Research Article
A Comparative Study of Diagnostic Tests To Identify Canine Parvovirus in Chattogram, Bangladesh
Shanta Barua1, Abdullah Al Sattar2, Md. Faridul Islam1, Md. Ashiqur Rahman3, Mosammat Moonkiratul Zannat4, F. M. Yasir Hasib5, Mohammed Yousuf Elahi Chowdhury1*
1Department of Medicine and Surgery, Faculty of Veterinary Medicine, Chattogram Veterinary and Animal Sciences University, Khulshi, Chattogram-4225, Bangladesh; 2School of Physiology, University of New England, Armidale, NSW-2351, Australia; 3School of Veterinary Medicine, Murdoch University, 90 south street, Murdoch WA 6150, Australia; 4Department of Physiology Biochemistry and Pharmacology, Faculty of Veterinary Medicine, Chattogram Veterinary and Animal Sciences University, Khulshi, Chattogram-4225, Bangladesh; 5Department of Pathology and Parasitology, Faculty of Veterinary Medicine, Chattogram Veterinary and Animal Sciences University, Khulshi, Chattogram-4225, Bangladesh.
Abstract | Canine parvovirus (CPV) is a deadly, highly contagious viral disease that affects dogs worldwide, causing severe, foul-smelling, often bloody diarrhea, vomiting, and dehydration. This study aimed to compare the currently available diagnostic methods for CPV infection in dogs in Bangladesh and to explore the genetic relationship of local strains through limited phylogenetic analysis. Between October 2020 and March 2021, 47 dogs were clinically diagnosed with CPV infection at the Teaching Veterinary Hospital in Chattogram. Rectal swabs and blood samples were collected from all dogs to perform rapid immunochromatographic (IC) strip test and polymerase chain reaction (PCR)-based molecular testing, respectively. The results showed that 87.2% (95% CI: 74.3%-95.2%) of the dogs tested positive with the IC test, while 85.1% (95% CI: 71.7%-93.8%) tested positive with PCR. The relative sensitivity and specificity of the rapid IC strip tests were reported as 100% (95% CI: 91.2%-100%) and 85.7% (95% CI: 42.1%-99.6%), respectively, indicating excellent agreement (91.1%, 95% CI: 73.8%-100%) with the PCR test. Partial sequencing and preliminary phylogenetic analysis of selected PCR-positive samples revealed a high degree of genetic similarity with strains from India and China. This study provides the first comparison of diagnostic tests for CPV infection in the study area and suggests that further VP2 gene sequencing on a broader scale could offer deeper insights into CPV’s genetic evolution in Bangladesh.
Keywords | Canine parvovirus infection, Diagnostic tests, PCR, Phylogenetic analysis, Rapid immunochromatographic (IC) strip test, Chattogram
Received | July 13, 2025; Accepted | September 21, 2025; Published | October 13, 2025
*Correspondence | Mohammed Yousuf Elahi Chowdhury, Department of Medicine and Surgery, Faculty of Veterinary Medicine, Chattogram Veterinary and Animal Sciences University, Khulshi, Chattogram-4225, Bangladesh; Email: [email protected]
Citation | Barua S, Al-Sattar A, Islam MF, Rahman MA, Zannat MM, Hasib FMY, Chowdhury MYE (2025). A comparative study of diagnostic tests to identify canine parvovirus in Chattogram, Bangladesh. Adv. Anim. Vet. Sci., 13(10):2323-2330.
DOI | https://dx.doi.org/10.17582/journal.aavs/2025/13.10.2323.2330
ISSN (Online) | 2307-8316
Copyright: 2025 by the authors. Licensee ResearchersLinks Ltd, England, UK.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
INTRODUCTION
Canine parvovirus (CPV), a significant cause of disease and death in young dogs for over four decades, remains one of the most widespread enteric diseases globally (Basoglu et al., 2025; Mazzaferro, 2020; Sullivan, 2019). It is a non-enveloped, icosahedral symmetrical single-stranded DNA (ssDNA) virus belonging to the genus Protoparvovirus in the Parvoviridae family (Cotmore et al., 2019), containing a capsid approximately 26 nm in size and about 5,000 nucleotide bases (López-Astacio et al., 2023). The genome consists of a pair of open reading frames (ORFs) encoding two non-structural proteins (NS1 and NS2) and two structural proteins (VP1 and VP2). Among these, VP2 is a key component comprising 90% of the total capsid protein and plays a crucial role in viral pathogenicity and host immune response (Akkutay-Yoldar and Taylan Koç, 2019). According to their surface genes, CPVs are classified into CPV-1 and CPV-2 groups. CPV-2 was designated as the original strain to differentiate it from genetically and antigenically unrelated CPV-1 (also called the minute virus CnMV or MCV) (Goetschius et al., 2021). The virus is transmitted through contaminated feces, causing a high morbidity rate (100%) and a mortality rate of around 10% (Sultana et al., 2016). Factors such as young age (under 5 months), exotic (international) male dog breeds like Spitz, German Shepherds, Labradors, Pomeranian, Alsatians, Rottweilers, Mongrels, and indigenous dogs (local or non-pedigree dog breeds in Bangladesh), lack of vaccination, and dry seasons are linked to CPV infection globally (Islam et al., 2014; Shima et al., 2015; Behera et al., 2015). The disease is characterized by sudden onset of vomiting and diarrhea (often hemorrhagic), fever, loss of appetite, progressive dehydration, lethargy, depression, and in some cases, myocarditis and leukopenia (Goetschius et al., 2021).
CPV-2 has largely been supplanted by three main variants: CPV-2a, 2b, and 2c (Shima et al., 2015). After 1980, the CPV-2 virus was primarily replaced by the CPV-2a mutant during a global epidemic (Behera et al., 2015; Hao et al., 2022). The CPV-2b variant emerged in 1984 in the United States, followed by CPV-2c in 2000 in Italy, each with a single amino acid change at residue 426 of the VP2 protein compared to CPV-2a (Chen et al., 2024; Decaro and Buonavoglia, 2012; Alam et al., 2021). In most regions of Asia, Europe, and Oceania, CPV-2a dominates, while CPV-2b prevails in Japan, Australia, and New Zealand (Takano et al., 2021; Kwan et al., 2021; Giraldo-Ramirez et al., 2020). Over the past decade, the Asian lineage of CPV-2c has expanded globally, reaching regions such as Africa, the USA, South America, and several European countries (France, Italy, and Germany) except for Colombia and Canada (Franzo et al., 2023; Carrino et al., 2022; Qi et al., 2020). Various strains of this virus have been found in Asian countries, with all three strains identified in Bangladesh and neighboring India (Jayappa et al., 2024; Hasib et al., 2021). Moreover, current studies have raised concerns about parvovirus cross-species transmission, including reports on CPV-like viruses in non-canine hosts, although its zoonotic potential remains unconfirmed and requires further investigation (Chen et al., 2024).
Diagnosing CPV based solely on clinical signs is not conclusive, as other infectious agents can also lead to similar symptoms in dogs (Tinky et al., 2015). Traditional diagnostic techniques, such as enzyme-linked immunosorbent assays (ELISA), hemagglutination (HA) tests, and hemagglutination inhibition (HI) tests, are less sensitive compared to molecular techniques like PCR, which offer higher sensitivity and specificity (Decaro and Buonavoglia, 2012). Rapid IC test kits, commonly used in Bangladesh, are cost-effective, easy to perform, and provide quick results. However, their diagnostic reliability remains uncertain without comparison to molecular tools. Several studies in Bangladesh have shown that the proportionate prevalence of CPV enteritis diagnosed via symptomatic diagnosis and rapid IC test kits ranges from 5.8% to 42% (Nızamı et al., 2020; Sen et al., 2016; Roy et al., 2018). In rural or resource-limited veterinary settings, access to molecular diagnostic techniques like PCR is often unavailable due to high costs and lack of laboratory infrastructure, making the use of rapid IC test a practical and essential alternative for timely detection of CPV (Decaro and Buonavoglia, 2012; Tinky et al., 2015).
Despite their widespread use, the diagnostic accuracy of rapid IC strip tests has not been systematically compared with molecular methods like PCR in Bangladesh. Most previous studies have relied solely on symptomatic diagnosis or rapid testing without laboratory validation. Therefore, this study specifically addresses this gap by performing a direct, side-by-side comparison of IC strip testing and PCR in the Chattogram region. Furthermore, while the global burden of CPV has been extensively studied, there remain a lack of specific data in the diagnostic accuracy and genetic diversity of CPV strains in Bangladesh. Most local studies lack molecular confirmation or phylogenetic analysis (Hasib et al., 2021; Nizami et al., 2020). As molecular surveillance becomes increasingly essential to track emerging variants (Franzo et al., 2023), this study aims to provide preliminary phylogenetic insights into CPV strains in the Chattogram region.
MATERIALS AND METHODS
Study design and data collection
SAQTVH is one of the largest and most popular referral centers for pet animals in the Chattogram region, receiving a high caseload from diverse area. From October 2020 to March 2021, a cross-sectional study was conducted on dogs brought to SAQTVH at CVASU, Bangladesh, for treatment. A total of 47 sick dogs were included in this study based on five clinical symptoms- (i) fever, (ii) foul-smelling mucoid to hemorrhagic diarrhea, (iii) vomiting, (iv) dehydration, and (v) weakness. Any patient with three or more symptoms was presumptively diagnosed with CPV infection (Mylonakis et al., 2016). A structured questionnaire was designed to gather demographic details, physical measurements, and clinical symptoms of the patients. Dogs that had received antibiotics or vaccinations in the last 10 days not included in the study.
Sample collection and preservation
Following proper aseptic procedures, rectal swabs and blood samples were collected from each dog. All swab samples were analyzed within 30 minutes for the rapid IC strip test, and blood samples were immediately placed in an ice bag after collection and transported to the laboratory to store at -20°C for further use.
Rapid IC strip test
Following the manufacturer’s instructions, rectal swab samples were tested using a commercial rapid test kit (AddBio CPV/CPV Ag rapid test kit). The samples were mixed with the buffer solution provided with the rapid test kit. After two minutes, three drops of the mixture’s supernatant were placed into the sample hole of the test device. A positive CPV infection was indicated by two red bands displayed in the device’s control (C) and test (T) result windows after 10 minutes. A negative test result was indicated by a single red band in the control (C) result window only.
DNA extraction and PCR confirmation
DNA was extracted from the collected blood samples using a DNA extraction kit (DNeasy Blood and Tissue Kits®) following the manufacturer’s instructions. The molecular identification of the virus was performed using PCR with previously published primers. Following DNA extraction, the processed samples were screened with the primer pair CPV-2ab (F) GAAGAGTGGTTGTAAATAATT and 2ab (R) CTATATAACCAAAGTTAGTAC, which amplified a 681 bp fragment of the gene encoding the capsid protein VP2 of both CPV-2a and CPV-2b types (Sharma et al., 2016). The thermal cycling protocol consisted of an initial denaturation at 94°C for 5 min, followed by 30 cycles of denaturation at 94°C for 30 sec, annealing at 55°C for 2 min, and extension at 72°C for 2 min, with a final extension at 72°C for 5 min. The PCR products were run on 1% agarose gel containing 0.5 µg/ml ethidium bromide alongside a 100 bp DNA ladder for electrophoresis. A known CPV-positive control and a negative control were included during each PCR run to validate the test results and ensure the reliability of assay. The migration of the dye was observed to track the progress of the electrophoresis.
Sequencing and phylogenetic analysis
Four randomly selected positive PCR samples were partially sequenced using Sanger deoxy sequencing (Macrogen®, Korea) and submitted to NCBI GenBank. Accession numbers were obtained (MW788669, MW788670, MW788671, and MW788672), and phylogenetic tree was constructed using the Maximum-likelihood (ML) method in MEGA version 12, employing the Tamura-Nei (TN93) substitution model (Saitou and Nei, 1987) with gamma-distributed rate variation across sites (using 4 categories). Twenty isolates were selected through BLAST-N search for visualization of the phylogenetic tree. Bootstrap support values based on 1,000 replicates are displayed at the nodes, with values below 50 omitted (Figure 2).
Statistical analysis
The agreement between the two diagnostic tests, IC strip test and PCR, was determined using Kappa statistics. The diagnostic performance of the IC strip test was calculated by comparing it with the PCR result. The kappa (κ) value was interpreted as follows: poor (κ = 0), slight (0.01 < κ < 0.20), fair (0.21 < κ < 0.40), moderate (0.41 < κ < 0.60), almost perfect (0.61 < κ < 0.80), and excellent (0.81 < κ < 1.00) (Carrouel et al., 2016).
RESULTS
It is worth noting that diagnostic processes in veterinary hospitals are underdeveloped in Bangladesh and mainly rely on presumptive diagnosis based on clinical symptoms. The findings of this study will help determine whether IC strip tests could serve as a valuable tool for diagnosing this viral infection in Bangladesh, where most veterinary hospitals lack the infrastructure for molecular diagnostic techniques.
Demographic information
In our study, the highest prevalence of CPV infection was observed in male dogs (57.4%) younger than six months (55.3%). It was most common in the winter season (61.7%) (November-February), followed by the summer (March-June) and monsoon (July-October) seasons. The disease was relatively higher among indigenous breeds (65.9%) and unvaccinated dogs (76.6%). Factors related to CPV infection in dogs are shown in Table 1.
Comparison of the diagnostic tests
Among the 47 tested samples, 87.2% (41/47) (95% CI: 74.3%-95.2%) were positive in the IC strip test. Subsequently, DNA extraction and amplification were carried out using the primer pair. PCR testing revealed 85.1% (40/47) (95% CI: 71.7%-93.8%) positive results for the target 681 bp band size (Figure 1). When compared to the PCR assay as a reference method, the IC strip test demonstrated relative sensitivity and specificity of 100% (95% CI: 91.2%-100%) and 85.7% (95% CI: 42.1%-99.6%), respectively. Furthermore, the Kappa statistics value was 91.1% (95% CI: 73.8%-100%), suggesting significant agreement between the tests (p<0.001) (Table 2).
Table 1: Factors associated with CPV infection in dogs.
|
Variable |
Category |
Positive (n) |
Percentage (%) |
|
Age (months) |
1-6 7-12 >12 |
26 12 9 |
55.3 25.6 19.1 |
|
Sex |
Male Female |
27 20 |
57.4 42.6 |
|
Breeds |
Local1 Exotic2 |
31 16 |
65.9 34.1 |
|
Season |
Summer Monsoon Winter |
11 7 29 |
23.4 14.9 61.7 |
|
Vaccination |
Yes No |
11 36 |
23.4 76.6 |
1Local breeds refer to indigenous breed or non-pedigree dog breeds in Bangladesh. 2Exotic breeds refer to international breeds such as Spitz, German Shepherds, Labradors, Pomeranian, Chihuahua etc.
Table 2: Comparison of the sensitivity and specificity of IC strip test and PCR analysis for detection of CPV.
|
PCR test result |
Total |
||
|
IC strip test result |
PCR positive |
PCR negative |
|
|
IC strip test positive |
40 |
1 |
41 |
|
IC strip test negative |
0 |
6 |
6 |
|
Total |
40 |
7 |
47 |
|
Relative sensitivity |
100.00% |
||
|
Relative specificity |
85.71% |
||
1Kappa statistics: Agreement: 91.1% (95% CI: 73.8%-100%); P<0.001. 2Test Performance Metrics: 95% Confidence Interval (CI) for sensitivity (100.00%): 91.2%-100% and for specificity (85.71%): 42.1%-99.6%.
Phylogenetic analysis of parvoviruses
Four isolated samples from Chattogram (MW788669-72) showed genetic similarity with isolates from India (MN661243.1) and China (MT165693.1 and MN519258.1) (Figure 2). This comparison was based on the VP2 genes of the genome of CPV.
DISCUSSION
CPV infection is widespread in Bangladesh and its neighboring countries, emerging as a growing concern for dog owners in recent years (Sen et al., 2016; Hasan et al., 2016; Chisty et al., 2020). In this study, a higher prevalence of the disease was observed in male dogs (57.4%) and in puppies under six months of age (55.3%), consistent with previously reported studies (Hasib et al., 2021; Chisty et al., 2020; Nahat et al., 2015). After weaning, puppies undergo changes in diet and gut bacteria, leading to an increased mitotic index in intestinal crypt cells. Since the virus targets rapidly dividing cells in the crypts, younger dogs are more vulnerable to CPV (Deka et al., 2013). Behavioral traits in males-such as roaming, territoriality, and frequent sniffing or licking of the perineal areas of potentially infected females, particularly during heat, may also partly increase their risk of exposure (Adeyemo et al., 2024; Deka et al., 2013). Transmission of the CPV virus through feco-oral route is widely recognized as the primary and most significant route (Decaro et al., 2005). Consistent with our findings, many previous studies reported a rise in the CPV cases during the months following November, when relatively low temperatures prevail across the country (Hasib et al., 2020; Nizami et al., 2020; Hasan et al., 2018). Unvaccinated dogs (76.6%) and local (65.9%) breeds were more frequently affected by the disease, which aligns with earlier research (Hasib et al., 2021; Nizami et al., 2020). While this viral disease can be controlled with proper vaccination strategies, it is challenging to implement in Bangladesh due to the large population of stray dogs (Hasan et al., 2024). These stray dogs pose a risk to even vaccinated dogs.
Several studies conducted in various locations in Bangladesh have documented the occurrence of the disease in multiple ranges. For instance, Sen et al. (2016) reported prevalence rate of 25% in Dhaka and 18.18% in Chattogram, while Roy et al. (2018) and Hasan et al. (2024) documented a lower prevalence of 13.94% in Dhaka and 6.8% in Sylhet and Dhaka, respectively. A notably higher prevalence was reported in Mymensingh (32%) by Nahat et al. (2015). Recent studies conducted in the Chattogram region have shown a growing prevalence of the disease in dogs. Nizami et al. (2020) documented a peak prevalence of 21.3% in 2016 over a six-year period (2013-2018), whereas Hasan et al. (2018) reported a higher overall prevalence of 42%. Additionally, Hasib et al. (2021) detected CPV-2a, CPV-2b, and CPV-2b at rates of 15%, 20%, and 65%, respectively in Chattogram. In comparison, our research demonstrated the highest prevalence reported to date: 87.2% in IC strip test and 85.1% in PCR. One sample that failed to test positive in the PCR assay may have been influenced by low viral load. Previous studies showed false negative result in the PCR assay suspecting influenced by the inhibitory substances present in the feces (Tinky et al., 2015; Mochizuki et al., 1993). The IC strip test’s sensitivity is consistent with a previous study by Alam et al. (2021), although its specificity is slightly lower than earlier reports (Alam et al., 2021; Deka et al., 2013).
The current study found that the sequenced samples mainly aligned with CPV-2a. However, following completion of our research work, a separate study by Hasib et al. (2021) reported the circulation of all three strains (CPV-2a, CPV-2b, CPV-2c) in the same region. This may indicate strain variation during outbreaks, with CPV2c, the most pathogenic variant, might have caused the outbreak in the susceptible population. Therefore, evaluating the specific strain could be a valuable step to control further outbreaks of CPV.
Phylogenetic alignment of our CVASU-strains shows close similarity to recent described new CPV-2a variants from China and India, consistent with previous findings that Bangladeshi CPV isolates share around 90.40% and 89.90% nucleotide homology with Chinese and India strains, respectively (Alam et al., 2021). This genetic similarity suggests possible transboundary movement or a common source of viral variants between Bangladesh, India, and China, underscoring the importance of regional molecular surveillance.
Very few studies have been undertaken on the molecular conformation of CPV-2 in dogs in Bangladesh. This study carried out at a major veterinary hospital, involved competent veterinarians and trained students who regularly treat numerous sick animals. Along with molecular characterization, the study compared rapid testing with molecular methods, demonstrating that the rapid testing method is sufficiently sensitive and reliable to diagnose CPV infection in dogs in Bangladesh with minimal resources.
Several limitations should be acknowledged. The small sample size, particularly the low number of PCR-negative cases (n=7), limits the precision and generalizability of our estimates for specificity and kappa statistics. The wide confidence intervals further indicate the statistical instability of these estimates. Therefore, the diagnostic performance results presented here should be considered preliminary and future studies involving larger and more diverse sample populations are necessary to validate these findings. It is important to note that the IC strip test was performed on fecal samples, while PCR was conducted on blood samples, and the primers used in the PCR assay were not designed to detect the CPV-2c variant. These methodological differences may have introduced bias in the calculated sensitivity and specificity, potentially underestimating or overestimating the diagnostic performance of the IC test and future studies should run both tests with same samples to obtain clearer diagnostic results. Furthermore, the PCR primer used in the study can detect both CPV-2a and CPV-2b but not the third strain. Due to funding constraints, the scope of real-time PCR and further sequencing was limited. As this study serves as one of the first attempts at combining clinical, diagnostic, and molecular characterization of CPV in Chattogram, it provides valuable groundwork and highlights the urgent need for larger-scale molecular surveillance, including full VP2 gene sequencing and real-time PCR assays capable of distinguishing all three variants. Epidemiological analysis of affected dogs identified multiple factors that play a role in the development of the disease among companion dogs. Additional epidemiological studies will elucidate the major risk factors for disease occurrence.
CONCLUSION
In summary, this study provides preliminary evidence supporting the use of rapid IC strip tests as a potentially useful tool for diagnosing CPV infection in resource-limited settings in Bangladesh, particularly when molecular diagnostic methods like PCR are unavailable. The high incidence of CPV-2 infection, particularly among unvaccinated male puppies during the winter months, underscores the need for a targeted vaccination schedule in vulnerable population. The IC strip test showed high sensitivity and agreement with PCR with small sample size which underscore the need for larger-scale studies with more robust comparator methods and variant-specific molecular tools to better validate diagnostic performance. Additionally, partial VP2 gene sequencing indicates genetic similarities of CPV strain between local and neighboring countries, suggesting a need for ongoing molecular surveillance and genomic characterization to inform regional disease control strategies.
ACKNOWLEDGEMENTS
The authors acknowledge the hospital authorities for permitting the study to be conducted, as well as the hospital staffs and trained students who assisted in restraining the dogs during sample collection.
Novelty Statement
This is the first study in Bangladesh to directly compare rapid IC strip test with PCR assay to diagnose Canine Parvovirus (CPV) infection in dogs, exposing high agreement between the test methods. The outcome of the study highlight the logical use of rapid IC strip test in resource-limited settings and emphasizes the need for expanded molecular surveillance to track the circulating CPV strains.
Author’s Contribution
Shanta Barua collected the demographic information from owners, did sample collection, diagnostic tests, data analysis, and manuscript writing. Md. Faridul Islam involved in preparation of the questionnaire, and review and editing the manuscript. Abdullah Al Sattar, Md. Ashiqur Rahman, and F. M. Yasir Hasib contributed to data entry, data analysis, preparation of tables and figures, and review and editing the manuscript. Mosammat Moonkiratul Zannat reviewed the manuscript. Mohammed Yousuf Elahi Chowdhury prepared the study design, supervised the entire research activity, and reviewed the manuscript.
Funding statement
The research was financially supported by the Ministry of Science and Technology, The People’s Republic of Bangladesh (Grant number 2058).
Ethical approval
Prior to the commencement of the study, written institutional ethical approval for invasive procedures (rectal swab, blood) was obtained from the Ethical Committee of Chattogram Veterinary and Animal Sciences University (CVASU), under approval number CVASU/Dir(R&E)EC/2025/880/14. Informed written consent was obtained from all participating dog owners after explaining the purpose and procedure of the study. All samples were collected under the supervision of a registered veterinarian to minimize discomfort and stress to the dogs, following standard sample collection procedures.
Generative AI and AI-assisted technology statement
The authors affirm that any Generative AI or AI-assisted Technology was not used during production of this manuscript.
Conflict of interest
The authors have declared no conflict of interest.
REFERENCES
Adeyemo AA, Aiki-Raji CO, Akinniyi OO, Fagbohun OA (2024). Molecular epidemiology of Canine parvovirus in Nigeria. Afr. J. Biomed. Res., 27(2): 217-24.
Akkutay-Yoldar Z, Taylan Koç B (2019). Comparison of partial and full VP2 gene sequences of parvovirus from domestic cats in Turkey. Vet. Méx. OA., 6(4). https://doi.org/10.22201/fmvz.24486760e.2019.4.643
Alam S, Chowdhury QM, Roy S, Chowdhury MS, Hasan M, Al Mamun M, Uddin MB, Hossain MM, Rahman MM (2021). Molecular detection and phylogenetic analysis of Canine Parvovirus (CPV) in diarrhoeic pet dogs in Bangladesh. Vet. Anim. Sci., 14: 100224. https://doi.org/10.1016/j.vas.2021.100224
Basoglu A, Bicici RO, Di Cesare F, Baspinar N, Tenori L, Ider M, Gulersoy E (2025). NMR-based-Metabolomics Evaluation in Dogs Infected with Canine Parvovirus: A new approach for biomarkers. Vet. Ital., 61(1).
Behera M, Panda SK, Sahoo PK, Acharya AP, Patra RC, Das S, Pati S (2015). Epidemiological study of canine parvovirus infection in and around Bhubaneswar, Odisha, India. Vet. World., 8(1): 33. https://doi.org/10.14202/vetworld.2015.33-37
Carrino M, Tassoni L, Campalto M, Cavicchio L, Mion M, Corrò M, Natale A, Beato MS (2022). Molecular investigation of recent canine parvovirus-2 (CPV-2) in Italy revealed distinct clustering. Viruses, 14(5): 917. https://doi.org/10.3390/v14050917
Carrouel F, Llodra JC, Viennot S, Santamaria J, Bravo M, Bourgeois D (2016). Access to interdental brushing in periodontal healthy young adults: A cross-sectional study. PLoS One, 11(5): e0155467. https://doi.org/10.1371/journal.pone.0155467
Chen S, Shang K, Chen J, Yu Z, Wei Y, He L, Ding K (2024). Global distribution, cross-species transmission, and receptor binding of canine parvovirus-2: Risks and implications for humans. Sci. Total Environ., 930: 172307. https://doi.org/10.1016/j.scitotenv.2024.172307
Chisty NN, Belgrad JP, Al Sattar A, Akter S, Hoque MA (2020). Clinico-epidemiological investigation of feline panleukopenia and parvoviral enteritis in the two largest pet hospitals in Bangladesh. J. Adv. Vet. Anim. Res., 7(4): 726. https://doi.org/10.5455/javar.2020.g474
Cotmore SF, Agbandje-McKenna M, Canuti M, Chiorini JA, Eis-Hubinger AM, Hughes J, Mietzsch M, Modha S, Ogliastro M, Pénzes JJ, Pintel DJ (2019). ICTV virus taxonomy profile: Parvoviridae. J. Gen. Virol., 100: 367-368 https://doi.org/10.1099/jgv.0.001212.
Decaro N, Buonavoglia C (2012). Canine parvovirus a review of epidemiological and diagnostic aspects, with emphasis on type 2c. Vet. Microbiol., 155(1): 1-12. https://doi.org/10.1016/j.vetmic.2011.09.007
Decaro N, Desario C, Campolo M, Elia G, Martella V, Ricci D, Lorusso E, Buonavoglia C (2005). Clinical and virological findings in pups naturally infected by canine parvovirus type 2 Glu-426 mutant. J. Vet. Diagn. Invest., 17(2): 133-138. https://doi.org/10.1177/104063870501700206
Deka D, Phukan A, Sarma DK (2013). Epidemiology of parvovirus and coronavirus infections in dogs in Assam. Indian Vet. J., (9): 49-51. https://www.researchgate.net/publication/311538022_Epidemiology_of_parvovirus_and_corona_virus_infections_in_dogs_in_Assam
Franzo G, Mira F, Schirò G, Canuti M (2023). Not Asian anymore: Reconstruction of the history, evolution, and dispersal of the “Asian” Lineage of CPV-2c. Viruses., 15(9): 1962. https://doi.org/10.3390/v15091962
Giraldo-Ramirez S, Rendon-Marin S, Ruiz-Saenz J (2020). Phylogenetic, evolutionary and structural analysis of canine parvovirus (CPV-2) antigenic variants circulating in Colombia. Viruses, 12(5): 500. https://doi.org/10.3390/v12050500
Goetschius DJ, Hartmann SR, Organtini LJ, Callaway H, Huang K, Bator CM, Ashley RE, Makhov AM, Conway JF, Parrish CR, Hafenstein SL (2021). High-resolution asymmetric structure of a Fab–virus complex reveals overlap with the receptor binding site. Proc. Natl. Acad. Sci. USA, 118(23): e2025452118. https://doi.org/10.1073/pnas.2025452118
Hao X, Li Y, Xiao X, Chen B, Zhou P, Li S (2022). The changes in canine parvovirus variants over the years. Int. J. Mol. Sci., 23(19): 11540. https://doi.org/10.3390/ijms231911540
Hasan M, Jalal M, Bayzid M, Sharif M, Masuduzzaman M (2016). A comparative study on canine parvovirus infection of dog in Bangladesh and India. Bangladesh J. Vet. Med., 14(2): 237-241. https://doi.org/10.3329/bjvm.v14i2.31403
Hasan R, Das CR, Akther KA, Hossain MM (2024). Disease prevalence in pets at various pet hospitals in Bangladesh. Sch. J. Agric. Vet. Sci., 7: 121-132. https://doi.org/10.36347/sjavs.2024.v11i07.002
Hasan T, Bairagi N, Hossan MM (2018). Prevalence of canine parvovirus infection in dog in relation to CVASU, Bangladesh and VCRI-MVC, India. Int. J. Curr. Res., 10(4): 67720-67725.
Hasib FY, Akter S, Chowdhury S (2021). First report of canine parvovirus molecular detection in Bangladesh. Vet. World, 14(4): 1038. https://doi.org/10.14202/vetworld.2021.1038-1043
Hasib FY, Kabir MH, Barua S, Akter S, Chowdhury S (2020). Frequency and prevalence of clinical conditions and therapeutic drugs used in dog and cat at Teaching Veterinary Hospital, Chattogram Veterinary and Animal Sciences University. J. Adv. Vet. Anim. Res., 7(1): 156. https://doi.org/10.5455/javar.2020.g405
Islam MR, Islam MA, Rahman MS, Uddin MJ, Sarker MA, Akter L, Alam E (2014). Prevalence of canine parvovirus infection in street dogs in Mymensingh Municipality area, Bangladesh. Microbes Health, 3(1): 5-6. https://doi.org/10.3329/mh.v3i1.19768
Jayappa K, Rajkhowa TK, Gaikwad SS (2024). Canine parvovirus in North-East India: A phylogenetic and evolutionary analysis. Vet. Q., 44(1): 1-13. https://doi.org/10.1080/01652176.2024.2408742
Kwan E, Carrai M, Lanave G, Hill J, Parry K, Kelman M, Meers J, Decaro N, Beatty JA, Martella V, Barrs VR (2021). Analysis of canine parvoviruses circulating in Australia reveals predominance of variant 2b and identifies feline parvovirus-like mutations in the capsid proteins. Transbound. Emerg. Dis., 68(2): 656-66. https://doi.org/10.1111/tbed.13727
López-Astacio RA, Adu OF, Lee H, Hafenstein SL, Parrish CR (2023). The Structures and Functions of Parvovirus Capsids and Missing Pieces: the Viral DNA and Its Packaging, Asymmetrical Features, Nonprotein Components, and Receptor or Antibody Binding and Interactions. J. Virol., 97(7): e00161-23. https://doi.org/10.1128/jvi.00161-23
Mazzaferro EM (2020). Update on canine parvoviral enteritis. Vet. Clin. North Am. Small. Anim. Pract., 50(6): 1307. https://doi.org/10.1016/j.cvsm.2020.07.008
Mochizuki M, Gabriel MCS, Nakatani H, Yoshida M, Harasawa R (1993). Comparison of polymerase chain reaction with virus isolation and haemagglutination assays for the detection of canine parvoviruses in faecal specimens. Res. Vet. Sci., 55(1): 60–63. https://doi.org/10.1016/0034-5288(93)90035-E
Mylonakis ME, Kalli I, Rallis TS (2016). Canine parvoviral enteritis: an update on the clinical diagnosis, treatment, and prevention. Vet. Med. Res. Rep., 7: 91-100. https://doi.org/10.2147/VMRR.S80971
Nahat FW, Rahman MS, Sarker RR, Hassan MK, Hasan AZ, Akter L, Islam MA (2015). Prevalence of canine parvo virus infection in street dogs using rapid antigen detection kit. Res. Agric. Livest. Fish., 2(3): 459-464. https://doi.org/10.3329/ralf.v2i3.26169
Nızamı TA, Al Sattar A, Akter S, Rahman MH, Chisty NN, Chowdhury MY, Hoque MA (2020). Clinico-epidemiological Inspection of Canine Parvoviral Enteritis at Teaching Veterinary Hospital of Chattogram Veterinary and Animal Sciences University. Turk. Vet. J., 2(2): 45-53.
Qi S, Zhao J, Guo D, Sun D (2020). A mini-review on the epidemiology of canine parvovirus in China. Front. Vet. Sci., 7: 5. https://doi.org/10.3389/fvets.2020.00005
Roy S, Ahmed SU, Alam S, Chowdhury QM, Sujaur M, Popy FY, Sharma B, Basit MS, Ahmed J (2018). Prevalence of canine parvoviral enteritis in pet dogs at Dhaka city of Bangladesh. Int. J. Biol. Res., 6: 14-17. https://doi.org/10.14419/ijbr.v6i1.9374
Saitou N, Nei M (1987). The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol., 4(4): 406-425.
Sen S, Rahman MS, Nag M, Rahman MM, Sarker RR, Kabir SL (2016). Prevalence of canine parvo virus and canine influenza virus infection in dogs in Dhaka, Mymensingh, Feni and Chittagong districts of Bangladesh. Asian J. Med. Biol. Res., 2(1): 138-142. https://doi.org/10.3329/ajmbr.v2i1.27579
Sharma S, Dhar P, Thakur A, Sharma V, Sharma M (2016). First detection of canine parvovirus type 2b from diarrheic dogs in Himachal Pradesh. Vet. World, 9(9): 964. https://doi.org/10.14202/vetworld.2016.964-969
Shima FK, Apaa TT, Mosugu JI (2015). Epidemiology of canine parvovirus enteritis among hospitalized dogs in Effurun/Warri Metropolitan Region of Delta State, Nigeria. Open Access Lib. J., 2(01): 1-7. https://doi.org/10.4236/oalib.1101208
Sullivan LA (2019). Parvoviral enteritis: What’s new? Adv. Small. Anim. Med. Surg., 32: 1-3. https://doi.org/10.1016/j.asams.2019.11.001
Sultana RN, Uddin AS, Asmaul H, Yesmin RN, Sabina Y, ATM B, Sadikul IM, Monira N, Jahengir AK (2016). Prevalence of diseases in pet animals at Dhaka city of Bangladesh. Ann. Vet. Anim. Sci., 3: 1-5.
Takano T, Hamaguchi S, Hasegawa N, Doki T, Soma T (2021). Predominance of canine parvovirus 2b in Japan: An epidemiological study during 2014-2019. Arch. Virol., 166(11): 3151-3156. https://doi.org/10.1007/s00705-021-05200-0
Tinky SS, Ambily R, Nair SR, Mini M (2015). Utility of a rapid immunochromatographic strip test in detecting canine parvovirus infection compared with polymerase chain reaction. Vet. World, 8(4): 523. https://doi.org/10.14202/vetworld.2015.523-52