PJZ_57_6_2725-2735

INTRODUCTION

The striped murrel (Channa striata) is an air-breathing freshwater carnivore fish that lives in all types of water bodies, from shallow muddy waters to lakes and rivers (Chen, 1990). As a result, the intensive production of striped murrel has increased worldwide (Hung and Huy, 2007). Striped murrel is a highly carnivore fish species requiring high dietary protein (Samantaray and Mohanty, 1997; Hua et al., 2019). In formulated diets, protein is the most expensive nutrient component, and it decides almost half of the percentage of feed production cost. Fish meal (FM) is the primary source of protein ingredient in the striped murrel diet because of its palatability and acceptability, providing indispensable amino acids, fatty acids, and unknown growth factors. However, worldwide FM production is continuously decreasing with increasing demand for the expansion of aquaculture and other livestock production (FAO, 2022). Consequently, the striped murrel formulated diet is relatively expensive in the commercial market. Therefore, developing alternative protein ingredients that are cheap, locally available, and less expensive than FM is highly required.

Among animal by-products, poultry by-product meal (PBM) is a highly available, sustainable, and comparatively cheaper ingredient than fish meal. Additionally, it has high nutritional values such as high crude protein (58-65%), protein digestibility values (87-91%) (Bureau et al., 1999; Yu, 2004; Irm et al., 2020), appropriate levels of essential amino acid and fatty acid profiles, micronutrients such as vitamin and minerals and palatability enhancers (Cruz-Suárez et al., 2007). Hence, PBM is proven to be the most efficient protein ingredient as an alternative to FM protein in different carnivore fishes including striped murrel (Abdul-Halim et al., 2014), spotted rose snapper (Hernández et al., 2014), black sea bream (Irm et al., 2020), barramundi (Siddik et al., 2019; Chaklader et al., 2021) and tilapia (Palupi et al., 2020; Sathishkumar et al., 2021). Nevertheless, a higher inclusion level of PBM diets hampered the growth performance in many carnivore fishes due to the lack of some essential amino acids, fatty acids, and attractability compared to FM (Nengas et al., 1999; Cheng et al., 2002; Chaklader et al., 2020).

Fish protein hydrolysate (FPH) is a by-product resulting from the solubilization of fish and shellfish proteins into simple fragments such as free amino acids, peptides, and oligopeptides using either chemical (e.g., acid and alkaline) and enzymatic (e.g., protease) treatments (Kristinsson and Rasco, 2000). Due to the positive dietary effects of FPH, it is added as supplement, immune-stimulant, attractant and an alternative ingredient to successfully replace FM partially or completely in different marine and freshwater fishes including Atlantic salmon (Hevrøy et al., 2005), red sea bream and olive flounder (Khosravi et al., 2015), European seabass (Delcroix et al., 2015), juvenile barramundi (Siddik et al., 2020), Atlantic cod (Johannsdottir et al., 2014) and striped murrel (Siddaiah et al., 2022). Moreover, FPH added as a supplement to the low-level FM-based diet has improved the growth and immune status of carnivore fishes like Channa striata (Suratip et al., 2023) and Lates calcarifer (Chaklader et al., 2020; Hong et al., 2021). Only a limited number of studies have been conducted on PBM as a dietary substitute for FM protein in striped murrel. Moreover, FPH supplemented with PBM in the diets of striped murrel has yet to be evaluated. Therefore, this study has been designed to evaluate the effects of dietary substituting FM protein with PBM and supplementation of FPH on growth performance, nutrient utilization, whole-body composition and growth gene (IGF-1) expression of striped murrel (Channa striata).

MATERIALS AND METHODS

Experimental fish and rearing conditions

The striped murrel (Channa striata) fingerlings (2.43±0.35 g) were obtained from Maria Integrated Fish Farm, Thiruvannamalai district, Tamil Nadu, India. Initially, the striped murrel fingerlings were acclimated to experimental conditions for a month in nursery tanks (4m x 4m x 1.5m). During the acclimatization period, the fish were fed with a commercial diet containing 44% crude protein and 10% crude lipids (Growel Feeds Pvt. Ltd., Andhra Pradesh, India) five times per day till satiation to reduce the cannibalistic activity of striped murrel. After acclimatization, a total number of 450 striped murrel juveniles (initial weight of 10.02±0.15g) were randomly distributed into 15 experimental cages (1m x 1m x 1.5 m) at the stocking density of 30 fish/cage. The experimental cages were installed in a cement tank (4m x 4m x 1.5m). Totally 15 experimental cages were utilized for this study, each treatment performed with three replicates (n=3). The fish were fed to satiety thrice daily at 08.00, 13.00, and 18.00 h for 60 days. During the feeding trial, the water quality parameters such as temperature, dissolved oxygen, pH, ammonia-N, nitrite-N, hardness, and total alkalinity were measured, and it was maintained at the levels of 29.65±0.29℃, 5.53±0.25 mg/L, 8.05±0.25, 0.58±0.28 mg/L, 0.48±0.15 mg/L, 175±15 mg/L and 122±5 mg/L, respectively. All the water quality parameters were analysed using following standard protocols of APHA (2012).

Experimental diet preparation and feeding trial

The PBM and FPH were procured from M/s Pragathi Broilers Pvt Ltd, Chennai, India, and M/s Janatha Fishmeal and Oil Products, Pvt. Ltd. Karnataka, India, respectively. Five experimental diets were formulated and prepared to be nearly isoproteic (44%, crude protein), isolipidic (11%, crude lipid), and isoenergetic (18 MJ/kg, gross energy) containing graded levels (25% and 50%) of PBM and supplemented with FPH. The control diet contained 35% of FM and the first two test diets replaced the FM protein with PBM at levels of 25% and 50% and the other two test diets replaced the FM protein with PBM at levels of 25% and 50% and each diet were supplemented with 3.5% of FPH. The experimental diets were designated as 35 FM (control), 25 PBM, 50 PBM, 25 PBM + FPH, and 50 PBM + FPH. The ingredient and nutritional composition of experimental diets are shown in Table II. The experimental diets were prepared using a twin-screw extruder machine (Jinan Sunpring Machinary, China) in Aqua Feed Extrusion Mill at the Directorate of Incubation and Vocational Training in Aquaculture (DIVA), TNJFU, Chennai, Tamil Nadu, India. All the dry feed ingredients were finely ground with a pulverizer, seized through 180-micron mesh, then added appropriate level of water and thoroughly mixed with a vertical feed mixer. The mixed ingredients were manually transferred into the hopper of the twin screw extruder and extruded through a 2-mm die. During the extrusion, the temperature, pressure, and moisture of the extruder were maintained at levels of 90-95℃, 2-3 bars, and 15-17%, respectively. Then the extruded pellets were dried using a drier at 60℃ for 15 min. After drying, the dried pellets were allowed to be coated with fish oil and palm oil using a Pegasus® vacuum coater (KK Life Sciences, Chennai, India). Finally, the dried pellets were packed in plastic containers and stored at 4℃ until used.

Table I. Proximate and amino acid composition (%, dry weight) of feed ingredients for production of experimental diets.

Compositions	Fish meal	PBM	FPH	Soybean meal	Squid meal	Corn gluten	Wheat flour	Broken rice
Proximate composition
Dry matter	89.4	93.2	94.3	92.7	89.9	92.7	90.1	90.3
Crude protein	65.03	58.5	80.3	50.6	47.54	63.7	12.21	10.06
Crude lipid	8.3	18.0	1.1	1.99	6.54	2.5	2.78	1.82
Crude fibre	< 1.0	1.28	< 1.0	4.77	1.0	< 1.0	1.10	< 1.0
Total ash	12.88	7.3	13.5	6.31	19.39	1.25	0.92	0.58
Gross energy (MJ/Kg)	19.20	22.66	19.43	18.41	16.58	20.27	16.42	16.14
Essential amino acids
Arginine	3.8	5.5	5.49	5.11	4.23	2.01	0.55	0.64
Histidine	1.7	1.03	1.75	1.03	1.02	1.29	0.2	0.2
Isoleucine	2.8	2.6	3.02	1.63	2.78	2.54	0.31	0.33
Leucine	6.4	4	6.3	2.87	4.36	11.36	0.55	0.63
Lysine	5.1	2.1	7.83	1.07	4.69	0.93	0.25	0.3
Methionine	1.7	1.05	3.22	1.2	1.56	1.43	0.12	0.18
Phenylalanine	2.6	2.56	3.83	1.96	2.31	3.59	0.5	0.37
Threonine	2.7	2.11	4.5	1.5	2.06	2.17	0.25	0.33
Tryptophan	0.9	0.37	1.8	0.6	0.2	0	0.12	0
Valine	2.8	3.14	3.3	2.06	2.63	3.06	0.37	0.54
Non-essential amino acids
Alanine	4.3	1.8	4.89	2.01	3.26	5.76	0.27	0.45
Aspartic acid	6.2	3.29	7.58	5.4	4.58	3.83	0.4	0.81
Cystine	1.1	1.31	0.85	0.69	0.1	1.05	0.25	0.07
Glutamic acid	8.1	5.16	9.57	8.32	7.61	12.23	2.95	1.25
Glycine	5	4.15	6.94	1.99	2.36	1.66	0.31	0.35
Serine	2.5	4.86	4.29	2.31	1.96	3.29	0.43	0.41
Tyrosine	2.1	4.75	3.76	7.8	1.85	3.42	0.32	0.36
Total sum of amino acids	59.8	49.78	78.92	47.55	47.56	59.62	8.15	7.22

PBM, Poultry by-product meal; FPH, Fish protein hydrolysate.

Table II. Ingredient and nutrient composition (%, dry weight) of experimental diets.

Ingredients	Experimental diets
Ingredients	35 FM	25 PBM	50 PBM	25 PBM+ 3.5 FPH	50 PBM+ 3.5 FPH
Fish meal1	35	26.25	17.5	25.03	16.28
Poultry by-product meal2	0	9.72	19.44	9.72	19.44
Fish protein hydrolysate3	0	0	0	1	1
Soybean meal4	17	17	17	17	17
Squid meal5	9	9	9	9	9
Corn gluten6	10	10	10	10	10
Wheat flour7	11	11	11	11	11
Broken rice8	6.2	6.43	6.46	6.65	6.68
Fish oil9	3	3	3	3	3
Palm oil10	2.2	1.2	0.2	1.2	0.2
Soy lecithin11	2	2	2	2	2
Di-calcium phosphate12	1	1	1	1	1
Vitamin mix13	1	1	1	1	1
Mineral mix14	1	1	1	1	1
Vitamin – C15	0.2	0.2	0.2	0.2	0.2
DL-Methionine16	0.4	0.2	0.2	0.2	0.2
Pega bind17	1	1	1	1	1
Nutrient composition (%)
Dry matter	90.18	89.88	90.36	90.28	90.13
Crude protein	43.76	43.88	43.92	43.98	44.08
Crude lipid	10.91	10.72	10.93	10.85	11.06
Crude fibre	1.16	1.25	1.35	1.09	1.1
Total ash	10.83	10.88	11.55	11.43	11.01
Calcium	1.88	1.69	1.50	1.66	1.47
Phosphorus	1.37	1.24	1.11	1.23	1.10
Gross energy (MJ/kg)	18.33	18.04	17.9	18.07	18.14

FM, fish meal; PBM, poultry by-product meal; FPH, fish protein hydrolysate. 1Bismi Fisheries Pvt. Ltd., Mayiladuthurai, Tamil Nadu, India. 2Pragathi broilers Pvt Ltd., Chennai, India. 3Janatha Fishmeal and Oil Products, Pvt. Ltd. Karnataka, India. 4Mahindra feeds Pvt. Ltd., Namakkal, Tamil Nadu, India. 5Mahindra feeds Pvt. Ltd., Namakkal, Tamil Nadu, India. 6SPAC Starch Products (India) Pvt Ltd., Erode, Tamil Nadu, India. 7Mahindra feeds Pvt. Ltd., Namakkal, Tamil Nadu, India. 8Mahindra feeds Pvt. Ltd., Namakkal, Tamil Nadu, India. 9Bismi Fisheries Pvt. Ltd., Mayiladuthurai, Tamil Nadu, India. 10Mahindra feeds Pvt. Ltd., Namakkal, Tamil Nadu, India. 11Otto chemie Pvt. Ltd., Mumbai, India. 12, 15Jain industrial chemicals, Chennai, India. 13Anicare Pvt. Ltd., Chennai, Tamil Nadu, India. Composition of vitamin premix (quantity/Kg): Vit. A-10,000,000 IU, Vit. B1-5000 mg, Vit. B2-5000 mg, Vit. B3-6000 mg, Vit. B5-6000 mg, Vit. B6-6000 mg, Vit. C-60,000 mg, Vit. D3-2,000,000 IU, Vit. E-10,000 IU, Vit. H-200 mg. 14Anicare Pvt. Ltd., Chennai, Tamil Nadu, India. Composition of mineral premix (quantity/kg): Magnesium-2800 mg, Iodine-7.4 mg, Iron-7400 mg, Copper-1200 mg, Manganese-11,600 mg, Zinc-9800 mg, Chlorides cobalt-4 mg, Potassium-100 mg, Selenium-4 mg, Calcium carbonate-27.25%, Phosphorous-7.45 mg, Sulphur-0.7 mg, Sodium-6 mg, Calpan-200 mg, Aluminium-1500 mg and Choline chloride-10,000 mg. 16Evonik AG (DL-methionine: MetAMINO® – 99%). 17PEGABIND®, Bentoli Agrinutrition India Pvt. Ltd., Chennai, India.

Growth performance and nutrient utilization analysis

At end of the feeding trial, all fish in each triplicate were starved for 24 h and then anesthetized using tricaine methanesulfonate (MS-222, Sigma-Aldrich Inc.). All fish from each treatment were counted and weighed to estimate the growth parameters such as weight gain (WG), feed intake (FI), percentage weight gain (PWG), average daily growth (ADG), feed conversion ratio (FCR), survival rate (SR), protein efficiency ratio (PER) and specific growth rate (SGR).

The growth performance and nutrient utilization of fish in this feeding trial were calculated as follows:

WG (g) = Final body weight (g) - Initial body weight (g)

FI (g fish-1) = (Dry feed intake (g)/Final body weight (g)/Days of fed)

ADG (g) = (Mean final weight (g) - Mean initial weight (g))/Days of culture

SR (%) = (Number of fish harvested/Number of fish stocked) × 100

SGR (% day− 1) = [(LN (final weight)) - (LN (initial weight)/Number of days)] × 100

Hepatosomatic index (HSI, %) = [Weight of liver (g) / Total weight of fish (g)] × 100

Viscerosomatic index (VSI, %) = [Weight of viscera (g) / Total weight of fish (g)] × 100

PER = Wet weight gain of fish (g)/Protein intake (g)

Lipid efficiency ratio (LER) = Wet weight gain of fish (g) ̸ Lipid intake (g)

Protein retention (PR, %) = 100 × [(Final body weight × Final body protein) - (Initial body weight × Initial body protein)] / Protein consumed

Lipid retention (LR, %) = 100 × [(Final body weight × Final body lipid) - (Initial body weight × Initial body lipid)] / Lipid consumed

Calcium retention (CR, %) = 100 × [(Final body weight × Final body calcium) - (Initial body weight x Initial body calcium)] / Calcium consumed

Phosphorus retention (PR, %) = 100 × [(Final body weight × Final body Phosphorus) - (Initial body weight × Initial body Phosphorus)]/ Phosphorus consumed

Proximate composition and amino acid analysis

Before feeding trial, 15 fish were ice killed, and whole-body samples were taken for estimation of whole-body proximate composition. At the end of the feeding trial, 3 fish from each replicate were ice killed and whole-body samples were taken for whole-body proximate composition. The proximate composition of experimental diets and whole-body samples was estimated following the procedure of AOAC (2010). The moisture level of experimental diets and whole-body were analyzed using a hot air oven at 105°C for 5-h, the kjeldhal method (Kelplus-Distyl Em Ba, Pelican equipments, Chennai, Tamil Nadu, India), and soxhlet method (Socsplus - SCS 04 AS DLSTS, Pelican equipments, Chennai, Tamil Nadu, India) were used to estimate the crude protein and crude lipid content of experimental diets and whole-body samples. The crude fiber content of experimental diets were determined using fiber cap method (FIBRAPLUS FES 04, Pelican equipments, Chennai, Tamil Nadu, India). The total ash content of experimental diets and whole-body samples were assessed using a muffle furnace at 550°C for 6-h. The gross energy content of experimental diets and fish samples was analysed using a bomb calorimeter (IKA-C 6000, IKA® India Private Limited, Bengaluru, India). The amino acid composition of experimental diets and ingredients were determined by ultra-pressure liquid chromatography (UPLC; Model-Waters ACQUITY-UPLC, Waters), following the method of Ishida et al. (1981). In brief, 50 mg of dried samples were transferred to an ampule (Borosil glass) sealed under a stream of nitrogen gas, and the samples were hydrolyzed using 6 N HCl for 24 h at 110°C for neutralization and then filtered with 0.2 μm PTFE filter. The hydrolysis samples were derivatized using AccQ-Tag Ultra Derivatization Kit and separated by Waters ACQUITY UPLC equipped with 2.1 × 100 mm and pore size of 1.7 μm column (AccQ-Tag Ultra C18) following stepwise gradient elution. Amino acid standard H (Product no: WAT088122) was used, and the amino acids were quantified based on the absorbance values at 260 nm measured by a tunable UV detector and analyzed using Empower 2 Software. Amino acid standards were also run simultaneously for calibration. Tryptophan was estimated after alkaline digestion of the sample with lithium hydroxide. he proximate and amino acid composition of feed ingredients and amino acid composition of experimental diets are shown in Tables I and III, respectively.

Quantitative real-time PCR (qRT-PCR) analysis

The total RNA (IGF-1 gene) was extracted from liver samples of experimental fish using PureZOL™ RNA Isolation Reagent (Bio-Rad) according to the manufacturer’s protocol. According to the manufacturer’s iScript cDNA Synthesis Kit (Bio-Rad) protocol, the first-strand cDNA was synthesized from 2 μg of total RNA. In total, 20 μl of the quantitative real-time polymerase chain reaction (qRT-PCR) contains 10 μM of each primer (forward and reverse), 20 ng of cDNA template, and 1× SYBR green PCR master mix kit. The qRT-PCR analysis was performed in C1000 Touch thermal cycler-CFX96 Real-time PCR (Bio-Rad). The thermal cycling conditions were initial denaturation at 95 ℃ for 10 min, followed by 40 cycles of 15 s denaturation at 95 ℃, annealing at 60-62 ℃ (depending on the target genes) for 30 s, extension at 72 ℃ for 30 s ended with dissolution curve. The expression levels of IGF-1 were measured using the formula R = 2−ΔΔCt (Livak and Schmittgen, 2001). The relative expression of the IGF-1 gene was compared using the housekeeping gene β-Actin. The primer sequences (Table IV) and protocols of relative gene expression analysis were acquired by Siddaiah et al. (2022).

Table III. Amino acid composition (%, dry weight) of experimental diets.

Amino acids	Experimental diets
Amino acids	35 FM	25 PBM	50 PBM	25 PBM+ FPH	50 PBM+ FPH
Essential amino acids
Arginine	2.88	3.08	3.29	3.20	3.40
Histidine	1.03	0.98	0.93	0.99	0.94
Isoleucine	1.82	1.82	1.83	1.83	1.84
Leucine	4.36	4.19	4.02	3.96	3.78
Lysine	2.53	2.29	2.04	2.53	2.28
Methionine	1.50	1.26	1.21	1.31	1.27
Phenylalanine	1.89	1.91	1.93	1.90	1.92
Threonine	1.65	1.62	1.59	1.69	1.66
Tryptophan	0.43	0.39	0.34	0.45	0.41
Valine	1.95	2.01	2.07	2.00	2.06
Non-essential amino acids
Alanine	2.77	2.57	2.37	2.52	2.32
Aspartic acid	3.98	3.76	3.53	3.87	3.65
Cystine	0.64	0.67	0.70	0.66	0.69
Glutamic acid	6.56	6.35	6.15	6.21	6.00
Glycine	2.52	2.49	2.46	2.67	2.63
Serine	1.85	2.10	2.35	2.12	2.37
Tyrosine	2.63	2.91	3.18	2.90	3.18
Total sum of amino acids	40.99	40.4	39.99	40.81	40.4

The amino acid composition of experimental diet values are expressed as means of three replicates per treatment (n=3).

Statistical analysis

All data obtained from this study were statistically analyzed using one-way ANOVA following the Duncan multiple range test (Duncan, 1955) using statistical software SPSS 24.0 (SPSS Inc., USA) for Windows to determine the significant difference (p < 0.05) among the treatments. All data are expressed as mean values ± standard deviation (SD) (n=3).

Table IV. Primer sequences used for qRT-PCR analysis of striped murrel.

Gene name

Gen Bank number

Primer sequence (5´−3´)

Hepatic insulin like growth

factor-1 (IGF-1)

JK 546357.1

F TCTGTGATGTTGACGAGTGGT

R AGCCTGAAATGTTGGGAGTG

β-Actin

KC 967219

F GCCTTCCTTCCTTGGTATGG

R GTGTTGGCGTACAG GTCCTT

RESULTS

Growth performance and survival rate of striped murrel

The growth performance and survival rate of striped murrel fed different levels of PBM and supplementation of FPH diets are shown in Table V. Significant differences (p < 0.05) were observed in growth performances such as FW, WG, FI, ADG and SGR of striped murrel fed different levels of PBM and supplementation of FPH diets. However, no significant differences (p > 0.05) were observed in SR, HSI, and VSI and the survival rate was obtained in ranged from 95-98%. Among the dietary groups, significantly higher (p < 0.05) growth performance was observed in fish fed 50 PBM+FPH diet compared to other dietary groups including the control diet (35 FM).

Feed conversion, nutrient utilization, and retention of striped murrel

The feed conversion, nutrient utilization, and retention of striped murrel fed different levels of PBM and supplementation of FPH diets are shown in Table VI. Significant differences (p < 0.05) were observed in FCR, PER, LER and PR of striped murrel. The best FCR (1.32±0.05 and 1.30±0.03) was observed in fish fed 25 PBM + FPH and 50 PBM + FPH diets than other dietary groups. Significantly higher (p<0.05) PER (1.73±0.07 and 1.75±0.04),

Table V. Growth performance and survival rate of striped murrel fed PBM with and without supplementation of FPH diets.

	Experimental diets					p value
	35 FM	25 PBM	50 PBM	25 PBM + FPH	50 PBM + FPH	p value
Initial weight (g)	10.03±0.16	9.89±0.28	10.19±0.12	9.96±0.08	10.01±0.22	0.430
Final weight (g)	46.03±1.11bc	45.54±1.29c	43.91±1.46c	48.12±1.05b	51.06±1.42a	<0.001
Weight gain (g)	36.00±1.26bc	35.65±1.56bc	33.73±1.45c	38.17±1.04b	41.05±1.38a	0.001
Feed intake (g fish-1)	52.16±1.54ab	51.27±1.56abc	49.35±1.33c	52.36±2.98bc	53.40±0.65a	0.026
Average daily growth (g)	0.60±0.02bc	0.59±0.02bc	0.56±0.02c	0.63±0.02b	0.68±0.02a	0.001
Survival rate (%)	98.33±2.88	96.67±5.77	95.00±5.00	98.33±2.88	98.33±2.88	0.804
Specific growth rate(% day-1)	2.54±0.06bc	2.54±0.09bc	2.43±0.05c	2.62±0.03ab	2.71±0.05a	0.003
Heptosomotic index (%)	1.75±0.03	1.72±0.05	1.71±0.04	1.69±0.01	1.69±0.06	0.529
Viscerosomatic index (%)	6.79±0.29	6.76±0.34	7.05±0.57	6.73±0.12	6.60±0.36	0.677

The growth performance and survival rate values were represented as mean ± SD of three replicates per treatment (n=3) and the values with different superscripts indicate significant differences as determined by Duncan’s test (p < 0.05).

Table VI. Feed conversion, nutrient utilization and retention of striped murrel fed PBM with and without supplementation of FPH diets.

	Experimental diets					p - value
	35 FM	25 PBM	50 PBM	25 PBM + FPH	50 PBM + FPH	p - value
Feed conversion ratio	1.45±0.06a	1.44±0.07a	1.46±0.07a	1.32±0.05b	1.30±0.03b	0.013
Protein efficiency ratio	1.57±0.06b	1.58±0.07b	1.55±0.08b	1.73±0.07a	1.75±0.04a	0.010
Lipid efficiency ratio	6.28±0.26b	6.32±0.29b	6.21±0.31b	6.90±0.27a	6.99±0.15a	0.010
Protein retention (%)	27.12±1.21c	27.85±2.12bc	27.49±0.91c	30.28±1.31ab	30.91±0.96a	0.021
Lipid retention (%)	35.32±3.79	35.83±1.50	35.05±0.62	39.48±3.25	39.85±3.30	0.146

Feed conversion, Nutrient utilization and retention values were represented as mean ± SD of three replicates per treatment (n=3) and the values with different superscripts indicate significant differences as determined by Duncan’s test (p < 0.05).

Table VII. Whole-body proximate composition (%, wet weight) of striped murrel fed PBM with and without supplementation of FPH diets.

		Experimental diets					p - value
	Initial	35 FM	25 PBM	50 PBM	25 PBM + FPH	50 PBM + FPH	p - value
Moisture	72.55	72.11±0.20	71.67±0.62	71.57±0.47	71.83±0.23	71.56±0.42	0.493
Crude protein	16.97	17.21±0.05	17.47±0.43	17.53±0.23	17.42±0.12	17.55±0.29	0.541
Crude lipid	4.61	5.40±0.30	5.44±0.16	5.41±0.26	5.49±0.27	5.49±0.29	0.988
Total ash	4.43	3.65±0.15	3.77±0.18	3.87±0.21	3.72±0.25	3.83±0.19	0.679
Calcium	0.86	1.07±0.02	1.05±0.03	1.04±0.02	1.08±0.03	1.09±0.02	0.257
Phosphorus	0.52	0.60±0.01	0.60±0.02	0.60±0.01	0.61±0.00	0.61±0.01	0.618

Whole-body proximate composition values were represented as mean ± SD of three replicates per treatments (n=3) and the values with different superscripts indicate significant differences as determined by Duncan’s test (p < 0.05).

LER (6.90±0.27 and 6.99±0.15) and PR (30.28±1.31 and 30.91±0.96) were observed in fish fed 25 PBM+FPH and 50 PBM+FPH diets. However, no significant difference (p > 0.05) was found in LR of fish fed different levels of PBM and supplementation of FPH diets.

Whole-body proximate composition of striped murrel

The whole-body proximate composition of striped murrel fed different levels of PBM and supplementation of FPH diets are shown in Table VII. No significant differences (p > 0.05) were observed in whole-body proximate composition such as moisture, crude protein, crude lipid, total ash, calcium, and phosphorus content of striped murrel.

Relative mRNA expression of IGF-1 of striped murrel

The relative mRNA expression of IGF-1 of striped murrel fed different levels of PBM and supplementation of FPH diets are shown in Figure 1. Significantly (p < 0.05) upregulated relative mRNA expression of IGF-1 (2.04±0.06) levels were observed in fish fed 50 PBM+FPH diets than other diets.

DISCUSSION

The results of the present study showed that dietary FM protein can be replaced with up to 50% of PBM without any adverse effects on the growth performance, feed utilization, and survival rate of striped murrel. Similar to our results, up to 40% PBM is substituted for FM without affecting the growth and feed utilization in the diet of striped murrel (Channa striata) fingerlings (Abdul-Halim et al., 2014). Hence, the findings of the present study agreed with previous studies with gilthead seabream (Sparus aurata) and olive flounder (Paralichthys olivaceus), in which growth performance and feed utilization were not significantly affected when FM replaced up to 50% of PBM (Karapanagiotidis et al., 2019; Ha et al., 2021). Up to 60-80% of FM has been replaced by PBM without any negative effects on growth performance and feed intake in the diets of cobia (Zhou et al., 2011), black seabream (Irm et al., 2020), barramundi (Siddik et al., 2019) and gilthead seabream (Fontinha et al., 2021). Additionally, complete replacement of FM with PBM was achieved in diets of humpback grouper (Cromileptes altivelis) (Shapawi et al., 2007), cobia (Rachycentron canadum) (Saadiah et al., 2011) and spotted rose snapper (Lutjanus guttatus) (Hernández et al., 2014) without affect the growth and feed utilization efficiency. Surprisingly, the diets of turbot (Psetta maeotica) and large yellow croaker (Larmichthys crocea) can be tolerated only a quarter of the amount of PBM instead of FM (Yigit et al., 2006; Wang et al., 2023). These different findings from the previous studies could be attributed to various factors such as the source, processed conditions and nutrient composition of PBM, diet preparation methods, protein level of diets, experimental conditions, size and developmental stages of fish, health conditions, and ingredient digestibility capacity of animals (Cheng et al., 2002; Krogdahl and Bakke-McKellep, 2005; Dawson et al., 2018). In this study, dietary supplementation of FPH in PBM-incorporated diets could enhance the overall growth performance, feed utilization and health conditions of striped murrel compared to other diets. Similarly, Siddik et al. (2020), Chaklader et al. (2021), and Pham et al. (2021) reported that dietary supplementation of tuna hydrolysate and FPH in PBM-incorporated diets could improve the overall growth performance, feed utilization efficiency and health status of Asian seabass (Lates calcarifer) and pompano (Trachinotus blochii) by eradicating the problems associated with the incorporation of PBM substituted with FM such as lack of digestibility, palatability and certain essential amino acids. Also, it has been experimentally demonstrated in the diets of Channa striata, supplementation of 2.5% and 10% FPH in low fish meal diet without affecting the feed intake and growth performance (Siddiah et al., 2022; Suratip et al., 2023). Hong et al. (2021) have demonstrated that the growth performance and feed utilization efficiency were not affected by the replacement of FM with up to 80% of the mixture of PBM and fermented soybean meal supplemented with FPH in the diets of barramundi (Lates calcarifer). The fish morphological indices such as HSI and VSI reflect the nutritional status and physiological conditions of reared animals. The values of HSI and VSI in our results were not affected by the partial replacement of FM with PBM, and these findings were confirmed with earlier studies in different carnivore fishes like snakehead (Channa striata) (Abdul-Halim et al., 2014), great sturgeon (Huso huso) (Hassani et al., 2021), black seabream (Acanthoparus schegeli) (Irm et al., 2020), gilthead seabream (Sparus aurata) (Sabbagh et al., 2019) and barramundi (Lates calcarifer) (Siddik et al., 2019) when the fishes were fed with different dietary levels of PBM instead of FM.

No significant variations were obtained in the whole-body carcass compositions, such as crude protein, crude lipid, and total ash content of striped murrel when FM protein was replaced with up to 50% of PBM in this study. This is because of dietary groups’ isonitrogenous, isolipidic and isocaloric values, and it has been confirmed that whole-body nutrient retention depends on the nutrient composition of dietary groups. Similar to our findings, up to 40% of FM replacement with PBM did not affect the whole-body composition of Channa striata fingerlings (Abdul-Halim et al., 2014). Previous studies by Karapanagiotidis et al. (2019), Irm et al. (2020) and Ha et al. (2020) showed that the dietary inclusion of PBM does not influence the whole-body composition of various fish species, like gilthead seabream (Sparus aurata), black seabream (Acanthoparus schegeli) and olive flounder (Paralichthys olivaceus). However, including FPH instead of FM did not influence the whole-body composition except for the crude lipid content of Channa striata (Siddiah et al., 2022). Similarly, up to 60% of PBM-incorporated diets significantly did not impact the whole-body composition, but the crude protein levels were decreased compared to the reference diet of cobia (Zhou et al., 2011).

The gene expression analysis is a supporting tool for evaluating the effects of feed ingredients on animal growth performance. IGF-1 is a growth hormone that is produced in the liver. It is involved and regulated in various physiological functions like cell proliferation, differentiation and division, subsequently increasing the growth and reproduction of mammals, birds and fish (Clemmons and Underwood, 1991; Jones and Clemmons, 1995). The upregulated IGF-1 mRNA expression levels are positively correlated with the muscle growth development of fish. Among the dietary treatments of this study, Channa striata fed with 50% of PBM supplemented with FPH (50 PBM+FPH) diet shows an upregulated expression of IGF-1 activity compared to other diets. The positive growth performance results obtained might be due to the presence of low molecular weight peptides and free amino acids in the FPH supplemented diet compared to other diets. In line with our present findings, Irm et al. (2020) demonstrated higher IGF-1 mRNA expression in fish fed with 30% of PBM-incorporated diets. Furthermore, our results were consistent with the study earlier in Siddaiah et al. (2022), which suggested that dietary inclusion of 10% FPH upregulated the IGF-1 gene in Channa striata.

CONCLUSION

In conclusion, the present study revealed that poultry by-product meal could replace up to 50% of fish meal without compromising the growth performance and nutrient utilization of Channa striata juveniles. Further studies are required for achieving more than 50% fish meal replacement with PBM supplement with FPH.

Declarations

Acknowledgement

The authors sincerely thank Tamil Nadu Dr. J. Jayalalithaa Fisheries University, Nagapattinam, Tamil Nadu, India for providing all the necessary facilities to carry out this study.

Funding

This research received no specific grant from any funding agency.

Data availability statement

The data that support the findings of this study are available within the article.

Statement of conflict of interest

The authors have declared no conflict of interest.

REFERENCES

Abdul-Halim, H.H., Aliyu-Paiko, M. and Hashim, R., 2014. Partial replacement of fish meal with poultry by-product meal in diets for snakehead, Channa striata (Bloch, 1793), fingerlings. J. World Aquacult. Soc., 45: 233-241. https://doi.org/10.1111/jwas.12112

AOAC, 2010. Association of official analytical chemists–Official methods of analysis (18th ed.). AOAC, Gaithersburg, MD.

APHA, 2012. Standard methods for the examination of water and waste water, 22nd edn. American Public Health Association., New York, USA.

Bureau, D., Harris, A. and Cho, C., 1999. Apparent digestibility of rendered animal protein ingredients for rainbow trout (Oncorhynchus mykiss). Aquaculture, 180: 345-358. https://doi.org/10.1016/S0044-8486(99)00210-0

Chaklader, M.R., Howieson, J., Siddik, M.A., Foysal, M.J. and Fotedar, R., 2021. Supplementation of tuna hydrolysate and insect larvae improves fishmeal replacement efficacy of poultry by-product in Lates calcarifer (Bloch, 1790) juveniles. Sci. Rep., 11: 4997. https://doi.org/10.1038/s41598-021-84660-5

Chaklader, M.R., Siddik, M.A. and Fotedar, R., 2020. Total replacement of fishmeal with poultry by-product meal affected the growth, muscle quality, histological structure, antioxidant capacity and immune response of juvenile barramundi, Lates calcarifer. PLoS One, 15: e0242079. https://doi.org/10.1371/journal.pone.0242079

Chen, L., 1990. Snakehead culture. In: Aquaculture in Taiwan. Blackwell Scientific Publication Ltd., Boston, USA, p. 39-42.

Cheng, Z.J., Behnke, K.C. and Dominy, W.G., 2002. Effects of poultry by-product meal as a substitute for fish meal in diets on growth and body composition of juvenile Pacific white shrimp, Litopenaeus vannamei. J. appl. Aquacult., 12: 71–83. https://doi.org/10.1300/J028v12n01_04

Clemmons, D.R. and Underwood, L.E., 1991. Nutritional regulation of IGF-I and IGF binding proteins. Annu. Rev. Nutr., 11: 393-412. https://doi.org/10.1146/annurev.nu.11.070191.002141

Cruz-Suárez, L.E., Nieto-López, M., Guajardo-Barbosa, C., Tapia-Salazar, M., Scholz, U. and Ricque-Marie, D., 2007. Replacement of fish meal with poultry by-product meal in practical diets for Litopenaeus vannamei, and digestibility of the tested ingredients and diets. Aquaculture, 272: 466-476. https://doi.org/10.1016/j.aquaculture.2007.04.084

Dawson, M.R., Alam, M.S., Watanabe, W.O., Carroll, P.M. and Seaton, P.J., 2018. Evaluation of poultry by-product meal as an alternative to fish meal in the diet of juvenile black sea bass reared in a recirculating aquaculture system. N. Am. J. Aquacult., 80: 74–87. https://doi.org/10.1002/naaq.10009

Delcroix, J., Gatesoupe, F.J., Desbruyères, E., Huelvan, C., Le Delliou, H., Le Gall, M.M., Quazuguel, P., Mazurais, D. and Zambonino-Infante, J.L., 2015. The effects of dietary marine protein hydrolysates on the development of sea bass larvae, Dicentrarchus labrax, and associated microbiota. Aquacult. Nutr., 21: 98-104. https://doi.org/10.1111/anu.12139

Duncan, D.B., 1955. Multiple range and multiple F-tests. Biometrics, 11: 1-42. https://doi.org/10.2307/3001478

FAO, 2022. The State of World Fisheries and Aquaculture 2022. Towards Blue Transformation. FAO, Rome, https://doi.org/10.4060/cc0461en

Fontinha, F., Magalhães, R., Moutinho, S., Santos, R., Campos, P., Serra, C.R., Aires, T., Oliva-Teles, A. and Peres, H., 2021. Effect of dietary poultry meal and oil on growth, digestive capacity, and gut microbiota of gilthead seabream (Sparus aurata) juveniles. Aquaculture, 530: 735879. https://doi.org/10.1016/j.aquaculture.2020.735879

Ha, M.S., Lee, K.W., Kim, J., Yun, A., Jeong, H.S., Lee, M.J., Baek, S.I., Cho, S.H., Kim, K.W., Lim, S.G., Lee, B.J., Hur, S.W., Son, M. and Lee, S., 2021. Dietary substitution effect of fish meal with chicken by-product meal on growth, feed utilization, body composition, haematology and non-specific immune responses of olive flounder (Paralichthys olivaceus). Aquacult. Nutr., 27: 315-326. https://doi.org/10.1111/anu.13176

Hernández, C., Sánchez-Gutiérrez, Y., Hardy, R., Benitez-Hernández, A., Domínguez-Jiménez, P., González-Rodríguez, B., Osuna-Osuna, L. and Tortoledo, O., 2014. The potential of pet-grade poultry by-product meal to replace fish meal in the diet of the juvenile spotted rose snapper Lutjanus guttatus (Steindachner, 1869). Aquacult. Nutr., 20: 623-631. https://doi.org/10.1111/anu.12122

Hevrøy, E., Espe, M., Waagbø, R., Sandnes, K., Ruud, M. and Hemre, G.I., 2005. Nutrient utilization in Atlantic salmon (Salmo salar L.) fed increased levels of fish protein hydrolysate during a period of fast growth. Aquacult. Nutr., 11: 301-313. https://doi.org/10.1111/j.1365-2095.2005.00357.x

Hong, Y.C., Chu, J.H., Kirby, R., Sheen, S.S. and Chien, A., 2021. The effects of replacing fish meal protein with a mixture of poultry by-product meal and fermented soybean meal on the growth performance and tissue nutritional composition of Asian seabass (Lates calcarifer). Aquacult. Res., 52: 4105-4115. https://doi.org/10.1111/are.15249

Hua, K., Koppe, W. and Fontanillas, R., 2019. Effects of dietary protein and lipid levels on growth, body composition and nutrient utilization of Channa striata. Aquaculture, 501: 368-373. https://doi.org/10.1016/j.aquaculture.2018.11.054

Hung, L. and Huy, H., 2007. Analysis of feeds and fertilizers for sustainable aquaculture development in Viet Nam. FAO Fish. Tech. Pap., 497: 331.

Irm, M., Taj, S., Jin, M., Luo, J., Andriamialinirina, H.J.T. and Zhou, Q., 2020. Effects of replacement of fish meal by poultry by-product meal on growth performance and gene expression involved in protein metabolism for juvenile black sea bream (Acanthoparus schlegelii). Aquaculture, 528: 735544. https://doi.org/10.1016/j.aquaculture.2020.735544

Ishida, Y., Fujita, T. and Asai, K., 1981. New detection and separation method for amino acids by high-performance liquid chromatography. J. Chromatogr. A, 204: 143–148. https://doi.org/10.1016/S0021-9673(00)81650-7

Johannsdottir, J., Heimisdottir, H.L., Hakonardottir, K., Hrolfsdottir, L., Steinarsson, A., Imsland, A.K., Thorarense, H., Bergsson, A.B. and Bjornsdottir, R., 2014. Improved performance of Atlantic cod (Gadus morhua L.) larvae following enhancement of live feed using a fish protein hydrolysate. Aquacult. Nutr., 20: 314-323. https://doi.org/10.1111/anu.12080

Jones, J.I. and Clemmons, D.R., 1995. Insulin-like growth factors and their binding proteins: Biological actions. Endocr. Rev., 16: 3–34. https://doi.org/10.1210/edrv-16-1-3

Karapanagiotidis, I.T., Psofakis, P., Mente, E., Malandrakis, E. and Golomazou, E., 2019. Effect of fishmeal replacement by poultry by-product meal on growth performance, proximate composition, digestive enzyme activity, haematological parameters and gene expression of gilthead seabream (Sparus aurata). Aquacult. Nutr., 25: 3-14. https://doi.org/10.1111/anu.12824

Khosravi, S., Bui, H.T.D., Rahimnejad, S., Herault, M., Fournier, V., Kim, S.S., Jeong, J.B., and Lee, K.J., 2015. Dietary supplementation of marine protein hydrolysates in fish-meal based diets for red sea bream (Pagrus major) and olive flounder (Paralichthys olivaceus). Aquaculture, 435: 371-376. https://doi.org/10.1016/j.aquaculture.2014.10.019

Kristinsson, H.G. and Rasco, B.A., 2000. Fish protein hydrolysates: Production, biochemical, and functional properties. Crit. Rev. Fd. Sci. Nutr., 40: 43-81. https://doi.org/10.1080/10408690091189266

Krogdahl, Å. and Bakke-McKellep, A.M., 2005. Fasting and refeeding cause rapid changes in intestinal tissue mass and digestive enzyme capacities of Atlantic salmon (Salmo salar L.). Comp. Biochem. Physiol. A: Mol. Integr. Physiol., 141: 450-460. https://doi.org/10.1016/j.cbpb.2005.06.002

Livak, K.J. and Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods, 25: 402-408. https://doi.org/10.1006/meth.2001.1262

Nengas, I., Alexis, M.N. and Davies, S.J., 1999. High inclusion levels of poultry meals and related by products in diets for gilthead seabream Sparus aurata L. Aquaculture, 179: 13–23. https://doi.org/10.1016/S0044-8486(99)00148-9

Palupi, E.T., Setiawati, M., Lumlertdacha, S. and Suprayudi, M.A., 2020. Growth performance, digestibility, and blood biochemical parameters of Nile tilapia (Oreochromis niloticus) reared in floating cages and fed poultry by-product meal. J. appl. Aquacult., 32: 16-33. https://doi.org/10.1080/10454438.2019.1605324

Pham, H.D., Siddik, M.A., Van Phan, U., Le, H.M. and Rahman, M.A., 2021. Enzymatic tuna hydrolysate supplementation modulates growth, nutrient utilisation and physiological response of pompano (Trachinotus blochii) fed high poultry-by product meal diets. Aquacult. Rep., 21: 100875. https://doi.org/10.1016/j.aqrep.2021.100875

Saadiah, I., Abol-Munafi, A. and Utama, C.C., 2011. Replacement of fishmeal in cobia (Rachycentron canadum) diets using poultry by-product meal. Aquacult. Int., 19: 637–648. https://doi.org/10.1007/s10499-010-9378-8

Sabbagh, M., Schiavone, R., Brizzi, G., Sicuro, B., Zilli, L. and Vilella, S., 2019. Poultry by-product meal as an alternative to fish meal in the juvenile gilthead seabream (Sparus aurata) diet. Aquaculture, 511: 734220. https://doi.org/10.1016/j.aquaculture.2019.734220

Samantaray, K. and Mohanty, S., 1997. Interactions of dietary levels of protein and energy on fingerling snakehead, Channa striata. Aquaculture, 156: 241-249. https://doi.org/10.1016/S0044-8486(97)00140-3

Sathishkumar, G., Felix, N. and Prabu, E., 2021. Effects of dietary protein substitution of fish meal with bioprocessed poultry by-product meal on growth performances, nutrient utilization, whole-body composition and haemato-biochemical responses of GIFT tilapia reared in floating cages. Aquacult. Res., 52: 5407-5418. https://doi.org/10.1111/are.15410

Hassani, S.M.H., Banavreh, A., Jourdehi, Y.A., Mohseni, M., Shokri, M.M. and Rastekenari, Y.H., 2021. The feasibility of partial replacement fish meal with poultry by-products in practical diets of juvenile great sturgeon, Huso huso: Effects on growth performance, body composition, physiometabolic indices, digestibility and digestive enzymes. Aquacult. Res., 52: 3605-3616. https://doi.org/10.1111/are.15205

Shapawi, R., Ng, W.K. and Mustafa, S., 2007. Replacement of fish meal with poultry by-product meal in diets formulated for the humpback grouper, Cromileptes altivelis. Aquaculture, 273: 118–126. https://doi.org/10.1016/j.aquaculture.2007.09.014

Siddaiah, G.M., Kumar, R., Kumari, R., Damle, D.K., Rasal, K.D., Manohar, V., Sundaray, J.K. and Pillai, B.R., 2022. Dietary supplementation of fish protein hydrolysate improves growth, feed efficiency and immune response in freshwater carnivore fish, Channa striata fingerlings. Aquacult. Res., 53: 3401-3415. https://doi.org/10.1111/are.15848

Siddik, M.A., Chaklader, M.R., Foysal, M.J., Howieson, J., Fotedar, R. and Gupta, S.K., 2020. Influence of fish protein hydrolysate produced from industrial residues on antioxidant activity, cytokine expression and gut microbial communities in juvenile barramundi Lates calcarifer. Fish Shellfish Immunol., 97: 465-473. https://doi.org/10.1016/j.fsi.2019.12.057

Siddik, M.A., Chungu, P., Fotedar, R. and Howieson, J., 2019. Bioprocessed poultry by-product meals on growth, gut health and fatty acid synthesis of juvenile barramundi, Lates calcarifer (Bloch). PLoS One, 14: e0215025. https://doi.org/10.1371/journal.pone.0215025

Suratip, N., Charoenwattanasak, S., Klahan, R., Herault, M. and Yuangsoi, B., 2023. An investigation into the effects of using protein hydrolysate in low fish meal diets on growth performance, feed utilization and health status of snakehead fish (Channa striata) fingerling. Aquacult. Rep., 30: 101623. https://doi.org/10.1016/j.aqrep.2023.101623

Wang, X., Luo, H., Zheng, Y., Wang, D., Wang, Y., Zhang, W., Chen, Z., Chen, X. and Shao, J., 2023. Effects of poultry by-product meal replacing fish meal on growth performance, feed utilization, intestinal morphology and microbiota communities in juvenile large yellow croaker (Larimichthys crocea). Aquacult. Rep., 30: 101547. https://doi.org/10.1016/j.aqrep.2023.101547

Yigit, M., Erdem, M., Koshio, S., Ergün, S., Türker, A. and Karaali, B., 2006. Substituting fish meal with poultry by-product meal in diets for black Sea turbot Psetta maeotica. Aquacult. Nutr., 12: 340–347. https://doi.org/10.1111/j.1365-2095.2006.00409.x

Yu, Y., 2004. Replacement of fishmeal with poultry byproduct meal and meat and bone meal in shrimp, tilapia and trout diets. Avances en Nutr. Acuicola. https://nutricionacuicola.uanl.mx/index.php/acu/article/view/194

Zhou, Q.C., Zhao, J., Li, P., Wang, H.L. and Wang, L.G., 2011. Evaluation of poultry by-product meal in commercial diets for juvenile cobia (Rachycentron canadum). Aquaculture, 322: 122–127. https://doi.org/10.1016/j.aquaculture.2011.09.042