Special Issue:
Emerging and Re-emerging Animal Health Challenges in Low and Middle-Income Countries
Use of Multiplex PCR for Detection of Campylobacter spp. and their Virulence Factors in Aborted Ewes
Hayder Abdul-Kareem Al-Mutar1* Masar Saab Kadhim2 , Nawaf Nooraldeen Dhaher3, Maythem Abdulealah Ismaeel3
1Department of Surgery and Obstetric, College of Veterinary Medicine, University of Baghdad, Baghdad, Iraq; 2Department of Surgery and Obstetric, College of Veterinary Medicine, Al-Qadisiyah University, Iraq; 3Department of Medicine, Surgery and Obstetrics, Veterinary Medicine, Tikrit University, Iraq.
Abstract | The current study aimed to detect and map virulent factors of Campylobacter spp. from aborted ewes. A total of 80 samples were collected from aborted ewes (28 from stomach contain of aborted fetus and 52 vaginal swabs collected from aborted ewes in period not more than 48 hours after abortion). Total, DNA extraction followed by multiplex PCR showed that Campylobacter fetus infection rate was 13.7% (11:80) while Campylobacter Jejuni was detected in 3.7% (3:80). Additionally, detection of cadF, cdtB and cdtC gene was confirmed in 100%, 78.5% and 85.7%, respectively while Iam1 gene was detected with rate of 7.1%. Taken together, Campylobacter spp. is an important cause of abortion in ewes and Campylobacter adherence gene (CadF) was detected the most frequent gene detection. Campylobacteriosis is the leading cause of ewe abortion in the area. C. fetal is the most pathogenic Campylobacter species in our region, affecting 17.5% of ewes.
Keywords | Campylobacter spp., Aborted ewes, Virulence factor
Received | September 07, 2025; Accepted | October 18, 2025; Published | October 28, 2025
*Correspondence | Hayder Abdul-Kareem Al-Mutar, Department of Surgery and Obstetric, College of Veterinary Medicine, University of Baghdad, Baghdad, Iraq; Email: [email protected]
Citation | Al-Mutar HAK, Kadhim MS, Dhaher NN, Ismaeel MA (2025). Use of multiplex PCR for detection of Campylobacter spp. and their virulence factors in aborted ewes. J. Anim. Health Prod. 13(s1): 701-705.
DOI | https://dx.doi.org/10.17582/journal.jahp/2025/13.s1.701.705
ISSN (Online) | 2308-2801
Copyright: 2025 by the authors. Licensee ResearchersLinks Ltd, England, UK.
This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Introduction
Campylobacteriosis is a zoonotic disease, infecting sheep, goat, cattle and human. In human, it causes enteritis, while in sheep and cattle causes reproductive disease (Hlashwayo et al., 2020). Campylobacteriosis in sheep, goats and cattle may cause enteric diseases, which is characterized by watery or bile-streaked diarrhea or may contain blood or mucoid, vomiting and sometimes fever. Other important disease caused by Campylobacter spp. is reproductive disease (Hagos et al., 2021). Campylobacter fetus or Campylobacter jejuni cause abortion in the late stage of pregnancy with gross lesions in the placenta and can cause stillbirths and weak lambs, sometime these cases followed by metritis (Mewari and Chauhan, 2020). Campylobacter sheds in vaginal discharges, aborted fetuses and fetal membranes of aborting sheep (Souhayla et al., 2017; Büyük et al., 2020). Main pathological changes include subcutaneous edema, and in rarely cases blood-stained fluid showed on body cavities, yellow or dark brown exudate and necrotic plaques may be observed on fetal cotyledons, and oedema may occur in the inter-cotyledonary areas (Abdulameer and Saleem, 2018; Rush and Edmondson, 2021). Campylobacter carry many virulence factors, like cytolethal distending toxin B (cdtB), which broadly spared among gram negative bacteria and
Table 1: Primers used in the current study for detection of Campylobacter spp.
|
Gene name |
Sequences |
Product size |
References |
|
|
Campylobacter fetus |
F |
5-GGAAGCCGCAGCTGCTAAGAT-3 |
359 |
Persson and Olsen, 2005 |
|
R |
5-AGCCAGTAACGCATATTATAGTAG-3 |
|||
|
Campylobacter Jejuni |
F |
5-CAAATAAAGTTAGAGGTAGAATGT-3 |
161 |
|
|
R |
5-CCATAAGCACTAGCTAGCTGA T-3 |
|||
|
Campylobacter adherence gene (CadF) |
F |
TTGAAGGTAATTTAGATATG |
400 |
Yoon, 1999 |
|
R |
CTAATACCTAAAGTTGAAAC |
|||
|
Cytolethal-distending-toxin subunit-B gene (CdtB) |
F |
GTTGGCACTTGGAATTTGCAAGGC |
495 |
Bang et al., 2003 |
|
R |
GTTAAAATCCCCTGCTATCAACCA |
|||
|
Cytolethal-distending-Toxin subunit-C (CdtC) |
F |
CGATGAGTTAAAACAAAAAGATA |
182 |
Rozynek et al., 2005 |
|
R |
TTGGCATTATAGAAAATACAGTT |
|||
|
Invasio´n-associated marker 1 (Iam1) |
F |
GCGCAAAATATTATCACCC |
512 |
Rozynek et al., 2005 |
|
R |
TTCACGACTACTATGCGG |
|||
cause damage and subsequent death on membranes of host cell (Shams et al., 2016). Campylobacter has ability to adhere to host epithelial cell, this process encoded by fibronectin F (cadF) and fibronectin is brokered by CadF fibronectin binding outer membrane protein (Konkel et al., 1997), and the heat survival and stress response proteins htrB and clpP, which are important for survival (Elhadidy et al., 2018).
This study aims to identify and characterize campylobacter species from aborted ewes and to determine the antibiotic resistance markers for the selection of antibiotic use in livestock.
Materials and Methods
A total of 80 samples were collected from aborted ewes (28 from stomach contain of aborted fetus and 52 vaginal swabs collected from aborted ewes in period not more than 48hours after abortion). DNA extraction was using Intron kit on isolate from stomach contain of aborted fetus and vaginal swabs. The PCR amplification was performed using the primers mentioned in Table 1 to detect and confirm Campylobacter spp. and virulence factors.
Table 2: Number and ratio of Campylobacter spp detected in current study.
|
Campylobacter spp. |
Number of samples |
Number of detection case |
Rate of detection |
|
Campylobacter fetus |
80 |
11 |
13.7% |
|
Campylobacter Jejuni |
3 |
3.7% |
|
|
Total |
14 |
17.5% |
Results and Discussion
Out of 80-abortion sample, Campylobacter fetus was detected 13.7% (11/80) of samples while Campylobacter Jejuni was detected in 3.7% (3/80) as in Table 2 and Figure 1.
The result of current study differed than result of a previous study (Hamali et al., 2014), where authors have detected of C. fetus subsp. fetus and C. jejuni with a rate of 9% and 1.5% respectively. In another study, (Rizzo et al., 2015) authors have detected of campylobacter spp. with a rate of 3.5%. This difference might be due to difference in the geographical region, number of samples, clinical signs, age and species of animals. The detection of Campylobacter spp. in abortion case endorses that campylobacter spp. is one of important etiology of abortion in sheep. Many studies (Mannering et al., 2006; Chon et al., 2020; Dorsch et al., 2021; Şevik, 2021), detected Campylobacter spp. from abortion ewes. C. fetus and of C. jejuni caused infertility, early embryonic death and a prolonged lambing season. C. fetus caused abortion in the lasted pregnancy period, stillbirths and weak lambs. In some cases, metritis and occasionally deaths may occur (Dawson et al., 2020). Our findings showed that the detection rate of C. fetus more than detection rate of C. jejun, which agreed with result of another study (Tamura and Kumar, 2004). The application of multiplex PCR for
Table 3: Number and Rate of Campylobacter spp isolates possessing virulence factor.
|
Campylobacter virulence factors |
Total isolate |
DNA out product size |
Number of isolates possessing virulence factor |
Rate of isolates possessing virulence factor |
|
Campylobacter adherence gene (cadF) |
14 |
400 |
14 |
100% |
|
Cytolethal distending toxin subunit B gene (cdtB) |
14 |
495 |
11 |
78.5% |
|
Cytolethal distending Toxin subunit c (cdtC) |
14 |
182 |
12 |
85.7% |
|
Invasio´n-associated marker 1 (Iam1) |
14 |
512 |
1 |
7.1% |
the detection of campylobacter virulence revealed that cadF, cdtB and cdtC were detected with a rate of 100%, 78.5% and 85.7% respectively while Iam1 detection rate was 7.1% as in Table 3 and Figure 2.
The UPGMA method was used to infer evolutionary history, the optimum A tree having a total of branches lengths of 0.06369197 was depicted. The tree was displayed in scale, with lengths of branches (below the branches) in the same units as the evolutionary distances employed. To reconstruct the genomic tree, the evolutionary distances were calculated using the maximal composite likelihood approach (Tamura et al., 2013) and were expressed in terms of base substitutions made at each site. There were 13 nucleotide sequences in the analysis. The codon locations listed were first, second, third, non-coding. Every position with gaps or the missed information was deleted. The final dataset contained a total of 560 locations. MEGA6.0 was used to carry out evolutionary analyses (Igwaran and Okoh, 2020) Figure 3. The appearance of this virulence factors agreed with study conducted previously (Lluque et al., 2017; Ghunaim et al., 2015). The cadF is one of important genes, which is responsible for heat survival, and translate a protein necessary for adhesion and invasion (García-Sánchez et al., 2018). The cdtB genes is tripartite and fully functional toxin and plays function in causing harm to cells that caused dame in mucosa, Additionally, it has DNaseI-like activity which caused break down of double strand DNA (Al-Mutar, 2017). the cdtC gene is cytotoxin, causes cell distraction by DNA damage, chromatin and fragmentation (Ghorbanalizadgan et al., 2018). In the current study C. jejuni was isolated in low rate, proportionate to Iam1 gene which was also detected in the lowest rate This supports the scientific references that refer to that Iam1 is frequency in C. jejuni (Rozynek et al., 2005).
Conclusion
Campylobacteriosis is the leading cause of ewe abortion in the area. C. fetal is the most pathogenic Campylobacter species in the studied region, affecting 17.5% of ewes.
ACKNOWLEDGEMENT
The author appreciates the laboratory facilities offered by the College of Veterinary Medicine, University of Baghdad; Al-Qadisiyah and Tikrit.
NOVELTY STATEMENT
This study introduces an innovative approach to clinical besides genetic analysis of bacteria in aborted ewes, and determines the antibiotic resistance.
AUTHOR’S CONTRIBUTION
This study was designed and written by the authors.
Funding
None.
Data availability
The publication includes all datasets created and analyzed during the investigation.
Ethics statement
Not applicable.
Generative AI and AI-assisted technology statement
The authors acknowledge that the primary purpose of generative AI tools (such as ChatGPT and software language editing) is to improve formatting, grammar, and language clarity. No artificial intelligence (AI) techniques were employed for data interpretation, analysis, or scientific conclusion-making. The content of this article is entirely the writer’s responsibility.
Conflict of interest
The author have declared no conflict of interest.
References
Abdulameer JA, Saleem AH (2018). Epidemiological study of thermophlic Campylobacter isolated from diarrheic and non-diarrheic cows in Baghdad governorate. Iraqi J. Vet. Med., 42(1): 105-113. https://doi.org/10.30539/iraqijvm.v42i1.39
Al-Mutar HA (2017). Investigation the polymorphism of gonadotropin releasing hormone receptor gene in Iraq sheep. Iraqi J. Vet. Med., 41(1): 138-144. https://doi.org/10.30539/iraqijvm.v41i1.96
Bang DD, Neilsen EM, Scheutz F, Pedersen K, Handberg K, Madsen M (2003). PCR detection of seven virulence and toxin genes of Campylobacter jejuni and Campylobacter coli isolates from Danish pigs and cattle and cytolethal distending toxin production of the isolates. J. Appl. Microbiol., 94(6): 1003-1014. https://doi.org/10.1046/j.1365-2672.2003.01926.x
Büyük F, Özgen EK, Karakurt E, Coşkun MR, Büyük E, Özmen M, Şahin M (2020). Accomplished management of chlamydophila abortus-induced enzootic sheep abortions: The case of şavşat (Turkey). Kafkas Üniv. Vet. Fakültesi Dergisi, 26(6).
Chon JW, Seo KH, Kim B, Jeong D, Song KY (2020). Advanced methods for isolating from and confirming Campylobacter spp. in milk and dairy products. J. Dairy Sci. Biotechnol., 38(3): 121-133. https://doi.org/10.22424/jdsb.2020.38.3.121
Dawson LJ, Shipley CF, Merkel R, Pugh DG (2020). Herd and flock health. Sheep, goat, and cervid medicine-E-Book, pp. 479. https://doi.org/10.1016/B978-0-323-62463-3.00028-1
Dorsch MA, Casaux ML, Calleros L, Aráoz V, Caffarena RD, Monesiglio C, Giannitti F (2021). Placentitis and abortion caused by a multidrug resistant strain of Campylobacter fetus subspecies fetus in a sheep in Uruguay. Rev. Argent. Microbiol., https://doi.org/10.1016/j.ram.2021.02.005
Elhadidy M, Miller WG, Arguello H, Álvarez-Ordóñez A, Duarte A, Dierick K (2018). Genetic basis and clonal population structure of antibiotic resistance in Campylobacter jejuni isolated from broiler carcasses in Belgium. Front. Microbiol., 9: 1014. https://doi.org/10.3389/fmicb.2018.01014
García-Sánchez L, Melero B, Rovira J (2018). Campylobacter in the food chain. Adv. Food Nutr. Res., 86: 215-252. https://doi.org/10.1016/bs.afnr.2018.04.005
Ghorbanalizadgan M, Bakhshi B, Najar-Peerayeh S (2018). Heterogeneity of cytolethal distending toxin sequence types of Campylobacter jejuni and correlation to invasion/cytotoxicity potential: The first molecular survey from Iran. Microb. Pathogen., 114: 213-218. https://doi.org/10.1016/j.micpath.2017.11.035
Ghunaim H, Behnke JM, Aigha I, Sharma A, Doiphode SH, Deshmukh A (2015). Analysis of resistance to antimicrobials and presence of virulence/stress response genes in Campylobacter isolates from patients with severe diarrhoea. PLoS One, 10(3): e0119268. https://doi.org/10.1371/journal.pone.0119268
Hagos Y, Gugsa G, Awol N, Ahmed M, Tsegaye Y, Abebe N, Bsrat A (2021). Isolation, identification, and antimicrobial susceptibility pattern of Campylobacter jejuni and Campylobacter coli from cattle, goat, and chicken meats in Mekelle, Ethiopia. PLoS One, 16(2): e0246755. https://doi.org/10.1371/journal.pone.0246755
Hamali H, Fallah S, Joozani RJ, Zare P, Noorsaadat G (2014). Detection of Campylobacter spp. in sheep aborted fetuses by PCR. Trends Life Sci., 3(2): 49-56.
Hlashwayo DF, Sigaúque B, Bila CG (2020). Epidemiology and antimicrobial resistance of Campylobacter spp. in animals in Sub-Saharan Africa: A systematic review. Heliyon, 6(3): e03537. https://doi.org/10.1016/j.heliyon.2020.e03537
Igwaran A, Okoh AI (2020). Occurrence, virulence and antimicrobial resistance-associated markers in campylobacter species isolated from retail fresh milk and water samples in two district municipalities in the eastern cape province, South Africa. Antibiotics, 9(7): 426. https://doi.org/10.3390/antibiotics9070426
Konkel ME, Garvis SG, Tipton SL, Anderson Jr, DE, Cieplak Jr W (1997). Identification and molecular cloning of a gene encoding a fibronectin-binding protein (CadF) from Campylobacter jejuni. Mol. Microbiol., 24: 953-963. https://doi.org/10.1046/j.1365-2958.1997.4031771.x
Lluque A, Riveros M, Prada A, Ochoa TJ, Ruiz J (2017). Virulence and antimicrobial resistance in Campylobacter spp. from a Peruvian pediatric cohort. Scientifica. https://doi.org/10.1155/2017/7848926
Mannering SA, West DM, Fenwick SG, Marchant RM, O’Connell K (2006). Pulsed-field gel electrophoresis of Campylobacter jejuni sheep abortion isolates. Vet. Microbiol., 115(1-3): 237-242. https://doi.org/10.1016/j.vetmic.2006.01.005
Mewari NS, Chauhan RS (2020). Immunopathology of abortions. An overview. J. Immunol. Immunopathol., 22(si1): 92-127. https://doi.org/10.5958/0973-9149.2020.00011.8
Persson S, Olsen KE (2005). Multiplex PCR for identification of Campylobacter coli and Campylobacter jejuni from pure cultures and directly on stool samples. J. Med. Microbiol., 54(11): 1043-1047. https://doi.org/10.1099/jmm.0.46203-0
Rizzo H, Gregory L, Beraldi F, de Carvalho AF, Pinheiro ES (2015). Campylobacter isolation from the feces of sheep with a history of reproductive disorders bred in the state of São Paulo, Brazil. Semina: Ciências Agrárias, 36(2): 4207-4214. https://doi.org/10.5433/1679-0359.2015v36n6Sup2p4207
Rozynek E, Dzierzanowska-Fangrat K, Jozwiak P, Popowski J, Korsak D, Dzierzanowska D (2005). Prevalence of potential virulence markers in Polish Campylobacter jejuni and Campylobacter coli isolates obtained from hospitalized children and from chicken carcasses. J. Med. Microbiol., 54(7): 615-619. https://doi.org/10.1099/jmm.0.45988-0
Rush JB, Edmondson MA (2021). Infectious agents: Campylobacter. Bovine Reprod., pp. 717-724. https://doi.org/10.1002/9781119602484.ch57
Şevik M (2021). Genomic characterization of pestiviruses isolated from bovine, ovine and caprine foetuses in Turkey: A potentially new genotype of Pestivirus I species. Transbound. Emerg. Dis., 68(2): 417-426. https://doi.org/10.1111/tbed.13691
Shams S, Bakhshi B, Moghadam T (2016). In silico analysis of the cadF gene and development of a duplex polymerase chain reaction for species-specific identification of Campylobacter jejuni and Campylobacter coli. Jundishapur J. Microbiol., 9(2): e29645. https://doi.org/10.5812/jjm.29645
Souhayla OH, Kreem IA, Sadeq JZ, Ahmed MM (2017). Activity of transaminase enzyme and testosterone hormone in blood of Awassi rams during different season. Asian Pac. J. Reprod., 6(5): 217-220. https://doi.org/10.4103/2305-0500.215932
Tamura K, Nei M, Kumar S (2004). Prospects for inferring very large phylogenies by using the neighbor-joining method. Proc. Natl. Acad. Sci. USA, 101: 11030-11035. https://doi.org/10.1073/pnas.0404206101
Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013). MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol., 30: 2725-2729. https://doi.org/10.1093/molbev/mst197
Yoon J (1999). Identification of the enteropathogens Campylobacter jejuni and Campylobacter coli based on the cadF virulence gene and its product. J. Clin. Microbiol., 37(3): 510-517. https://doi.org/10.1128/JCM.37.3.510-517.1999