Research Article

Genetic Characterization of Infectious Bursal Disease (Gumboro) in Ismailia Province

Mohamed Helal Selim1,2*, Esraa Fayez El-Sadek3, Mona Rawy Fares3, Wafaa A.A. Ibrahim4, Kareem Saad Swede5

1Animal Disease Research and Diagnostic Laboratory, Department of Veterinary and Biomedical Sciences, College of Agriculture, Food and Environmental Sciences, South Dakota State University, Brookings, SD 57007, USA; 2Biotechnology Department, Animal Health Research Institute, Agricultural Research Center, Ismailia, Egypt; 3Virology Department, Animal Health Research Institute, Agricultural Research Center, Ismailia, Egypt; 4Biotechnology department, Reference laboratory for Veterinary Quality Control on Poultry Production, Animal Health Research Institute, Agricultural Research Center, Ismailia, Egypt; 5Virology Department, Faculty of Veterinary Medicine, El Zagazig University, El Zagazig, Egypt.

Received | July 15, 2025; Accepted | August 26, 2025; Published | September 26, 2025

*Correspondence | Mohamed Helal Selim, Animal Disease Research and Diagnostic Laboratory, Department of Veterinary and Biomedical Sciences, College of Agriculture, Food and Environmental Sciences, South Dakota State University, Brookings, SD 57007, USA; Email: [email protected]

Citation | Selim MH, El-Sadek EF, Fares MR, Ibrahim WAA, Swede KS (2025). Genetic characterization of infectious bursal disease (Gumboro) in Ismailia Province. Adv. Anim. Vet. Sci., 13(10):2168-2178.

DOI | https://dx.doi.org/10.17582/journal.aavs/2025/13.10.2168.2178

ISSN (Online) | 2307-8316

Copyright: 2025 by the authors. Licensee ResearchersLinks Ltd, England, UK.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

Introduction

Infectious bursal disease (IBD) is an acute, highly contagious disease affecting the lymphocytes in lymphoid organs (primarily the bursa of Fabricius) of young chickens, causing high mortalities and immune suppression (Mosa et al., 2023). IBD virus (IBDV) is a linear double-stranded non-enveloped bi-segmented RNA virus belonging to the genus Avibirnavirus, family Birnaviridae (ICTV Taxonomy, 2023). The total length of the IBDV genome is 6 kbp, composed of two segments: Segment A is the longest segment (3.1–3.6 kbp), while Segment B is the shortest, ranging from 2.8 to 3.3 kbp. Segment A contains two overlapping open reading frames (ORFs). The first ORF encodes for VP0, which subsequently processes into two structural proteins, pVP2 (capsid protein) and VP3, and one nonstructural protein VP4 (Chevalier et al., 2002). The second ORF encodes VP5, with regulatory and anti-apoptotic activities (Ebrahimi et al., 2020). Segment B translates to RNA-dependent RNA polymerase VP1, which is responsible for virus replication (Swayne et al., 2019). VP2 is a trimerized spike, representing the main component of the IBDV capsid (Coulibaly et al., 2010), which comprises two conserved ends (shell and base) and a variable projection which contains the hypervariable region (hvVP2) located at 206-350 amino acids (aa) (Luque et al., 2007).

Two main serotypes of IBDV have been determined based on virus neutralization; serotype I is pathogenic to chickens, causing IBDV infections, whereas serotype II is apathogenic and mainly detected in turkeys (Swayne et al., 2019). Serotype I, IBDVs can be classified into seven major genogroups, with A222, I242, I256, and I294 aa identified as conserved motifs for very virulent (vv)IBDVs (Michel and Jackwood, 2017). However, this classification was insufficient for proper genotyping (Jackwood et al., 2018). Thus, global IBDVs have been recently classified according to combining VP2 (nine genogroups A1-A9) and VP1 (five genogroups B1-B5), into four main genotypes: A1B1 (classic virulent cvIBDV), A2B2 (variant IBDV), A3B2 (very virulent vvIBDV), and A9B1 (attenuated IBDV) (Gao et al., 2023; Islam et al., 2021; Zhang et al., 2022).

Vaccination is the main way to mitigate the seriousness of IBDV infection and reduce the incidence of the disease by both live and inactivated vaccines (Baron et al., 2018). Inactivated vaccination of breeders provides the young broilers with maternal-derived antibodies (MDAs), preventing IBDV infection during the first 15-20 days of life (Jackwood, 2017). However, the live vaccines were associated with safety and efficacy concerns (Olesen et al., 2018). Therefore, two new generation vaccines, including live recombinant vector vaccines expressing VP2, like the herpesvirus of turkey HVT (Prandini et al., 2016), and the immune complex vaccine (Abou El-Fetouh et al., 2020), were developed to address these concerns.

In Egypt, the first record of IBDV infection was in 1974 (El-Sergany, 1974), while in 1989, the detection of vvIBDV was confirmed (Mawgod et al., 2014). Since that time, the vvIBDVs have circulated in Egyptian chicken farms, and several recurrent outbreaks have been reported in various locations at the age of 3-6 weeks, despite the application of different vaccination programs (Mawgod et al., 2014; Omar et al., 2021). Recently, a novel variant of BDV (A2DB2) has been detected in Egyptian chicken farms (Legnardi et al., 2023), exacerbating the situation and increasing the burden on producers.

In this study, we experienced a severe outbreak of highly virulent IBVs among various chicken farms, regardless of the vaccination programs and biosecurity standards implemented in these farms. Thus, the primary objective of this study was to identify the cause of the recent IBDV outbreak among Ismailia chicken farms and confirm any novel mutations. Additionally, we conducted a field-based evaluation of the various commercial vaccines used on the affected farms under investigation. We reported the genetic substitutions that may affect the effectiveness of vaccination.

Materials and Methods

Sample collection and preparation

A total of 150 bursae were collected from 30 farms (5 bursae per farm) between 2022 and 2024, from various locations in Ismailia Governorate, which is characterized by extensive chicken production. Five bursae were physically processed by adding 10 mL of sterile HBSS (Hanks’ balanced salt solution) and subjected to three cycles of freezing, thawing, and homogenization between each cycle using a mortar and pestle with sterile sand to ensure appropriate processing. After the third freezing and thawing, the homogenized bursae were placed in a sterile 15 mL tube, followed by centrifugation at 4000 × g for 10 minutes at 4 °C. Following centrifugation, the clear supernatant was transferred to a sterile 15 mL tube and stored at -80 °C until further examination.

RNA extraction and Real-time qRT-PCR

Viral RNA was extracted from the tissue supernatants using the QIAamp viral RNA Mini Kit (Qiagen, Germany, GmbH) according to the manufacturer’s instructions. Real-time qRT-PCR was performed to determine relative amounts of VP2 gene transcripts in bursal samples using the primer-probe combinations delivered from Metabion (Germany) targeting a 69 bp amplicon; IBD-F GAGGTGGCCGACCTCAACT, IBD-R AGCCCGGATTATGTCTTTGAAG and IBD-Probe [FAM] TCCCCTGAAGATTGCAGGAGCATTTG [TAMRA], as previously described by Moody et al. (2000). The real-time qRT-PCR conditions started with reverse transcription at 55°C for 30 min, followed by initial denaturation at 94°C for 15 min, and 40 cycles of denaturation at 94°C for 15 sec, annealing at 59°C for 30 sec, and extension at 72°C for 30 sec. The reaction was done in a Stratagene MX3005P real-time PCR machine.

 

Table 1: Primers used in conventional RT-PCR for IBDV typing.

Reference	Length of amplified product (bp)	Primer sequence (5'-3')	Target gene
Nwagbo et al., 2016	722	5'CATAAAGCCTACAGCTGGAC3'	VP1
		5'GTCCACTTGATGACTTGAGG3'
Metwally et al., 2009	620	5'TCACCGTCCTCAGCTTACCCACATC3'	VP2
		5'GGATTTGGGATCAGCTCGAAGTTGC3'

 

Conventional RT-PCR amplification of partial VP1 and VP2 genes for sequencing

Initially, the chosen samples were tested by conventional RT-PCR via two sets of primers supplied by Metabion (Germany), which were used for the amplification of B marker, a 722 bp fragment of VP1 (Nwagbo et al., 2016) and a 620 bp fragment of VP2 (Metwally et al., 2009) (Table 1). The reaction was performed in a Biometra thermal cycler. The RT-PCR condition was an initial reverse transcription, which was performed at 50 °C for 30 min, a primary denaturation step was done at 95°C for 5 min, followed by 35 cycles of 94°C for 30 sec., annealing (55°C for 40 sec for VP1 and 60OC for 40 sec for VP2) and extension 72OC for 45 seconds. The final extension step was done at 72°C for 10 min. The products were separated by electrophoresis on a 1.5% agarose gel (Applichem). The gel was photographed by a gel documentation system (Alpha Innotech, Biometra), and the data were analyzed through computer software.

Sequence analysis

The expected-size bands of the selected amplified fragments of VP1 and VP2 were subjected to sequencing. The PCR products were first purified using AMPure XP beads and then sequenced directly using a Big Dye Terminator v3.1 Cycle Sequencing Kit through the Sanger Sequencing Terminator machine (Applied Biosystems). The purified PCR products were sequenced using forward and reverse primers, following the manufacturer’s instructions.

Phylogenetic analysis

The phylogenetic relationship between the hvVP2 and B markers of VP1 from the sequenced samples in this study was compared with the representative sequences mentioned in Tables 2 and 3 for each genogroup of IBDV, according to the recent classification proposed by Gao et al. (2023). Two separate maximum likelihood trees with 1000 bootstrap replicates were reconstructed based on VP1 and VP2, including the new sequences of this study, using IQ-TREE2 and the best-fit TIM2e+G4 model chosen according to BIC. Multiple sequence alignments were performed using Muscle, and the identity matrix was created using Genious software for VP2 and VP1 separately (Kearse et al., 2012). Deduced amino acid sequence alignments of the hvVP2 (210-325 aa) and VP1 (20-250 aa) were conducted between the newly detected strains and the representative sequences of vvIBDs and vaccine strains widely used in commercial vaccines, using BioEdit software.

 

Table 2: The representative reference sequences of hvVP2 of genogroups (1-9) used in the phylogenetic analysis in this study.

Year of isolation	Location of isolation	Strain accession number
SEP/2018	EGYPT	MK496544.1
2022	EGYPT	OQ030208.1
Strain 91168 (Vaccinal strain)		Y14957.1
2014	EGYPT	MH078255.1
1998	EGYPT	MH078253.1
2022	EGYPT	OR791878.1
SEP/2018	EGYPT	MK496541.1
2017	EGYPT	MT840281.1
2015	EGYPT/Domitta	KY610531.1
1999	EGYPT	KY610528.1
Isolate 99323 (Vaccinal strain)		AJ583500.1
2015	EGYPT/Domitta	KY597836.1
2015	EGYPT (isolate509)	MF142543.1
2016	Morroco (ISOLATE 752)	MF142572.1
2015	EGYPT/Dakahlia	KY597834.1
2015	EGYPT/Domitta	KY597835.1
2022	EGYPT	OQ030204
2015	Algeria	KY555576.1
Strain 94432 (Vaccinal strain)		Y14955.1
Faragher 52/70 (Vaccinal strain)		Y14958.1
Faragher 52/70	United kingdom	HG974565
Bursavac (Vaccinal strain)		AF498633.1
Bursine2 (Vaccinal strain)		AF498631.1
(spain4178EV04 vp1 gene)	Spain	EU162081.1
Bursine plus (Vaccinal strain)		AF498632.1
2018	USA	MH329181.1
(Int/228E VP2 gene)	Taiwan	AF457104.1

 

Statistical analysis

Linear correlation analysis was performed to assess the relationship between the Ct values of the IDBV detected

 

Table 3: The representative reference sequences of VP1 of genogroups (1-5) used in the phylogenetic analysis in this study.

Strain accession number	Location of isolation	Year of isolation
KY597863.1	Egypt/Domitta	2015
KY597861.1	Egypt/Domitta	2015
KY597859.1	Egypt	1999
OR791871.1	Egypt	2022
AF240687.1	Netherlands	1989
MT935649.1	France	2019
MT066170.1	China	2019
MT935635.1	France	2019
OP978046.1	Poland	2017
OQ883724.1	Egypt	2022
OQ883728.1	Egypt	2022
DQ679811.1	Holland	2007
MF576307.1	India	2015
KX759563.1	Poland	2014
MG739299.1	Finland	2014
AF083092.1	Winterfield	1999
AJ878657.1	Strain 228E (Vaccinal strain)
AJ878655.1	Bursine 2 (Vaccinal strain)
EU162090.1	Isolate D78(Vaccinal strain)
OR791866.1	Egypt	2023
OR791872.1	Egypt	2023

 

by real-time qRT-PCR, mortality rate, and the severity of infection (mild, moderate, and severe) according to our proposed scheme, with the vaccines applied in the farms under investigation. Using Microsoft Excel for data analysis, the regression produced the slope, intercept, coefficient of determination (R²), 95% confidence intervals for the slope, and the p-value for statistical significance. A scatter plot with a fitted linear regression line was generated to illustrate the relationship among Ct values, mortality rates, infection severity, and vaccines applied, with R² and p-values indicating the strength and significance of this correlation.

Results

Clinical investigation for chickens

Farm investigations were started immediately after the appearance of IBDV infection-related signs. To facilitate the accuracy of our surveillance, we developed a specific scheme that is based on four definite criteria: (1) The signs related to IBDV infection, including a sudden onset of infection characterized by loss of appetite, ruffled feathers, huddling, inability to move, shivering, dehydration, whitish diarrhea, and chalky vents. (2) The significant spiking mortality curve, which typically lasts 5-7 days, peaking on the third day after the onset of infection, with a quick recovery by the 7th day. (3) We developed a distinctive severity score to assess the severity of IBDV infection in all farms under investigation. This score is based on clinical signs and post-mortem lesions, including bursal lesions, thigh hemorrhage, renal lesions, and persistence of the mortalities. The score has three grades, mild, moderate, and severe, as outlined in Figure 1. (4) The Bursae showed IBDV-related infection lesions were collected during the middle of the infection and mortality curve (3-4 days) and subjected to IBDV-specific real-time RTqPCR.

 

The farms that possessed all four of these criteria, with Ct values for IBDV in the collected bursae, were considered in our study; however, those that did not confirm the presence of IBDV by PCR results were excluded. Interestingly, to verify this scheme, all 30 farms were confirmed to be negative for the universal PCR assay applied in the diagnostic lab of the Animal Health Institute for both high- and low-pathogenic Avian influenza and Newcastle Disease. Most farms under investigation exhibited severe disease conditions, regardless of their vaccination programs. Nevertheless, farms vaccinated with a single dose of hot or intermediate plus vaccines at 14-15 days displayed a reasonable degree of protection against infection, exhibiting a mild clinical disease score and mortality of less than 10% (Figure 2).

 

 

Remarkably, linear regression analysis was performed among the 30 farms to examine the relationship between Ct values, mortalities, and the severity of IBDV infections, as well as their correlation with the vaccination program used in these farms. This regression model showed a negative association between Ct values and mortality, with a 4.3% decrease (R² = 0.43, slope = –0.043, 95% CI = –0.063 to –0.024, p < 0.0001). Overall, vaccinated farms with hot or intermediate plus vaccines had a considerable increase in the Ct values of IBDV, as measured by real-time RT-qPCR, along with a significant (p < 0.0001) reduction in mortality rates compared to other vaccination programs based on intermediate, rHVT-VP2, and immune complex vaccines, as well as non-vaccinated farms. Furthermore, all hot and intermediate plus vaccinated farms had shown mild severity of infection compared to other vaccination programs, which showed severe infection (Figure 3).

Molecular diagnosis of IBDVs

All 30 farms under investigation showed positive real-time RT-qPCR results with Ct values ranging from 18 to 25. Based on our statistical analysis, sequencing was specifically performed only on those samples that exhibited the lowest Ct values, typically around 18-19, and showed severe clinical scores. Fortunately, upon this selection criterion, the three selected samples displayed highly intense bands upon gel electrophoresis, corresponding to the expected fragment sizes as VP1 (722 nucleotides, nt) and hvVP2 (620 nt) (Figure 4), followed by successful sequencing of both hv VP2 and VP1 B markers of the three strains.

Phylogenetic analysis

The phylogenetic analysis of the nucleotide sequences of the hvVP2 (620 nt) (205-330 aa) was conducted according to the recently proposed refined classification by Gao et al. (2023), who classified the IBDVs based on the hvVP2 into nine main genogroups. A maximum likelihood tree, supported by high bootstrap values, showed that the three Ism-1, -2, and -3 sequences clustered within the vvIBDV A3 genogroup, particularly within the clade

 

 

of the Egyptian vvIBDVs (Figure 5). However, all the commercial vaccines used in the infected chicken farms investigated in this study were found to exist in cvIBDVs in both A1 and A9 (F5270 strain). The identity percentage also supported the tree topology, indicating that the three new viral sequences detected in the Ismailia chicken farm outbreaks were closely identical to each other (98.1-98.6% nt and 99-100% aa). The identity percentage between the Ism-1, -2, and -3 and the other vvIBDV in A3 was notably higher than the vaccine strains (Table 4).

 

Table 4: The identity percentage between Ism strains and the other vvIBDVs and vaccinal strains based on hvVP2.

	ISM-1		ISM-2		ISM-3
	na1 %	aa2%	na %	aa %	na %	aa %
ISM-1	ID	ID	98.1	99	98.6	100
ISM-2	98.1	99	ID	ID	98.1	99
ISM-3	98.6	100	98.1	99	ID	ID
vvIBDVs	95.63-994	98.1-100	94.8-98.4	97-100	95.8-99	98-100
Reassortant vvIBDVs	91.9	94.4	92.1	95.1	91.7	94.4
F52/705	93.3	95.8	93.3	96.3	93.3	95.8
Bursavac	92.1	92.4	91.9	93.1	91.9	92.4
Bursine 2	91	91	91.7	91.7	90.8	91
D78	91.7	91.7	91.4	92.4	91.4	91.7
Bursine plus	90.5	91	91.2	91.7	90.3	91
Winterfield	91.7	94.3	91.9	94.8	91.4	94.3
Nobilis E228	91.9	93.1	91.2	93.7	91.7	93.1

 

1 na; nucleotide, 2 aa; amino acids, 3 minimum identity with highly virulent IBDVs, 4 maximum identity with highly virulent IBDVs, 5; grey background commercial IBDV vaccines.

 

The hvVP2 deduced amino acid alignment of the three Ismailia viral sequences and representative sequences of typical and atypical vvIBDVs, reassortant vvIBDVs, and vaccine strains was verified by phylogenetic analysis (Figure 6). It revealed that the Ism-1 and -3 were completely identical with all the typical vvIBDV circulating previously in Egyptian chicken farms, exhibiting all the characteristic amino acid markers of vvIBDV Exceptionally, the Ism-2 displayed a unique substitution at the 299 aa (S299N) which is a characteristic of the vaccine strains, representing the first reported amino acid mutation at that position in all vvIBDVs either in Egypt or worldwide which is related to the vaccine strains.

Regarding the phylogenetic analysis of the B marker of VP1 (722 nt) (20-240 aa) of the detected viral sequences in Ismailia, the maximum likelihood tree, based on the study by Gao et al. (2023), revealed the clustering of the three strains with the Egyptian vvIBDVs in the B2 genogroup and other global vvIBDVs. While all the vaccine strains existed in the B1 genogroup (Figure 7). The three viral sequences were closely identical to each other. They had high identity

 

 

percentages to the other vvIBDVs (97-98% nt and 99-100% aa), declining to 87-88% nt and 96-97% aa with the vaccines in the B1 genogroup. Additionally, the deduced amino acids alignment revealed no mutations between the current viral sequences and all the representative VP1 sequences of the vvIBDVs, possessing the distinctive genetic markers of the vvIBDVs, the three TDN amino acid residues at positions 145-147aa. Exclusively, the Ism-3 strain displayed a unique substitution V239A, which was unrivaled in all other vvIBDVs and vaccines, except in newly emerged novel antigenic variant IBDVs in Egypt (Figure 8). Then, applying the advanced genetic classification of Gao et al. (2023), which combines both classifications of hvVP2 and the B marker of VP1, revealed that the genotype A3B2 is the dominant strain circulating among the chicken farms in Ismailia province.

Discussion

It is worth noting that the Egyptian vvIBDVs possess a highly invasive nature and antigenic variation to the vaccines based on cvIBDV strains (Samy et al., 2020). Thus, recurrent outbreaks with extensive severity and mortality have been significantly noted among Egyptian chicken farms (Mawgod et al., 2014; Mosad et al., 2024; Samy et al., 2020; Sedeik et al., 2018). This served as the primary motivation for our study, delivering a distinct insight into the disease condition during the recent outbreak in the Ismailia governorate. Unlike most previous studies, we provide a real-world assessment of the commercial vaccines under field conditions during this outbreak, offering a clear view of their efficacy.

The successful sequencing of three clinical bursal samples based on hvVP2 and B marker of VP1 revealed that they belonged to the vvIBDVs, the most common IBDVs circulating in Egyptian chicken farms (Mosad et al., 2024; Shehata et al., 2017), specifically, the typical vvIBDV, possessing A321 in the hvVP2 (Samy et al., 2020).

 

Notably, the three strains studied here, which belonged to the A3B2 genotype of vvIBDV, dominated in the infected chicken farms in Ismailia. Interestingly, this genotype was recently detected in other locations in Egypt (Mosad et al., 2024), causing a severe outbreak regardless of the vaccination programs.

The three viral sequences detected in this study display the main antigenic markers for the vvIBDVs, namely 222A, 242I, 249Q, 253Q, 256I, 272I, 279D, 284A, 294I, and 299S, which distinguish them from the cvIBDVs (Michel and Jackwood, 2017; Yilmaz et al., 2019). Notably, unlike all vvIBDVs, the Ism-2 strain represents the first vvIBDV exhibiting a single substitution at position S299N aa, which has been reported to be a distinctive hallmark of the cvIBDVs, attenuated vaccines, and recently detected vvIBDV reassortants. This could be attributed to the pressure created by the vaccinal pressure (Jackwood, 2012), especially since all the commercial vaccines used in the investigated farms had N amino acid at the 299 position, which could be the possible source of this mutation. Additionally, another single substitution in residue 239 aa of VP1 of the Ism-3 sequence was unmatched in all vvIBDVs. The impact of these mutations on the antigenicity and pathobiology of the detected strains in this study required further molecular characterization and an in vivo pathogenicity study, which would be the next step for our team.

Regarding the assessment of the vaccination programs applied in the farms under our study investigation, it is evident that the farms vaccinated with vaccines based on the hot or intermediate plus strains showed a significant reduction in the severity of the IBDV infection. This is mainly because the capacity of intermediate plus and hot strains to induce rapid replication in the bursa within 6 hours post-vaccination, resulting in potent local bursal immunity (Hamad et al., 2020). Additionally, these vaccines possess the capacity to escape from the MDAs, causing active immunization (Sedeik et al., 2019). This helps these vaccines compete with vvIBDVs for bursal occupation, thereby depriving them of infection. They also promote potent cellular innate immunity (Ramon et al., 2022).

On the other hand, during our surveillance, the other vaccination programs based on intermediate live attenuated vaccines, rHVT+VP2 vaccines, and immune complex vaccines did not show a noticeable degree of protection against the vvIBDV outbreak in the farms under investigation. Firstly, the intermediate live attenuated vaccines are usually negatively impacted by the MDAs, which neutralize these vaccines, rendering them less potent (Rautenschlein et al., 2003). Secondly, the rHVT-VP2 usually lacks active immunization and bursal occupation by the vaccine strain, which is necessary to enhance intra-bursal T cell production (Ramon et al., 2022). However, this field study required subsequent vaccination and challenge studies using these detected strains to provide an accurate view of the potency of the commercial IBDV vaccines against the very virulent strains.

Conclusion

This study presents the first application of the new classification system for IBDVs in Ismailia province, which integrates both VP1 and VP2 segment analyses, revealing the prevalence of the A3B2 genotype associated with a severe outbreak. Notably, two substitutions were detected: The VP2 S299N mutation in Ism-2, which aligns more closely with vaccine strains, and the VP1 A239 mutation in Ism-3, a feature of emerging antigenic variants. These two mutations firstly reported in very virulent IBDVs in Egypt. The impact of these two mutations requires further investigation through whole-genome sequencing and pathogenicity studies. To the best of our knowledge, we conducted a unique real-world assessment of vaccine performance against genetically characterized field strains, revealing widespread vaccine failure against vvIBDVs, except for intermediate-plus and hot-strain vaccines. However, the other commercial vaccines were unable to provide sufficient protection.

Acknowledgments

The authors are thankful to all the farm owners who helped us in this research work and supplied us with all the data and samples required for the study.

Novelty Statement

The novelty of our study lies in detection of two novel mutations in the very virulent IBDVs, as well as field-based study for assessment of disease condition and vaccination programs.

Author’s Contribution

Conceptualization: Mohamed Selim, Esraa Fayez El-Sadek; Data curation: Mona Rawy Fares; Formal analysis: Kareem Saad Swede; Investigation: Esraa Fayez El-Sadek; Methodology: Mohamed Selim, Esraa Fayez El-Sadek, Mona Rawy Fares; Supervision: Mohamed Selim, Wafaa A. A. Ibrahim; Validation: Kareem Saad Swede, Wafaa A. A. Ibrahim; Writing - original draft: Mohamed Selim; Writing - review & editing: Mohamed Selim, Kareem Saad Swede

Funding

This research did not receive support from any funding organizations.

Generative AI and AI-assisted technology statement

We confirm that no generative AI or AI-assisted technologies were used in the preparation of this manuscript.

Conflict of interest

The authors have declared no conflict of interest.

References

Abou El-Fetouh MS, Hafez MH, El-Attar ESR, Ezzat El-Agamy M (2020). Immune-complex infectious bursal disease virus versus live attenuated vaccines to protect SPF chicken against very virulent virus challenge. J. World’s Poult. Res., 10(4): 556–564. https://doi.org/10.36380/jwpr.2020.63

Baron MD, Iqbal M, Nair V (2018). Recent advances in viral vectors in veterinary vaccinology. Curr. Opin. Virol., 29: 1–7. https://doi.org/10.1016/j.coviro.2018.02.002.

Chevalier C, Lepault J, Erk I, Da Costa B, Delmas B (2002). The maturation process of pVP2 requires assembly of infectious bursal disease virus capsids. J. Virol., 76(5): 2384–2392. https://doi.org/10.1128/jvi.76.5.2384-2392.2002

Coulibaly F, Chevalier C, Delmas B, Rey FA (2010). Crystal structure of an Aquabirnavirus particle: Insights into antigenic diversity and virulence determinism. J. Virol., 84(4): 1792–1799. https://doi.org/10.1128/JVI.01536-09

Current ICTV Taxonomy Release ICTV. (n.d.). Retrieved August 12, 2025, from https://ictv.global/taxonomy

Ebrahimi MM, Yousefi AR, Shahsavandi S, Zaghari M, Bassami MR (2020). Comparison of the immunogenicity of four infectious bursal disease intermediate vaccines in commercial broiler flocks in Iran: A field trial study. Arch. Razi Inst., 75(2): 205–212.

El-Sergany HA (1974). A preliminary investigation on the occurrence of Gumboro disease in Egypt. J. Vet. Sci., 11: 7-14.

Gao H, Wang Y, Gao L, Zheng SJ (2023). Genetic insight into the interaction of IBDV with host-a clue to the development of novel IBDV vaccines. Int. J. Mol. Sci., 24(9). https://doi.org/10.3390/ijms24098255

Hamad M, Hassanin O, Ali FAZ, Ibrahim RS, Abd-Elghaffar SK, Saif-Edin M (2020). Comparative study on dynamic and immunopathology of four intermediate-plus infectious bursal disease (IBD) vaccines in commercial broiler chickens. Vet. Res. Commun., 44(3–4): 147–157. https://doi.org/10.1007/s11259-020-09782-z

Islam MR, Nooruzzaman M, Rahman T, Mumu TT, Rahman MM, Chowdhury EH, Eterradossi N, Müller, H (2021). A unified genotypic classification of infectious bursal disease virus based on both genome segments. Avian Pathol. J. W.V.P.A, 50(2): 190–206. https://doi.org/10.1080/03079457.2021.1873245

Jackwood DJ (2012). Molecular epidemiologic evidence of homologous recombination in infectious bursal disease viruses. Avian Dis., 56(3): 574–577. https://doi.org/10.1637/10053-010912-ResNote.1

Jackwood DJ (2017). Advances in vaccine research against economically important viral diseases of food animals: Infectious bursal disease virus. Vet. Microbiol., 206: 121–125. https://doi.org/10.1016/j.vetmic.2016.11.022

Jackwood DJ, Schat KA, Michel LO, de Wit S (2018). A proposed nomenclature for infectious bursal disease virus isolates. Avian Pathol., 47(6): 576–584. https://doi.org/10.1080/03079457.2018.1506092

Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C, Thierer T, Ashton B, Meintjes P, Drummond A (2012). Geneious basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinf., 28(12): 1647–1649. https://doi.org/10.1093/bioinformatics/bts199

Legnardi M, Poletto F, Talaat S, Selim K, Moawad MK, Franzo G, Tucciarone CM, Cecchinato M, Sultan H (2023). First detection and molecular characterization of novel variant infectious bursal disease virus (Genotype A2dB1b) in Egypt. Viruses, 15(12): 2388. https://doi.org/10.3390/v15122388

Luque D, Saugar I, Rodríguez JF, Verdaguer N, Garriga D, Martín CS, Velázquez-Muriel JA, Trus BL, Carrascosa JL, Castón JR (2007). Infectious bursal disease virus capsid assembly and maturation by structural rearrangements of a transient molecular switch. J. Virol., 81(13): 6869–6878. https://doi.org/10.1128/JVI.00077-07

Mawgod SA, Arafa AS, Hussein HA (2014). Molecular genotyping of the infectious bursal disease virus (IBDV) isolated from Broiler Flocks in Egypt. Int. J. Vet. Sci. Med., 2(1): 46–52. https://doi.org/10.1016/j.ijvsm.2014.02.004

Metwally AM, Yousif AA, Shaheed IB, Mohammed WA, Samy AM, Reda IM (2009). Re-emergence of very virulent IBDV in Egypt. Int. J. Virol., 5(1): 1–17. https://doi.org/10.3923/ijv.2009.1.17

Michel LO, Jackwood DJ (2017). Classification of infectious bursal disease virus into genogroups. Arch. Virol., 162(12): 3661–3670. https://doi.org/10.1007/s00705-017-3500-4

Moody A, Sellers S, Bumstead N (2000). Measuring infectious bursal disease virus RNA in blood by multiplex real-time quantitative RT-PCR. J. Virol. Methods, 85(1–2): 55–64. https://doi.org/10.1016/S0166-0934(99)00156-1

Mosa MI, Salem HM, Bastami MA, Amer MM (2023). Pathogenic and non-pathogenic factors; especially infectious bursal disease viruses; affect chicken digestive system microbiota and methods of its evaluation and recovery: A review. Egypt. J. Vet. Sci., 54(4): 733–760. https://doi.org/10.21608/ejvs.2023.203480.1476

Mosad SM, Elsayed MM, Hammad EM, Hendam BM, Ali HS, Eladl AH, Saif MA (2024). Genotype classification and pathogenicity of infectious bursal disease virus circulating in vaccinated broiler chicken farms. Vet. Res. Commun., 48(5). https://doi.org/10.1007/s11259-024-10468-z

Nwagbo IO, Shittu I, Nwosuh CI, Ezeifeka GO, Odibo FJC, Michel LO, Jackwood DJ (2016). Molecular characterization of field infectious bursal disease virus isolates from Nigeria. https://doi.org/10.14202/vetworld.2016.1420-1428

Olesen L, Dijkman R, Koopman R, van Leeuwen R, Gardin Y, Dwars RM, de Bruijn ND, Boelm GJ, Elattrache J, de Wit JJ (2018). Field and laboratory findings following the large-scale use of intermediate type infectious bursal disease vaccines in Denmark. Avian Pathol. J. WVPA, 47(6): 595–606. https://doi.org/10.1080/03079457.2018.1520388

Omar SE, Abd W, Moneim E, Sayed E, Abdelhalim A, Yehia N (2021). J. world’s poultry research genetic evolution of infectious bursal disease virus isolated from chicken poultry flocks in Egypt. J. World Poult. Res., 11(2): 215–222. https://doi.org/10.36380/jwpr.2021.26

Prandini F, Simon B, Jung A, Pöppel M, Lemiere S, Rautenschlein S (2016). Comparison of infectious bursal disease live vaccines and a HVT-IBD vector vaccine and their effects on the immune system of commercial layer pullets. Avian Pathol. J WVPA, 45(1): 114–125. https://doi.org/10.1080/03079457.2015.1127891

Ramon G, Legnardi M, Cecchinato M, Cazaban C, Tucciarone CM, Fiorentini L, Gambi L, Mato T, Berto G, Koutoulis K, Franzo G (2022). Efficacy of live attenuated, vector and immune complex infectious bursal disease virus (IBDV) vaccines in preventing field strain bursa colonization: A European multicentric study. Front. Vet. Sci., 9. https://doi.org/10.3389/fvets.2022.978901

Rautenschlein S, Yeh HY, Sharma JM (2003). Comparative immunopathogenesis of mild, intermediate, and virulent strains of classic infectious bursal disease virus. Avian Dis., 47(1): 66–78. https://doi.org/10.1637/0005-2086(2003)047[0066:CIOMIA]2.0.CO;2

Samy A, Courtillon C, Briand FX, Khalifa M, Selim A, Arafa AES, Hegazy A, Eterradossi N, Soubies SM (2020). Continuous circulation of an antigenically modified very virulent infectious bursal disease virus for fifteen years in Egypt. Infect. Genet. Evol. J. Mol. Epidemiol. Evolut. Genet. Infect. Dis., 78. https://doi.org/10.1016/j.meegid.2019.104099

Sedeik ME, Awad AM, Rashed H, Elfeil WK (2018). Variations in pathogenicity and molecular characterization of infectious bursal disease virus (IBDV) in Egypt. Am. J. Anim. Vet. Sci., 13(2): 76–86. https://doi.org/10.3844/ajavsp.2018.76.86

Sedeik ME, El-Shall NA, Awad AM, Abd El-Hack ME, Alowaimer AN, Swelum AA (2019). Comparative evaluation of HVT-IBD vector, immune complex, and live IBD vaccines against vvIBDV in commercial broiler chickens with high maternally derived antibodies. Animals, 9: 72. https://doi.org/10.3390/ani9030072

Shehata AA, Sultan H, Halami MY, Talaat S, Vahlenkamp TW (2017). Molecular characterization of very virulent infectious bursal disease virus strains circulating in Egypt from 2003 to 2014. Arch. Virol., 162(12): 3803–3815. https://doi.org/10.1007/s00705-017-3554-3

Swayne DE, Boulianne M, Logue CM, McDougald LR, Nair V, Suarez DL, De Wit S, Grimes T, Johnson D, Kromm M, Prajitno TY, Rubinoff I, Zavala G (2019). 14th edition: Diseases of poultry. Dis. Poult., pp. 1–1451. https://doi.org/10.1002/9781119371199

Yilmaz A, Turan N, Bayraktar E, Gurel A, Cizmecigil UY, Aydin O, Bamac OE, Cecchinato M, Franzo G, Tali HE, Cakan B, Savic V, Richt JA, Yilmaz H (2019). Phylogeny and evolution of infectious bursal disease virus circulating in Turkish broiler flocks. Poult. Sci., 98(5): 1976–1984. https://doi.org/10.3382/ps/pey551

Zhang W, Wang X, Gao Y, Qi X (2022). The over-40-years-epidemic of infectious bursal disease virus in China. Viruses, 14(10). https://doi.org/10.3390/v14102253