of ≥ 2.0 were accepted for species assignment and scores of 1.7-2.0 were accepted for genus identification.
Identification of phenotypic characteristics by biochemical profiling
The biochemical profiles of isolates were tested to confirm bacterial strain identification by the VITEK™ 2 automated identification system (BioMérieux, Hazelwood, MO, USA) according to the manufacturer’s instruction. A VITEK™ 2 GP ID card was used for the identification of gram-positive bacteria.
Table I. Primer pairs used to screen various bacterial and viral infections.
|
Virus/Bacteria |
Target gene |
Primer sequence (5’–3’) |
|
Porcine reproductive and respiratory virus (PRRSV) |
ORF7 |
F: CCAGTTCCAGCCAGTCAATCA |
|
R: GCCCCGATTGAATAGGTGAC |
||
|
Porcine Circovirus 2 (PCV2) |
ORF2 |
F: AAGGGCTGGGTTATGGTATG |
|
R: CGCTGGAGAAGGAAAAATGG |
||
|
Pseudorabies virus (PRV) |
gE |
F: ATGGGCATCGGCGACTACCT |
|
R: CCACCGCCACAAAGAACACG |
||
|
Porcine respiratory coronavirus (PRCV) |
Nucleocapsid |
F: AGCTATTGGACTTCAAAGGAAGATG |
|
R: CATAGGCATTAATCTGCTGAAGGAA |
||
|
Porcine hemagglutinating encephalomyelitis virus (PHEV) |
Spike protein |
F: CAACCAGATCCTTCCACATATAAAG |
|
R: GAGCAATCATCCTCCACAAGA |
||
|
Porcine cytomegalovirus |
gB |
F: CTCTCAAGAAGATGCCGTCTG |
|
R: CTGCTGATATTCCAAGTGACGTA |
||
|
Swine influenza A virus |
matrix (M) gene |
F: GGCTCTCATGGAATGGCTAAA |
|
R: TGCAGTCCTCGCTCACT |
||
|
Actinobacillus pleuropneumoniae |
omlA |
F: GGGGACGTAACTCGGTGATT |
|
R: GCTCACCAACGTTTGCTCAT |
||
|
Glaesserella parasuis |
CTinfF1 |
F: CGACTTACTTGAAGCCATTCTTCTT |
|
R: CCGCTTGCCATACCCTCTT |
||
|
Pasteurella multocida |
Kmt1 |
F: GGGCTTGTCGGTAGTCTTT |
|
R: CGGCAAATAACAATAAGCTGAGTA |
||
|
Streptococcus suis |
16S rRNA gene |
F: AGAAGAGTGGAAAGTTTCTCA |
|
R: TCACAGTTTCCAAAGCGT |
||
|
Mycoplasma hyopneumoniae |
p102 |
F: GTCAAAGTCAAAGTCAGCAAAC |
|
R: AGCTGTTCAAATGCTTGTCC |
16S rRNA sequence determination and phylogenetic analysis
Genomic DNA was extracted with the TIANamp stool DNA kit (TIANGEN, Beijing, China) in accordance with the manufacturer’s protocol. The 16S rRNA sequences were amplified by PCR with primers (rDNA37f, 5’-AGAGTTTGATCCTGGCTCAGG-3’, positions 8-37, and rDNA1479r, 5’-ACGGCAACCTTGTTACGAGTT-3’, positions 1506-1479) (Twomey et al., 2012). The amplicons were purified using a PCR DNA Gel Purification kit (TIANGEN, Beijing, China) and sequenced by Sangon Biotechnology Co., Ltd. (Shanghai, China). The 16S rRNA sequences were edited with BioEdit Sequence Alignment Editor software version 7.2.6. The sequences obtained from this study were deposited in GenBank under accession numbers ON303629.1, ON307070.1, and ON307071.1. Phylogenetic analysis was performed using mega 7.0.26 through the maximum-likelihood method with reference sequences of V. fluvialis obtained from the GenBank database.
Determination of the minimal inhibitory concentration
The standard agar dilution method, as described by the Clinical Laboratory Standards Institute (CLSI, 2021; Humphries et al., 2021), was employed to determine the minimal inhibitory concentration (MIC) of V. fluvialis isolates against various 16 antimicrobial agents i.e., ampicillin, ceftiofur, ceftriaxone, chloramphenicol, ciprofloxacin, clarithromycin, clindamycin, doxycycline, enrofloxacin, erythromycin, florfenicol, gentamycin, kanamycin, penicillin, tetracycline, and vancomycin (details summarized in Table III). All of these antimicrobials were purchased from the China Institute of Veterinary Drug Control (Beijing, China). As no breakpoint/threshold levels are known for V. fluvialis, antimicrobial resistance was assessed based on MIC values. Staphylococcus aureus strain ATCC25923 was used for quality control.
Results
Pathogen identification
On a global basis, co-infection of various bacterial and viral infections is very common in growing pigs and contributes to a wide range of polymicrobial diseases syndrome (van Dixhoorn et al., 2016; Wang et al., 2016; Kavanová et al., 2018; Saade et al., 2020; Zhao et al., 2020; Kang et al., 2022). The deceased pigs on thorough examination and post-mortem inspection showed signs of encephalitis, pneumonia, spleen enlargement, necrosis, haemorrhages, and consolidation in the lungs (Fig. 1).
All the 78 samples (48 from dead pigs and 30 from healthy pigs) were screened for multiple bacterial and viral infections (details of diseases are summarized in Table I) through PCR (Zeng et al., 2014; Sunaga et al., 2020). Most of the samples were found negative. However, PCV2 was detected in various tissue samples from three deceased pigs and 40% of apparently healthy pigs from the same pen (data not shown). Three V. fluvialis strains (JS5, JS7, and JS12) were identified (by MALDI-TOF-MS) and isolated from the lungs and spleen of deceased animals with a confidence interval of more than 99% among them. All the strains were purified and formed small, pale, and smooth colonies in blood agar (Fig. 2).
Phenotypic characteristics
The biochemical profile of the three V. fluvialis strains (JS5, JS7, and JS12) was identified by VITEK™. The phenotypic characteristics of isolated strains are summarized in Table II. All strains produced acids from pyruvate, cyclodextrin, glycerol, mannitol, ribose, sorbitol, trehalose, and sucrose and failed to form acid from β-D-glucopyranoside, lactose, and raffinose. The strains were motile and grew in broth containing 6.5% NaCl at 10°C. The reactions for α-chymotrypsin, β-mannosidase, and pyroglutamic acid were positive among all studied strains, while reactions for N-acetyl-β-glucosaminidase, β-glucosidase and α-galactosidase were negative. The physiologic characteristics of all three V. fluvialis strains were similar to the description of V. fluvialis ATCC49515T (Fischer and Arneth-Seifert, 1998; Shewmaker et al., 2004). These findings suggest that all three isolated strains (JS5, JS7, and JS12) belong to the species V. fluvialis.
Table II. Phenotypic characteristics of the isolated V. fluvialis strains.
|
Characteristic |
ATCC 49515T# |
JS5 |
JS7 |
JS12 |
|
Growth in 6.5% NaCl |
+ |
+ |
+ |
+ |
|
Growth in 10℃ |
+ |
+ |
+ |
+ |
|
Growth in 45℃ |
- |
- |
- |
- |
|
Motility |
+ |
+ |
+ |
+ |
|
Acid from: |
||||
|
β-D-Glucopyranoside |
- |
- |
- |
- |
|
Pyruvate |
+ |
+ |
+ |
+ |
|
Cyclodextrin |
+ |
+ |
+ |
+ |
|
Glycerol |
+ |
+ |
+ |
+ |
|
Mannitol |
+ |
+ |
+ |
+ |
|
Ribose |
+ |
+ |
+ |
+ |
|
Sorbitol |
+ |
+ |
+ |
+ |
|
Lactose |
- |
- |
- |
- |
|
Trehalose |
+ |
+ |
+ |
+ |
|
Sucrose |
+ |
+ |
+ |
+ |
|
Raffinose |
- |
- |
- |
- |
|
Production of: |
||||
|
N-Acetyl-β-glucosaminidase |
- |
- |
- |
- |
|
α-Chymotrypsin |
+W |
+W |
+ |
+W |
|
β-Glucosidase |
- |
- |
- |
- |
|
α-Galactosidase |
v |
- |
- |
- |
|
β-Mannosidase |
+W |
+W |
+W |
+W |
|
Pyroglutamic acidarylamidase |
+ |
+ |
+ |
+ |
- represents Negative, + represents positive, and +W represents weak positive.
Sequence determination and phylogenetic analysis based on 16S rRNA
The 16S rRNA sequences of the three isolated strains (JS5, JS7, and JS12) were deposited in the GenBank database through accession numbers ON303629.1, ON307070.1, and ON307071.1. A phylogenetic tree was constructed based on the 16S rRNA sequences using the neighbor-joining method (Fig. 3). Among the 16S rRNA sequences of 20 strains (including 17 reference strains gotten from the GenBank database), V. fluvialis JS5 has the highest similarity with V. fluvialis CCUG 32704 (Y18098.1) and V. fluvialis M19 (JF690756.1), both being 99.7% identical. V. fluvialis JS7 also has high similarity with them (both were 99.6% identical) and V. fluvialis JS12 also had the highest identity with V. fluvialis JS7, V. fluvialis GX20 (KU937383.1) and V. fluvialis GX21 (KU937384.1) with 99.3% similarity. V.fluvialis JS5 showed the highest divergence from V. entomophilus VOSTP2 (JQ 363620.1) (6.5%) and a slightly lower divergence from V. salmoninarum CCUG 3339 (Y18097.1) (6.4%). V. fluvialis JS7 showed the highest divergence from V. salmoninarum CCUG 3339 (6.5%) and a slightly lower divergence from V. entomophilus VOSTP2 and V. humatus C25 (KX247009.1) (6.2%). V. fluvialis JS12 had the highest divergence from V. salmoninarum CCUG 3339 (6.4%) and a slightly lower divergence from V. entomophilus VOSTP2 and V. humatus C25 (KX247009.1) (6.2%). Based on our 16S rRNA sequence analysis, all the isolated strains i.e JS5, JS7, and JS12 were identified as strains of V. fluvialis (Fig. 3).
Antimicrobial susceptibility
Sixteen antimicrobial agents were used to investigate their antimicrobial activities against V. fluvialis isolates (Table III). For the interpretation of the results of MIC,
Table III. MIC (μg/mL) data and interpretive criteria of V. fluvialis strains from swine in China.
|
Antimicrobial agents |
ATCC 25922 |
JS5 |
JS7 |
JS12 |
||||||
|
MIC (μg/mL) |
MIC (μg/mL) |
Interpretive criteria |
MIC (μg/mL) |
Interpretive criteria |
MIC (μg/mL) |
Interpretive criteria |
||||
|
Ampicillin |
5 |
8 |
S |
0.5 |
S |
0.5 |
S |
|||
|
Ceftiofur |
0.25 |
2 |
S |
1 |
S |
1 |
S |
|||
|
Ceftriaxone |
- |
1 |
I |
0.25 |
S |
0.25 |
S |
|||
|
Chloramphenicol |
5 |
≤1 |
S |
≤1 |
S |
≤1 |
S |
|||
|
Ciprofloxacin |
- |
4 |
R |
4 |
R |
2 |
I |
|||
|
Clarithromycin |
- |
>2 |
I |
>2 |
I |
>2 |
I |
|||
|
Clindamycin |
- |
>16 |
R |
>16 |
R |
>16 |
R |
|||
|
Doxycycline |
- |
>16 |
R |
4 |
S |
>16 |
R |
|||
|
Enrofloxacyn |
0.025 |
0.25 |
S |
0.5 |
S |
0.25 |
S |
|||
|
Erythromycin |
- |
8 |
R |
4 |
R |
2 |
R |
|||
|
Florfenicol |
5 |
2 |
S |
8 |
R |
4 |
I |
|||
|
Gentamycin |
0.25 |
8 |
R |
4 |
I |
4 |
I |
|||
|
Spectinomycin |
16 |
128 |
R |
64 |
S |
32 |
S |
|||
|
Penicillin |
- |
0.25 |
S |
0.25 |
S |
0.25 |
S |
|||
|
Tetracycline |
1 |
64 |
R |
32 |
R |
64 |
R |
|||
|
Vancomycin |
- |
≤1 |
S |
≤1 |
S |
≤1 |
S |
|||
S, susceptible; I, intermediate; R, resistance.
Table IV. Vagococcus species isolated from various sources.
|
Vagococcus species |
Sample source |
Health status |
Sample type |
Reference |
|
V. fluvialis |
Chicken |
Healthy |
Faeces and river water |
Collins et al., 1989 |
|
V. salmoninarum |
Salmonid fish |
Diseased |
- |
Wallbank et al., 1990 |
|
V. lutrae |
Lutra lutra |
Healthy |
Blood,liver,lungs and spleen |
Lawsone et al., 1999 |
|
V. fessus |
Seal and harbour Porpoise |
- |
Liver and kidneys |
Hoyles et al., 2000 |
|
V. carniphilus |
Cattle |
- |
Ground beef |
Shewmaker et al., 2004 |
|
V. elongatus |
Pig |
- |
Swine-manure storage pit |
Lawson et al., 2007 |
|
V. penaei |
Penaeus vannamei |
- |
Microbiota of cooked shrimp |
Jaffrès et al., 2010 |
|
V. acidifermentans |
Acidogenic fermentation bioreactor |
- |
- |
Wang et al., 2011 |
|
V. entomophilus |
Vespula vulgaris (Wasp) |
- |
Digestive Tract |
Killer et al., 2014 |
|
V. martis |
Martes flavigula |
- |
Small intentine |
Tak et al., 2017 |
|
V. humatus |
Pig |
- |
The soil beneath a decomposing pig carcass |
Sundararaman et al., 2017 |
|
V. teuberi |
Malian sour milk fènè |
- |
Malian sour milk fènè |
Wullschleger et al., 2018 |
|
V. bubulae |
Cattle |
- |
Ground beef |
Shewmaker et al., 2019 |
|
V. vulneris |
Human |
- |
Foot wound |
Shewmaker et al., 2019 |
|
V. silagei |
Brewer's grain (Silage production) |
- |
- |
Wu et al., 2020 |
|
V. xieshaowenii |
Snow finch (Montifringilla taczanowskii) |
Healthy |
Cloacal content |
Ge et al., 2020 |
|
V. coleopterorum |
Diving beetle |
Healthy |
Intestine |
Hyun et al.,2021 |
|
V. hydrophili |
Dark diving beetle |
Healthy |
Intestine |
Hyun et al., 2021 |
|
V. zenguangii |
Yak (Bos grunniens) |
Healthy |
Faeces |
Ge et al., 2021 |
- indicates no status given.
the cut-off points established by the Clinical and Laboratory Standards Institute (CLSI) were used for Enterococcus spp. except in the case of erythromycin, clarithromycin and ceftriaxone, in which those set for the group of Streptococci were used (Racero et al., 2021).
According to the CLSI, Among the 16 kinds of antimicrobial agents, three V. fluvialis were all sensitive to 6 kinds of antimicrobial agents, such as ampicillin, ceftiofur, chloramphenicol, enrofloxacin, penicillin and vancomycin. Among them, V. fluvialis JS5 was also sensitive to florfenicol, V. fluvialis JS7 was also sensitive to ceftriaxone, doxycycline and spectinomycin, V. fluvialis JS12 was also sensitive to ceftriaxone and spectinomycin. On the contrary, Three V. fluvialis were resistant to clindamycin, erythromycin and tetracycline. Among them, V. fluvialis JS5 was also resistant to ciprofloxacin, doxycycline, gentamycin and spectinomycin. V. fluvialis JS7 was resistant to ciprofloxacin. V. fluvialis JS12 was resistant to doxycycline. These data can provide effective suggestions for the use of drugs in pig farms infected with V. fluvialis. And shown that V. fluvialis strains are sensitive to most clinical antibiotics (see Table III for details) This indicated that V. fluvialis strains are susceptible to most clinical antibiotics (details are summarized in Table III).
Discussion
The genus Vagococcus was proposed in 1989 (Collins et al., 1989) to compensate for motile cocci which were identical to Lactococcus and were previously referred to as motile lactic streptococci. They were shown to be unique from all known Lactococcus (Schleifer et al., 1985). There are currently 20 known Vagococcus species that are isolated from a variety of sources including terrestrial, aquatic, insect species, and even animal products (details are summarized in Table IV) (Collins et al., 1989; Wallbanks et al., 1990; Lawson et al., 1999; Hoyles et al., 2000; Shewmaker et al., 2004; Lawson et al., 2007; Jaffrès et al., 2010; Wang et al., 2011; Killer et al., 2014; Sundararaman et al., 2017; Tak et al., 2017; Wullschleger et al., 2018; Shewmaker et al., 2019; Ge et al., 2020; Wu et al., 2020; Ge et al., 2021; Hyun et al., 2021). The 16S rRNA sequencing studies revealed that Vagococcus had a different and well-defined line of descent within lactic acid bacteria which represented a new species named V. fluvialis (Collins et al., 1989). Since its discovery, V. fluvialis have been recovered from diverse sources including human clinical samples (peritoneal fluids, wounds, and blood)(Teixeira et al., 1997), river water and chicken feces (Hashimoto et al., 1974), and various domestic animals (lesions from cattle, cats, horses, pigs, and chickens (Pot et al., 1994) and could be regarded as a potential bacterial pathogen.
In this study, we have identified and characterized three distinct V. fluvialis strains (JS5, JS7, and JS12) that were isolated from deceased pigs in Jiangsu province of China, using their genotypic and morphological characteristics, biochemical profiles, and resistance to commonly used antimicrobial drugs.
Co-infection of various viral and bacterial infections is very common in growing pigs (van Dixhoorn et al., 2016; Wang et al., 2016; Kavanová et al., 2018; Saade et al., 2020; Zhao et al., 2020; Kang et al., 2022). The collected samples were further screened for twelve various diseases to instigate other possible reasons for death (detail of pathogens are summarized in Table I). Most of the samples screened were found negative for all of them. However, PCV2 was detected in various tissue samples from all deceased and fewer healthy pigs (40%) from the same pen suggesting that V. fluvialis may play a role in opportunistic infection (Teixeira et al., 1997; Nguyen et al., 2021). Though, its pathogenicity in pigs and synergistic mechanism with other pathogens need further studies.
Comparative 16S rRNA gene sequencing was performed to determine the phylogenetic affinities of the isolated strains with seventeen other strains gotten from Gene-Bank (Figure Phylogenetic tree) (Stackebrandt and Goebel 1994). Searches revealed that the gene sequences (16S rRNA) of V. fluvialis isolated strains JS5 and JS7 are phylogenetically most closely related to V. fluvialis M19 (JF690756.1), which was isolated from the midgut of Culexq unique fasciatus mosquitos in India (Chandel et al., 2013) and CCUG 32704 (Y18098.1) isolated by Lawson et al. (1999) (submitted). JS12 is closely associated with JS7 and strains GX20 (KU937383.1) and GX21 (KU937384.1), isolated from Guangxi, China in 2017. All the three isolated strains of V. fluvialis (J5, J7, and 12) showed a higher level of divergence (ranging from 6.2 to 6.5 %) with V. entomophilus, VOSTP2 (JQ 363620.1) isolated from the digestive tract of vasp (Killer et al., 2014), V. salmoninarum CCUG 3339 (Y18097.1) isolated by Lawson et al. (1999) (submitted) and V. humatus C25 (KX247009.1) isolated from the soil beneath a decomposing pig carcass in 2016 (Sundararaman et al., 2017).
Potential resistance to the chemotherapeutic drugs may be indicated by the proliferation of bacterial strains in the highest concentrations evaluated for the examined antimicrobials. Results of MIC determinations indicated that these V. fluvialis isolated strains were susceptible to ampicillin, ceftiofur, chloramphenicol, enrofloxacin, penicillin and vancomycin. However, they were found resistant to clindamycin, erythromycin, and tetracycline (details are summarized in Table III). Data obtained using the disc diffusion technique for V. fluvialis strains previously revealed that of the 18 microbial examined, the strain was found to be resistant to nafcillin, kanamycin, clindamycin, nalidixic acid, and norfloxacin (van Belkum et al., 2007). Teixeira et al. (1997) also provided MIC data for this species, which they reported as being resistant to lomefloxacin, ofloxacin, and clindamycin in a different investigation. The sensitivity of V. fluvialis isolated this study to clindamycin , erythromycin and gentamicin was different from the results of the article published by Garcia et al. (2016), The transition was from drug sensitivity to drug resistance, indicating that the sensitivity of V. fluvialis to several commonly used antibiotics is gradually decreasing, which will increase the risk of zoonosis.
This is the first report showing the spreading of V. fluvialis in deceased pigs of Jiangsu, China. The role of this bacteria in illness or death is so far unknown. However, it is significant to highlight that, none of the stains previously isolated from lesions in domestic animals (including cattle and pigs) encode for the genes associated with the virulence factor (Pot et al., 1994; Giannattasio-Ferraz et al., 2021), questioning their potential pathogenic association. Further in vitro and in vivo studies on the isolated strains would be very necessary to sort out whether isolated strains have any pathogenic and/or probiotic potential.
Conclusion
Due to the possible zoonotic potential of the Vagococcus species, V. fluvialis may provide a risk, not only for swine production but also for pig industry workers. The findings in this study could be of great help in understanding the epidemiological behaviour of these neglected pathogens in the swine production system.
DeclarationS
Acknowledgments
We would like to thank Sun Qin and Yang Yang from Shanghai Veterinary Research Institute, Chinese Academy of Agricultural Sciences for their assistance with samples collection.
Funding
This research was funded by supported by the Shanghai Agriculture Applied Technology Development Program, China (no. X2022-02-08-00-12-F01195 and no. X2021-02-08-00-12-F00770 awarded to J.W).
Ethics approval and consent to participate
All animal experiments were approved by the Institutional Animal Care and Use Committee of Shanghai Veterinary Research Institute, China (IACUC No: SVRI-P-2020101206) and performed in compliance with the Guidelines on the Humane Treatment of Laboratory Animals (Ministry of Science and Technology of the People’s Republic of China, Policy No. 2006 398).
Availability of data and materials
All data generated during this study are publicly available. This data can be found at: https://www.ncbi.nlm.nih.gov/nuccore/ON303629.1, https://www.ncbi.nlm.nih.gov/nuccore/ON307070.1, https://www.ncbi.nlm.nih.gov/nuccore/ON307071.1. However, the raw data is available from the corresponding author upon reasonable request.
Statement of conflict of interest
The authors have declared no conflict of interest.
References
Al-Ahmad, A., Pelz, K., Schirrmeister, J.F., Hellwig, E. and Pukall, R., 2008. Characterization of the first oral vagococcus isolate from a root-filled tooth with periradicular lesions. Curr. Microbiol., 57: 235-238. https://doi.org/10.1007/s00284-008-9182-0
Chandel, K., Mendki, M.J., Parikh, R.Y., Kulkarni, G., Tikar, S.N., Sukumaran, D., Prakash, S., Parashar, B.D., Shouche, Y.S. and Veer, V., 2013. Midgut microbial community of culex quinquefasciatus mosquito populations from india. PLoS One, 8: e80453. https://doi.org/10.1371/journal.pone.0080453
CLSI, 2021. Performance standards for antimicrobial susceptibility testing. M100, 31st ed. Clinical and Laboratory Standards Institute, Wayne, PA.
Collins, M.D., Ash, C., Farrow, J.A., Wallbanks, S. and Williams, A.M., 1989. 16s ribosomal ribonucleic acid sequence analyses of lactococci and related taxa. Description of vagococcus fluvialis gen. Nov., sp. Nov. J. appl. Bact., 67: 453-460. https://doi.org/10.1111/j.1365-2672.1989.tb02516.x
Fischer, W. and Arneth-Seifert, D., 1998. D-alanylcardiolipin, a major component of the unique lipid pattern of Vagococcus fluvialis. J. Bact., 180: 2950-2957. https://doi.org/10.1128/JB.180.11.2950-2957.1998
Garcia, V., Abat, C. and Rolain, J.M., 2016. Report of the first Vagococcus lutrae human infection, Marseille, France. New Microbes New Infect., 9: 56-57. https://doi.org/10.1016/j.nmni.2015.11.008
Ge, Y., D. Jin, Lai, X.H., Yang, J., Lu, S., Huang, Y., Zheng, H., Zhang, X. and Xu, J., 2021. Vagococcus zengguangii sp. nov., isolated from yak faeces. J. Microbiol., 59: 1-9. https://doi.org/10.1007/s12275-021-0406-3
Ge, Y., Yang, J., Lai, X.H., Zhang, G., Jin, D., Lu, S., Wang, B., Huang, Y., Huang, Y., Ren, Z., Zhang, X. and Xu, J., 2020. Vagococcus xieshaowenii sp. Nov., isolated from snow finch (Montifringilla taczanowskii) cloacal content. Int. J. Syst. Evol. Microbiol., 70: 2493-2498. https://doi.org/10.1099/ijsem.0.004061
Giannattasio-Ferraz, S., Ene, A., Maskeri, L., Oliveira, A.P., Barbosa-Stancioli, E.F. and Putonti, C., 2021. Vagococcus fluvialis isolation and sequencing from urine of healthy cattle. G3 (Bethesda), 11: 1-5. https://doi.org/10.1093/g3journal/jkaa034
Hashimoto, H., Tosaka, R. and Yanagawa, R., 1974. Distribution of motile streptococci in man, animals and natural environment. Nihon saikingaku zasshi. Jpn. J. Bact., 29: 387-393. https://doi.org/10.3412/jsb.29.387
Hoyles, L., Lawson, P.A., Foster, G., Falsen, E., Ohlen, M., Grainger, J.M. and Collins, M.D., 2000. Vagococcus fessus sp. Nov., isolated from a seal and a harbour porpoise. Int. J. Syst. Evol. Microbiol., 50: 1151-1154. https://doi.org/10.1099/00207713-50-3-1151
Humphries, R., Bobenchik, A.M., Hindler, J.A. and Schuetz, A.N., 2021. Overview of changes to the clinical and laboratory standards institute performance standards for antimicrobial susceptibility testing, m100, 31st edition. J. clin. Microbiol., 59: e0021321. https://doi.org/10.1128/JCM.00213-21
Hyun, D.W., Tak, E.J., Kim, P.S. and Bae, J.W., 2021. Description of Vagococcus coleopterorum sp. nov., isolated from the intestine of the diving beetle, Cybister lewisianus, and Vagococcus hydrophili sp. nov., isolated from the intestine of the dark diving beetle, Hydrophilus acuminatus, and emended description of the genus Vagococcus. J. Microbiol., 59: 132-141. https://doi.org/10.1007/s12275-021-0485-1
Jadhav, K.P. and Pai, P.G., 2019. A rare infective endocarditis caused by Vagococcus fluvialis. J. Cardiol. Cases, 20: 129-131. https://doi.org/10.1016/j.jccase.2019.07.001
Jaffrès, E., Prévost, H., Rossero, A., Joffraud, J.J. and Dousset, X., 2010. Vagococcus penaei sp. nov., isolated from spoilage microbiota of cooked shrimp (Penaeus vannamei). Int. J. Syst. Evol. Microbiol., 60: 2159-2164. https://doi.org/10.1099/ijs.0.012872-0
Kang, L., Wahaab, A., Shi, K., Mustafa, B.E., Zhang, Y., Zhang, J., Li, Z., Qiu, Y., Li, B., Liu, K., Shao, D., Ma, Z., Zhong, D. and Wei, J., 2022. Molecular epidemic characteristics and genetic evolution of porcine circovirus type 2 (pcv2) in swine herds of shanghai, china. Viruses, 14. https://doi.org/10.3390/v14020289
Kavanová, L., Matiašková, K., Levá, L., Nedbalcová, K., Matiašovic, J., Faldyna, M. and Salát, J., 2018. Concurrent infection of monocyte-derived macrophages with porcine reproductive and respiratory syndrome virus and Haemophilus parasuis: A role of ifnα in pathogenesis of co-infections. Vet. Microbiol., 225: 64-71. https://doi.org/10.1016/j.vetmic.2018.09.016
Killer, J., Svec, P., Sedlacek, I., Cernohlavkova, J., Benada, O., Hroncova, Z., Havlik, J., Vlkova, E., Rada, V., Kopecny, J. and Kofronova, O., 2014. Vagococcus entomophilus sp. nov., from the digestive tract of a wasp (Vespula vulgaris). Int. J. Syst. Evol. Microbiol., 64: 731-737. Available from https://doi.org/10.1099/ijs.0.054940-0
Lawson, P.A., Falsen, E., Cotta, M.A. and Whitehead, T.R., 2007. Vagococcus elongatus sp. nov., isolated from a swine-manure storage pit. Int. J. Syst. Evol. Microbiol., 57: 751-754. https://doi.org/10.1099/ijs.0.64730-0
Lawson, P.A., Foster, G., Falsen, E., Ohlen, M. and Collins, M.D., 1999. Vagococcus lutrae sp. nov., isolated from the common otter (Lutra lutra). Int. J. Syst. Bacteriol., 49: 1251-1254. https://doi.org/10.1099/00207713-49-3-1251
Nguyen, V.G., Kim, C.U., Do, H.Q., Shin, S., Jang, K.C., Park, Y.H., Park, B.K. and Chung, H.C., 2021. Characteristics of Aerococcus viridans isolated from porcine fetuses in korean farms. Vet. med. Sci., 7: 1325-1331. https://doi.org/10.1002/vms3.456
Pot, B., Devriese, L.A., Hommez, J., Miry, C., Vandemeulebroecke, K., Kersters, K. and Haesebrouck, F., 1994. Characterization and identification of Vagococcus fluvialis strains isolated from domestic animals. J. appl. Bact., 77: 362-369. Available from https://doi.org/10.1111/j.1365-2672.1994.tb03436.x
Racero, L., Barberis, C., Traglia, G., Loza, M.S., Vay, C. and Almuzara, M., 2021. Infections due to Vagococcus spp. Microbiological and clinical aspects and literature review. Enferm. Inf. Microbiol. Clin. (Engl. Ed.), 39: 335-339. Available from https://doi.org/10.1016/j.eimce.2021.05.002
Roman, L., Real, F., Padilla, D., El-Aamri, F., Deniz, S., Grasso, V. and Acosta, F., 2013. Cytokine expression in head-kidney leucocytes of european sea bass (Dicentrarchus labrax L.) after incubation with the probiotic Vagococcus fluvialis l-21. Fish Shellfish Immunol., 35: 1329-1332. Available from https://doi.org/10.1016/j.fsi.2013.07.036
Roman, L., Real, F., Sorroza, L., Padilla, D., Acosta, B., Grasso, V., Bravo, J. and Acosta, F., 2012. The in vitro effect of probiotic Vagococcus fluvialis on the innate immune parameters of Sparus aurata and Dicentrarchus labrax. Fish Shellfish Immunol., 33: 1071-1075. Available from https://doi.org/10.1016/j.fsi.2012.06.028
Saade, G., Deblanc, C., Bougon, J., Marois-Créhan, C., Fablet, C., Auray, G., Belloc, C., Leblanc-Maridor, M., Gagnon, C.A., Zhu, J., Gottschalk, M., Summerfield, A., Simon, G., Bertho, N. and Meurens, F., 2020. Coinfections and their molecular consequences in the porcine respiratory tract. Vet. Res., 51: 80. https://doi.org/10.1186/s13567-020-00807-8
Schleifer, K.H., Kraus, J., Dvorak, C., Kilpper-Bälz, R., Collins, M.D. and Fischer, W., 1985. Transfer of streptococcus lactis and related streptococci to the genus Lactococcus gen. Nov. Syst. appl. Microbiol., 6: 183-195. https://doi.org/10.1016/S0723-2020(85)80052-7
Schmidtke, L.M. and Carson, J., 1994. Characteristics of vagococcus salmoninarum isolated from diseased salmonid fish. J. appl. Bact., 77: 229-236. https://doi.org/10.1111/j.1365-2672.1994.tb03068.x
Shewmaker, P.L., Steigerwalt, A.G., Morey, R.E., Carvalho, M., Elliott, J.A., Joyce, K., Barrett, T.J., Teixeira, L.M. and Facklam, R.R., 2004. Vagococcus carniphilus sp. Nov., isolated from ground beef. Int. J. Syst. Evol. Microbiol., 54: 1505-1510. https://doi.org/10.1099/ijs.0.02908-0
Shewmaker, P.L., Whitney, A.M., Gulvik, C.A., Humrighouse, B.W., Gartin, J., Moura, H., Barr, J.R., Moore, E.R.B., Karlsson, R., Pinto, T.C.A. and Teixeira, L.M., 2019. Vagococcus bubulae sp. nov., isolated from ground beef, and Vagococcus vulneris sp. nov., isolated from a human foot wound. Int. J. Syst. Evol. Microbiol., 69: 2268-2276. https://doi.org/10.1099/ijsem.0.003459
Sorroza, L., Padilla, D., Acosta, F., Roman, L., Grasso, V., Vega, J. and Real, F., 2012. Characterization of the probiotic strain Vagococcus fluvialis in the protection of european sea bass (Dicentrarchus labrax) against vibriosis by Vibrio anguillarum. Vet. Microbiol., 155: 369-373. https://doi.org/10.1016/j.vetmic.2011.09.013
Stackebrandt, E. and Goebel, B.M., 1994. Taxonomic note: A place for DNA-DNA reassociation and 16s rrna sequence analysis in the present species definition in bacteriology. Int. J. Syst. Bacteriol., 44: 846-849. https://doi.org/10.1099/00207713-44-4-846
Sunaga, F., Tsuchiaka, S., Kishimoto, M., Aoki, H., Kakinoki, M., Kure, K., Okumura, H., Okumura, M., Okumura, A., Nagai, M., Omatsu, T. and Mizutani, T., 2020. Development of a one-run real-time pcr detection system for pathogens associated with porcine respiratory diseases. J. Vet. Med. Sci., 82: 217-223. https://doi.org/10.1292/jvms.19-0063
Sundararaman, A., Srinivasan, S. and Lee, S.S., 2017. Vagococcus humatus sp. nov., isolated from soil beneath a decomposing pig carcass. Int. J. Syst. Evol. Microbiol., 67: 330-335. https://doi.org/10.1099/ijsem.0.001625
Tak, E.J., Kim, H.S., Lee, J.Y., Kang, W., Hyun, D.W., Kim, P.S., Shin, N.R. and Bae, J.W., 2017. Vagococcus martis sp. Nov., isolated from the small intestine of a marten, martes flavigula. Int. J. Syst. Evol. Microbiol., 67: 3398-3402. https://doi.org/10.1099/ijsem.0.002131
Teixeira, L.M., Carvalho, M.G., Merquior, V.L., Steigerwalt, A.G., Brenner, D.J. and Facklam, R.R., 1997. Phenotypic and genotypic characterization of Vagococcus fluvialis, including strains isolated from human sources. J. clin. Microbiol., 35: 2778-2781. https://doi.org/10.1128/jcm.35.11.2778-2781.1997
Twomey, D.F., Carson, T., Foster, G., Koylass, M.S. and Whatmore, A.M., 2012. Phenotypic characterisation and 16s rrna sequence analysis of veterinary isolates of Streptococcus pluranimalium. Vet. J., 192: 236-238. https://doi.org/10.1016/j.tvjl.2011.05.007
van Belkum, A., Tassios, P.T., Dijkshoorn, L., Haeggman, S., Cookson, B., Fry, N.K., Fussing, V., Green, J., Feil, E., Gerner-Smidt, P., Brisse, S. and Struelens, M., 2007. Guidelines for the validation and application of typing methods for use in bacterial epidemiology. Clin. microbiol. Infect. Off. Publ. Eur. Soc. Clin. Microbiol. Infect. Dis., 13(Suppl 3): 1-46. https://doi.org/10.1111/j.1469-0691.2007.01786.x
van Dixhoorn, I.D., I. Reimert, J. Middelkoop, J.E. Bolhuis, H.J. Wisselink, P.W. Groot Koerkamp, B. Kemp and N. Stockhofe-Zurwieden, 2016. Enriched housing reduces disease susceptibility to co-infection with porcine reproductive and respiratory virus (prrsv) and Actinobacillus pleuropneumoniae (A. pleuropneumoniae) in young pigs. PLoS One, 11: e0161832. https://doi.org/10.1371/journal.pone.0161832
Wallbanks, S., Martinez-Murcia, A.J., Fryer, J.L., Phillips, B.A., and Collins, M.D., 1990. 16s rrna sequence determination for members of the genus carnobacterium and related lactic acid bacteria and description of Vagococcus salmoninarum sp. nov. Int. J. Syst. Bact., 40: 224-230. https://doi.org/10.1099/00207713-40-3-224
Wang, H., Feng, Z., Wu, Y., Wei, Y., Gan, Y., Hua, L., Li, B., Wang, X., Liu, M., Xiong, Q. and Shao, G., 2016. The effects of Mycoplasma hyopneumoniae on porcine circovirus type 2 replication in vitro pk-15 cells. Res. Vet. Sci., 105: 56-61. https://doi.org/10.1016/j.rvsc.2016.01.015
Wang, L., Cui, Y.S., Kwon, C.S., Lee, S.T., Lee, J.S. and Im, W.T., 2011. Vagococcus acidifermentans sp. Nov., isolated from an acidogenic fermentation bioreactor. Int. J. Syst. Evol. Microbiol., 61: 1123-1126. https://doi.org/10.1099/ijs.0.022087-0
Wu, Y.C., Lin, S.T., Guu, J.R., Tamura, T., Mori, K., Wang, L.T., Huang, L. and Watanabe, K., 2020. Vagococcus silagei sp. nov., isolated from brewer’s grain used to make silage in taiwan. Int. J. Syst. Evol. Microbiol., 70: 1953-1960. https://doi.org/10.1099/ijsem.0.003999
Wullschleger, S., Jans, C., Seifert, C., Baumgartner, S., Lacroix, C., Bonfoh, B., Stevens, M.J.A. and Meile, L., 2018. Vagococcus teuberi sp. Nov., isolated from the malian artisanal sour milk fene. Syst. appl. Microbiol., 41: 65-72. https://doi.org/10.1016/j.syapm.2017.11.003
Zeng, Z., Liu, Z., Wang, W., Tang, D., Liang, H. and Liu, Z., 2014. Establishment and application of a multiplex pcr for rapid and simultaneous detection of six viruses in swine. J. Virol. Methods, 208: 102-106. https://doi.org/10.1016/j.jviromet.2014.08.001
Zhao, G., Zhang, L., Li, C., Zhao, J., Liu, N., Li, Y., Wang, J. and Liu, L., 2020. Identification of enterobacteria in viscera of pigs afflicted with porcine reproductive and respiratory syndrome and other viral co-infections. Microb. Pathog., 147: 104385. https://doi.org/10.1016/j.micpath.2020.104385